Restriction Map of BCY1/YIL033C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

BCY1/YIL033C on chromosome IX from coordinates 291669 to 290419.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.4109

EMBOSS_001 Cac8I | CviJI StyI | | TspEI SecI* | | | CviRI* | TfiI | | | | Tsp4CI* | HinfI | | | | | Hpy178III* \ \ \ \ \ \ \ \ ATGGTATCTTCTTTGCCCAAGGAATCGCAAGCCGAATTGCAACTGTTCCAGAACGAAATC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCATAGAAGAAACGGGTTCCTTAGCGTTCGGCTTAACGTTGACAAGGTCTTGCTTTAG / / / / // / / / | | | CviJI || | | TspGWI | | Cac8I || | Hpy178III* | HinfI || Tsp4CI* | TfiI |CviRI* SecI* TspEI StyI M V S S L P K E S Q A E L Q L F Q N E I W Y L L C P R N R K P N C N C S R T K S G I F F A Q G I A S R I A T V P E R N Q ----:----|----:----|----:----|----:----|----:----|----:----| X T D E K G L S D C A S N C S N W F S I X P I K K A W P I A L R I A V T G S R F H Y R R Q G L F R L G F Q L Q E L V F D TspGWI | AciI | BisI | |BlsI | ||TauI | ||| Eco57I | ||| Eco57MI | ||| | MboII | ||| | | Hpy188I | ||| | | | EciI AciI MmeI CviJI \ \\\ \ \ \ \ \ \ \ AACGCCGCTAATCCGTCCGACTTTCTTCAGTTCTCCGCCAACTATTTCAATAAAAGGCTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCGGCGATTAGGCAGGCTGAAAGAAGTCAAGAGGCGGTTGATAAAGTTATTTTCCGAC ///// / / / / / / ||||| | | EciI | MmeI CviJI ||||| | Hpy188I AciI BplI ||||| MboII BplI ||||Eco57MI ||||Eco57I |||AciI ||BisI |BlsI TauI N A A N P S D F L Q F S A N Y F N K R L T P L I R P T F F S S P P T I S I K G W R R * S V R L S S V L R Q L F Q * K A G ----:----|----:----|----:----|----:----|----:----|----:----| L A A L G D S K R * N E A L * K L L L S * R R * D T R S E E T R R W S N * Y F A V G S I R G V K K L E G G V I E I F P Q BssKI CviJI EcoRII HaeIII |SecI* ||ScrFI ||BseBI |||MnlI |||| NlaIV |||| |CviJI |||| ||BplI |||| ||BplI BplI |||| ||| ApoI BplI |||| ||| TspEI | Bce83I* SmlI |||| ||| | MseI \ \ \ \\\\ \\\ \ \ GAACAACAGAGAGCGTTCCTCAAGGCCAGGGAGCCTGAATTTAAGGCAAAGAACATTGTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTTGTCTCTCGCAAGGAGTTCCGGTCCCTCGGACTTAAATTCCGTTTCTTGTAACAA / / / //// // / / Bce83I* | | |||| |CviJI | MseI | | |||| NlaIV TspEI | | |||EcoRII ApoI | | |||BssKI | | |||SecI* | | ||BplI | | ||BplI | | |BseBI | | |ScrFI | | MnlI | HaeIII | CviJI SmlI E Q Q R A F L K A R E P E F K A K N I V N N R E R S S R P G S L N L R Q R T L F T T E S V P Q G Q G A * I * G K E H C S ----:----|----:----|----:----|----:----|----:----|----:----| S C C L A N R L A L S G S N L A F F M T P V V S L T G * P W P A Q I * P L S C Q F L L S R E E L G P L R F K L C L V N N BetI* BspMII* PleI BinI* |HpaII |MlyI AluI | Hpy178III* |Hpy178III* ||Hpy178III* CviJI | | MboI || MnlI ||| BseRI |MnlI | | XhoII || | NlaIV HinfI ||| | SetI ||SetI | | | DpnI \\ \ \ \ \\\ \ \ \\\ \ \ \ \ CTATTTCCGGAACCAGAGGAGTCATTTTCCAGACCTCAATCAGCTCAATCTCAATCAAGA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GATAAAGGCCTTGGTCTCCTCAGTAAAAGGTCTGGAGTTAGTCGAGTTAGAGTTAGTTCT //// / // // / / / /// |||NlaIV HinfI || |SetI | CviJI | ||DpnI ||BspMII* || | | MnlI | |BstKTI ||BetI* || | | AluI | Hpy178III* |Hpy178III* || | SetI BinI* |HpaII || Hpy178III* MnlI |BseRI PleI MlyI L F P E P E E S F S R P Q S A Q S Q S R Y F R N Q R S H F P D L N Q L N L N Q D I S G T R G V I F Q T S I S S I S I K I ----:----|----:----|----:----|----:----|----:----|----:----| R N G S G S S D N E L G * D A * D * D L E I E P V L P T M K W V E I L E I E I L * K R F W L L * K G S R L * S L R L * S MnlI |BsaXI |Hin4I BstKTI || Hpy166II |Hpy178III* || | AsuI* ||BsaBI || | AvaII |||MboI || | DraII MaeII |||| DpnI || | PpuMI AflIII |||| |TaqI || | |BmgT120I | SetI |||| |BstKTI || | ||NlaIV | TaiI \\\\ \\ \\ \ \\\ \ \ TCCAGATCGAGTGTTATGTTCAAATCCCCCTTTGTGAACGAGGACCCACACTCCAACGTG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTCTAGCTCACAATACAAGTTTAGGGGGAAACACTTGCTCCTGGGTGTGAGGTTGCAC ///// // / // / // / / / ||||| |TaqI | || | |PpuMI | | AflIII ||||| MboI | || | |DraII | MaeII ||||DpnI | || | |AvaII TaiI |||BstKTI | || | |AsuI* SetI ||Hpy178III* | || | BmgT120I |BsaBI | || | NlaIV XhoII | || Hpy166II MboI | |MnlI | BsaXI Hin4I S R S S V M F K S P F V N E D P H S N V P D R V L C S N P P L * T R T H T P T C Q I E C Y V Q I P L C E R G P T L Q R V ----:----|----:----|----:----|----:----|----:----|----:----| D L D L T I N L D G K T F S S G C E L T I W I S H * T * I G R Q S R P G V S W R G S R T N H E F G G K H V L V W V G V H MseI |AhaIII* MseI ||BsaXI |TspEI FauI ||| Hin4I || MmeI AciI | HphI Cac8I \\\ \ \\ \ \ \ \ \ TTTAAAAGTGGGTTTAATTTAGACCCGCACGAACAGGACACTCACCAGCAAGCACAGGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTTTCACCCAAATTAAATCTGGGCGTGCTTGTCCTGTGAGTGGTCGTTCGTGTCCTT / // // / / // / | |MseI || TspEI AciI |FauI Cac8I | AhaIII* |MseI HphI Hin4I MmeI BsaXI F K S G F N L D P H E Q D T H Q Q A Q E L K V G L I * T R T N R T L T S K H R K * K W V * F R P A R T G H S P A S T G R ----:----|----:----|----:----|----:----|----:----|----:----| N L L P N L K S G C S C S V * W C A C S T * F H T * N L G A R V P C E G A L V P K F T P K I * V R V F L V S V L L C L F MnlI |BsaXI MboII || Hin4I | MaeI || |CviRI* | |BsaXI || || FalI | |Hin4I BseRI || || FalI \ \\ \ \\ \\ \ GAACAACAGCATACTAGAGAAAAGACATCAACTCCTCCACTCCCAATGCACTTCAACGCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTTGTCGTATGATCTCTTTTCTGTAGTTGAGGAGGTGAGGGTTACGTGAAGTTGCGG // / / / // // || | MaeI BseRI |MnlI |FalI || BsaXI Hin4I |FalI |Hin4I BsaXI CviRI* MboII E Q Q H T R E K T S T P P L P M H F N A N N S I L E K R H Q L L H S Q C T S T P T T A Y * R K D I N S S T P N A L Q R P ----:----|----:----|----:----|----:----|----:----|----:----| S C C C V L S F V D V G G S G I C K L A L V V A Y * L F S M L E E V G L A S * R F L L M S S F L C * S R W E W H V E V G TspEI | GsuI | Eco57MI | | Hin4I | | Hin4I Csp6I BsmAI FalI SetI | | | MlyI |RsaI Eco31I FalI | HphI | | | PleI HinfI \\ \ \ \ \ \ \ \ \ \ CAAAGGCGTACTTCTGTTAGTGGTGAGACCTTACAACCAAACAATTTTGACGATTGGACT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCCGCATGAAGACAATCACCACTCTGGAATGTTGGTTTGTTAAAACTGCTAACCTGA // / / / / // / // / |Csp6I | | SetI HphI || | |PleI HinfI RsaI | Eco31I || | MlyI | BsmAI || TspEI FalI |Hin4I FalI |Hin4I Eco57MI GsuI Q R R T S V S G E T L Q P N N F D D W T K G V L L L V V R P Y N Q T I L T I G L K A Y F C * W * D L T T K Q F * R L D S ----:----|----:----|----:----|----:----|----:----|----:----| W L R V E T L P S V K C G F L K S S Q V G F A Y K Q * H H S R V V L C N Q R N S L P T S R N T T L G * L W V I K V I P S Hin4I Hin4I | Hpy188I | | TseI | | |BisI TspGWI | | ||BlsI |BsrI | | ||| MfeI ||BinI* | | ||| TspEI ||| TaqI Hpy178III* | | ||| | MwoI ||| ClaI | MboI | | ||| | BstAPI ||| |MboI | | DpnI | | ||| | | CviRI* ||| || DpnI | | |BstKTI | | ||| | | | BbvI ||| || |BstKTI \ \ \\ \ \ \\\ \ \ \ \ \\\ \\ \\ CCAGATCACTATAAGGAAAAGTCCGAGCAGCAATTGCAAAGACTGGAAAAATCGATCCGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTAGTGATATTCCTTTTCAGGCTCGTCGTTAACGTTTCTGACCTTTTTAGCTAGGCA /// / / / /// // /// / // / ||| MboI Hin4I | ||| |CviRI* ||| | || MboI ||DpnI Hin4I | ||| TspEI ||| | |DpnI |BstKTI | ||| MfeI ||| | BstKTI Hpy178III* | ||BstAPI ||| | ClaI | ||MwoI ||| | TaqI | ||TseI ||| BinI* | |BisI ||BsrI | BlsI |TspGWI Hpy188I BbvI P D H Y K E K S E Q Q L Q R L E K S I R Q I T I R K S P S S N C K D W K N R S V R S L * G K V R A A I A K T G K I D P * ----:----|----:----|----:----|----:----|----:----|----:----| G S * * L S F D S C C N C L S S F D I R E L D S Y P F T R A A I A F V P F I S G W I V I L F L G L L L Q L S Q F F R D T Hin4I | AluI Hin4I | CviJI | TspEI | | SetI | |Hin4I | | | MlyI | |BsaXI | | | PleI | ||MmeI | | | TfiI | |||MnlI | | | HinfI | |||| BslFI | | | | Hpy188I | |||| Hpy178III* | | | | |HinfI CviJI | |||| | TspGWI \ \ \ \ \\ \ \ \\\\ \ \ AATAACTTTCTGTTCAACAAGCTGGATTCCGACTCAAAAAGGCTGGTCATAAATTGTCTG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTGAAAGACAAGTTGTTCGACCTAAGGCTGAGTTTTTCCGACCAGTATTTAACAGAC / / / // // / // / / / / / / / Hin4I | | || || HinfI || | | | | | | Hpy178III* | | || |Hpy188I || | | | | | TspGWI | | || HinfI || | | | | TspEI | | || TfiI || | | | MnlI | | |PleI || | | MmeI | | MlyI || | BsaXI | CviJI || Hin4I | AluI |Hin4I SetI CviJI N N F L F N K L D S D S K R L V I N C L I T F C S T S W I P T Q K G W S * I V W * L S V Q Q A G F R L K K A G H K L S G ----:----|----:----|----:----|----:----|----:----|----:----| L L K R N L L S S E S E F L S T M F Q R Y Y S E T * C A P N R S L F A P * L N D I V K Q E V L Q I G V * F P Q D Y I T Q BseRI MaeIII | GsuI Tsp45I | Eco57MI BstEII | | BsaXI | SetI | | | SetI | | StyI | | | Hin4I | | SecI* HphI \ \ \ \ \ \ \ \ GAGGAGAAGTCCGTCCCCAAAGGTGCTACGATAATCAAGCAAGGTGACCAAGGGGACTAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTCTTCAGGCAGGGGTTTCCACGATGCTATTAGTTCGTTCCACTGGTTCCCCTGATG / / / // / / / / BslFI | | |SetI SetI | | HphI | | BsaXI | SecI* | | Hin4I | StyI | Eco57MI BstEII | GsuI Tsp45I BseRI MaeIII E E K S V P K G A T I I K Q G D Q G D Y R R S P S P K V L R * S S K V T K G T T G E V R P Q R C Y D N Q A R * P R G L L ----:----|----:----|----:----|----:----|----:----|----:----| S S F D T G L P A V I I L C P S W P S * P P S T R G W L H * S L * A L H G L P S L L L G D G F T S R Y D L L T V L P V V Csp6I |RsaI || Tsp4CI* || | HindII || | Hpy166II DrdI || | | DrdI |MboII || | | |MaeII || SetI || | | || SetI || |HindII BslFI || | | || TaiI || |Hpy166II | TaqI || | | || |HindII || || GsuI | | Hpy99I || | | || |Hpy166II || || Eco57MI \ \ \ \\ \ \ \\ \\ \\ \\ \ TTCTATGTCGTCGAAAAGGGTACTGTTGACTTCTACGTCAACGACAACAAGGTCAACTCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AAGATACAGCAGCTTTTCCCATGACAACTGAAGATGCAGTTGCTGTTGTTCCAGTTGAGA / / / /// / / / / / / / // | | TaqI ||| | | | | | | | |Eco57MI | BslFI ||| | | | | | | | |GsuI Hpy99I ||| | | | | | | | Hpy166II ||| | | | | | | | HindII ||| | | | | | | MboII ||| | | | | | | SetI ||| | | | | | DrdI ||| | | | | Hpy166II ||| | | | | HindII ||| | | | MaeII ||| | | TaiI ||| | | SetI ||| | DrdI ||| Hpy166II ||| HindII ||Tsp4CI* |Csp6I RsaI F Y V V E K G T V D F Y V N D N K V N S S M S S K R V L L T S T S T T T R S T L L C R R K G Y C * L L R Q R Q Q G Q L F ----:----|----:----|----:----|----:----|----:----|----:----| K * T T S F P V T S K * T L S L L T L E S R H R R F P Y Q Q S R R * R C C P * S E I D D F L T S N V E V D V V V L D V R BssKI |HpaII ||ScrFI ||CauII* ||Ksp632I* |||AsuI* ||||BmgT120I |||||BssKI |||||CviJI |||||EcoRII |||||HaeIII CviJI |||||| ScrFI TatI | BsiI* |||||| BseBI Bsp1407I | | TseI |||||| | CviJI |Csp6I | | |BisI |||||| | |NlaIV ||RsaI | | ||BlsI |||||| | || BsrI BsiYI* ||| BbvI | | ||| MnlI \\\\\\ \ \\ \ \ \\\ \ \ \ \\\ \ TCCGGGCCAGGCTCCAGTTTCGGGGAACTTGCTCTTATGTACAACAGCCCTCGTGCTGCC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCCCGGTCCGAGGTCAAAGCCCCTTGAACGAGAATACATGTTGTCGGGAGCACGACGG / // / // / /// // / /// | || | || BsiYI* ||| |CviJI | ||MnlI | || | |NlaIV ||| BbvI | ||TseI | || | |BsrI ||Bsp1407I | |BisI | || | EcoRII ||TatI | BlsI | || | BssKI |Csp6I BsiI* | || | CviJI RsaI | || BseBI | || ScrFI | |AsuI* | Ksp632I* | BmgT120I | HaeIII | BssKI | CviJI CauII* HpaII ScrFI S G P G S S F G E L A L M Y N S P R A A P G Q A P V S G N L L L C T T A L V L P R A R L Q F R G T C S Y V Q Q P S C C H ----:----|----:----|----:----|----:----|----:----|----:----| E P G P E L K P S S A R I Y L L G R A A K R A L S W N R P V Q E * T C C G E H Q G P W A G T E P F K S K H V V A R T S G CviJI | XbaI | SduI | Eco57I | Eco57MI | HgiJII* | |MaeI SetI | |Hpy178III* | Hpy188I | || HphI SetI | | Tsp4CI* | || | MmeI | Hpy188I Tsp4CI* | | | MnlI | || | | CviJI | | Hin4II* \ \ \ \ \ \ \\ \ \ \ \ \ \ ACCGTTGTAGCAACCTCCGACTGTTTGTTGTGGGCTCTAGACAGGCTCACCTTCAGAAAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCAACATCGTTGGAGGCTGACAAACAACACCCGAGATCTGTCCGAGTGGAAGTCTTTT / / / / / / / /// / / / / Tsp4CI* SetI | | MnlI | | ||XbaI | SetI | Hin4II* | Tsp4CI* | | || CviJI Hpy188I Hpy188I | | |Hpy178III* | | |MmeI | | |MaeI | | HphI | Eco57MI | Eco57I | CviJI HgiJII* SduI T V V A T S D C L L W A L D R L T F R K P L * Q P P T V C C G L * T G S P S E K R C S N L R L F V V G S R Q A H L Q K N ----:----|----:----|----:----|----:----|----:----|----:----| V T T A V E S Q K N H A R S L S V K L F W R Q L L R R S N T T P E L C A * R * F G N Y C G G V T Q Q P S * V P E G E S F TseI |BisI ||BlsI |||AluI |||CviJI |||| SetI |||| | Ksp632I* |||| | | BsmAI |||| | | Hpy178III* |||| | | | HinfI |||| | | | | FatI |||| | | | | |CviAII |||| | | | | || MboII |||| | | | | || NlaIII FatI |||| | | | | || | MboI |CviAII |||| | | | | || | | DpnI ||Cac8I |||| | | | MlyI | || | | |BstKTI ||| SphI |||| | | | PleI | || | | ||SapI ||| NspI |||| | | | BbvI | || | | ||Ksp632I* ||| NlaIII \\\\ \ \ \ \ \ \\ \ \ \\\ \\\ \ ATACTTTTGGGCAGCTCTTTCAAGAAGAGACTCATGTATGACGATCTTTTGAAGAGCATG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TATGAAAACCCGTCGAGAAAGTTCTTCTCTGAGTACATACTGCTAGAAAACTTCTCGTAC /// //// / / // // / / / /// ||CviJI |||| BbvI | |FatI || | | | ||FatI ||TseI |||BsmAI | CviAII || | | | |CviAII ||AluI ||PleI | MboII || | | | |BsrI |BisI || NlaIII || | | | Cac8I BlsI || HinfI || | | NlaIII SetI |Hpy178III* || | | NspI |MlyI || | | SphI Ksp632I* || | Ksp632I* || | SapI || MboI |DpnI BstKTI I L L G S S F K K R L M Y D D L L K S M Y F W A A L S R R D S C M T I F * R A C T F G Q L F Q E E T H V * R S F E E H A ----:----|----:----|----:----|----:----|----:----|----:----| I S K P L E K L F L S M Y S S R K F L M F V K P C S K * S S V * T H R D K S S C Y K Q A A R E L L S E H I V I K Q L A H MboII |MaeII ||SplI* ||BsaAI ||SnaBI |||Csp6I McrI* BsrI ||||RsaI |Tsp4CI* | MboII ||||SetI || SfaNI BciVI BsrI | |Ksp632I* ||||TaiI || | MwoI |CviRI* TspRI \ \\ \\\\\ \\ \ \ \\ \ CCAGTTTTGAAGAGTTTGACTACGTACGACCGTGCCAAACTTGCCGATGCACTGGATACC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCAAAACTTCTCAAACTGATGCATGCTGGCACGGTTTGAACGGCTACGTGACCTATGG / / // ////// / / / / / / | Ksp632I* || |||||| | | SfaNI | | BsrI MboII || |||||| | MwoI | CviRI* || |||||| Tsp4CI* TspRI || |||||McrI* BciVI || ||||SplI* || |||Csp6I || ||RsaI || |MaeII || SnaBI || BsaAI |TaiI |SetI MboII P V L K S L T T Y D R A K L A D A L D T Q F * R V * L R T T V P N L P M H W I P S F E E F D Y V R P C Q T C R C T G Y Q ----:----|----:----|----:----|----:----|----:----|----:----| G T K F L K V V Y S R A L S A S A S S V A L K S S N S * T R G H W V Q R H V P Y W N Q L T Q S R V V T G F K G I C Q I G MnlI |HphI || Hpy178III* || |NruI MboI BssKI || |FnuDII* BglII CviJI || || MboI XhoII |HpaII || || BclI | DpnI ||ScrFI || || | DpnI | |BstKTI ||CauII* || || | |BstKTI HphI \ \\ \\\ \\ \\ \ \\ \ AAGATCTACCAGCCGGGTGAAACAATCATTCGCGAGGGTGATCAAGGGGAGAACTTTTAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTAGATGGTCGGCCCACTTTGTTAGTAAGCGCTCCCACTAGTTCCCCTCTTGAAAATA // / / / / // // // / / || XhoII | | BssKI |HphI || || BclI HphI || BglII | CauII* MnlI || || MboI || MboI | HpaII || |DpnI |DpnI | ScrFI || BstKTI BstKTI CviJI |Hpy178III* FnuDII* NruI K I Y Q P G E T I I R E G D Q G E N F Y R S T S R V K Q S F A R V I K G R T F I D L P A G * N N H S R G * S R G E L L F ----:----|----:----|----:----|----:----|----:----|----:----| L I * W G P S V I M R S P S * P S F K * W S R G A P H F L * E R P H D L P S S K L D V L R T F C D N A L T I L P L V K I AluI CviJI | SetI | | Hpy166II | | | AcyI | | | MaeII | | | |ZraI | | | || SetI | | | || TaiI | | | || AatII AsuI* | | | || TspGWI |BmgT120I | | | || |Hin4II* ||CviJI | | | || || DdeI ||HaeIII MseI Csp6I | | | || || |BsmAI |||StyI |TspEI |RsaI | | | || || |Esp3I |||SecI* SetI \\ \\ \ \ \ \\ \\ \\ \\\\ \ TTAATTGAGTACGGAGCTGTGGACGTCTCTAAGAAGGGCCAAGGTGTCATAAATAAACTG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AATTAACTCATGCCTCGACACCTGCAGAGATTCTTCCCGGTTCCACAGTATTTATTTGAC / / // / / // /// / / // / / | | || | | || ||| | | || | SecI* | | || | | || ||| | | || | StyI | | || | | || ||| | | || SetI | | || | | || ||| | | |AsuI* | | || | | || ||| | | BmgT120I | | || | | || ||| | | HaeIII | | || | | || ||| | | CviJI | | || | | || ||| | Esp3I | | || | | || ||| | BsmAI | | || | | || ||| DdeI | | || | | || ||Hin4II* | | || | | || |MaeII | | || | | || |AcyI | | || | | || TspGWI | | || | | || ZraI | | || | | |AatII | | || | | |TaiI | | || | | |SetI | | || | | Hpy166II | | || | CviJI | | || | AluI | | || SetI | | |Csp6I | | RsaI | TspEI MseI L I E Y G A V D V S K K G Q G V I N K L * L S T E L W T S L R R A K V S * I N * N * V R S C G R L * E G P R C H K * T E ----:----|----:----|----:----|----:----|----:----|----:----| K I S Y P A T S T E L F P W P T M F L S N L Q T R L Q P R R * S P G L H * L Y V * N L V S S H V D R L L A L T D Y I F Q CviJI HaeIII FatI CviJI | MaeIII |CviAII HaeIII | Tsp45I || NlaIII | HphI | Tsp4CI* \\ \ \ \ \ \ AAAGACCATGATTATTTCGGTGAAGTGGCCTTGCTAAACGATTTGCCCAGACAGGCCACT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTGGTACTAATAAAGCCACTTCACCGGAACGATTTGCTAAACGGGTCTGTCCGGTGA / // / / // / | |FatI | HphI || Tsp4CI* | CviAII HaeIII |HaeIII NlaIII CviJI |CviJI TspRI K D H D Y F G E V A L L N D L P R Q A T K T M I I S V K W P C * T I C P D R P L R P * L F R * S G L A K R F A Q T G H C ----:----|----:----|----:----|----:----|----:----|----:----| F S W S * K P S T A K S F S K G L C A V S L G H N N R H L P R A L R N A W V P W F V M I I E T F H G Q * V I Q G S L G S AclI MaeII | SetI | TaiI TspRI BsiYI* | |Hpy166II \ \ \ \\ GTGACTGCTACAAAGAGAACCAAAGTTGCCACATTGGGGAAAAGTGGTTTTCAACGTTTA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CACTGACGATGTTTCTCTTGGTTTCAACGGTGTAACCCCTTTTCACCAAAAGTTGCAAAT / / / / / Tsp45I BsiYI* | | Hpy166II MaeIII | MaeII | AclI TaiI SetI V T A T K R T K V A T L G K S G F Q R L * L L Q R E P K L P H W G K V V F N V Y D C Y K E N Q S C H I G E K W F S T F T ----:----|----:----|----:----|----:----|----:----|----:----| T V A V F L V L T A V N P F L P K * R K Q S Q * L S F W L Q W M P S F H N E V N H S S C L S G F N G C Q P F T T K L T * AsuI* AvaII DraII PpuMI |BsrI |NlaIV |BmgT120I || SfeI* || | BfiI || | CviRI* || | | PstI AluI || | | | AccI CviJI || | | | |Hpy166II |BinI* || | | | || MaeII ||SetI || | | | || | SetI ||| MboI || | | | || | TaiI ||| | DpnI || | | | || | | MseI ||| | |BstKTI MseI \\ \ \ \ \\ \ \ \ \\\ \ \\ \ CTGGGTCCTGCAGTAGACGTATTAAAGCTCAATGATCCTACAAGACATTAA 1210 1220 1230 1240 1250 ----:----|----:----|----:----|----:----|----:----|- GACCCAGGACGTCATCTGCATAATTTCGAGTTACTAGGATGTTCTGTAATT / ////// / // / // / / // / / | |||||| | || | || | | || MboI MseI | |||||| | || | || | | |DpnI | |||||| | || | || | | BstKTI | |||||| | || | || | BinI* | |||||| | || | || CviJI | |||||| | || | || AluI | |||||| | || | |SetI | |||||| | || | MseI | |||||| | || MaeII | |||||| | |AccI | |||||| | |TaiI | |||||| | |SetI | |||||| | Hpy166II | |||||| SfeI* | |||||CviRI* | ||||BfiI | |||PstI | ||PpuMI | ||DraII | ||AvaII | ||AsuI* | |BmgT120I | NlaIV BsrI L G P A V D V L K L N D P T R H * W V L Q * T Y * S S M I L Q D I X G S C S R R I K A Q * S Y K T L X ----:----|----:----|----:----|----:----|----:----|- S P G A T S T N F S L S G V L C * V P D Q L L R I L A * H D * L V N Q T R C Y V Y * L E I I R C S M L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AhaIII* 1 DraI AluI 5 AluBI ApoI 1 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BbvI 3 BseXI,BstV1I,Lsp1109I Bce83I* 1 BpuEI BciVI 1 BfuI BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 3 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmgT120I 4 BplI 2 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 3 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseRI 3 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 5 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstAPI 1 BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 8 Cac8I 3 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 5 CviQI,RsaNI CviAII 3 CviJI 19 CviKI-1 CviRI* 5 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 8 MalI DraII 2 EcoO109I DrdI 2 AasI,DseDI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 5 EcoRII 2 AjnI,Psp6I,PspGI Esp3I 1 BsmBI FalI 2 FatI 3 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GsuI 3 BpmI HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 6 Hin4II* 2 HpyAV HindII 3 HincII HinfI 6 HpaII 3 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 7 Hpy8I Hpy178III* 10 Hpy188III Hpy188I 5 Hpy99I 1 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 2 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 4 SchI MmeI 4 MnlI 9 MseI 6 Tru1I,Tru9I MwoI 2 HpyF10VI,BstMWI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspI 1 BstNSI,XceI PleI 4 PpsI PpuMI 2 Psp5II,PspPPI PstI 1 RsaI 5 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 19 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI SnaBI 1 Eco105I,BstSNI SphI 1 PaeI,BbuI SplI* 1 Pfl23II,PspLI,BsiWI StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 6 TaqI 3 TatI 1 TauI 1 TfiI 2 PfeI TseI 3 ApeKI Tsp45I 2 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspEI 7 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 2 TscAI XbaI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AflII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI BceAI BcgI BdaI BglI BmeT110I BmtI Bpu10I BseGI BseMII BsePI BseSI BseYI BsgI BsmI Bsp120I BspCNI BspHI BspLU11I* BspMI BspOI BsrBI BsrDI BssNAI Bst1107I BstF5I BstXI BstZ17I BtgZI BtrI BtsCI BtsI Cfr10I Cfr9I CfrI CspCI DinI DraIII DsaI* Eam1105I Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI EspI* FokI FseI FspAI GlaI GsaI HaeII HgaI HgiAI* HgiCI* HhaI Hin6I HindIII HinP1I HpaI HspAI KasI KpnI MauBI MluI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NsiI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TsoI TspDTI TspMI TstI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* XmnI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769