Restriction Map of CTF8/YHR191C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CTF8/YHR191C on chromosome VIII from coordinates 486631 to 486230.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.2126

EMBOSS_001 HindII Hpy166II | Tth111I MaeI | | Tsp4CI* | SfaNI MaeI | | | Hpy178III* \ \ \ \ \ \ \ ATGCCTAGTGTAGATATAGATGCTAGTCAATGGCAGAAGTTGACACAGTCAAGAGAAAAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGATCACATCTATATCTACGATCAGTTACCGTCTTCAACTGTGTCAGTTCTCTTTTC / / / / / / MaeI SfaNI MaeI | | Hpy178III* | Tth111I | Tsp4CI* Hpy166II HindII M P S V D I D A S Q W Q K L T Q S R E K C L V * I * M L V N G R S * H S Q E K S A * C R Y R C * S M A E V D T V K R K A ----:----|----:----|----:----|----:----|----:----|----:----| X G L T S I S A L * H C F N V C D L S F X A * H L Y L H * D I A S T S V T L L F H R T Y I Y I S T L P L L Q C L * S F L SetI |Hpy166II SecI* AciI FokI || MaeI DsaI* | HphI | TfiI || | GsuI | Tsp4CI* | | SfaNI BseGI | HinfI || | Eco57MI \ \ \ \ \ \ \ \ \\ \ \ CAGACCACGGTGATAACACCGCTTGGGATGATGATGCTGGAGATTCAAGGTGAACTAGAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTGGTGCCACTATTGTGGCGAACCCTACTACTACGACCTCTAAGTTCCACTTGATCTC // // / / / / / / // / |DsaI* |AciI | BseGI | | SetI | || HphI |SecI* HphI SfaNI | HinfI | |MaeI Tsp4CI* | TfiI | Eco57MI FokI | Hin4I | Hin4I | GsuI Hpy166II Q T T V I T P L G M M M L E I Q G E L E R P R * * H R L G * * C W R F K V N * S D H G D N T A W D D D A G D S R * T R V ----:----|----:----|----:----|----:----|----:----|----:----| C V V T I V G S P I I I S S I * P S S S A S W P S L V A Q S S S A P S E L H V L L G R H Y C R K P H H H Q L N L T F * L Hin4I Hin4I Eam1105I |TfiI HphI | MnlI |HinfI Hin4I | |BplI || PpiI Hin4I | |BplI || | MnlI | HgaI | |Hpy99I || | | BseRI BplI | DdeI | ||MwoI || | | | Hin4II* BplI | SauI* | |||Cac8I || | | | | BsiYI* | SetI \ \ \ \\\\ \\ \ \ \ \ \ \ \ TTGCCTAAGGACTTTGCGTCGCTGGCGAGGAGAGATTCTCCAAATGAGGGAAGGTTCAGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AACGGATTCCTGAAACGCAGCGACCGCTCCTCTCTAAGAGGTTTACTCCCTTCCAAGTCA / / / / / / / / // / / / / / | | | | | | | PpiI || | | | | TspRI | | | | | | Hin4I || | | | SetI | | | | | | Hin4I || | | BplI | | | | | Cac8I || | | BplI | | | | MwoI || | Hin4II* | | | | MnlI || | BsiYI* | | | Hpy99I || BseRI | | | BplI |MnlI | | | BplI HinfI | | Eam1105I TfiI | HgaI SauI* DdeI L P K D F A S L A R R D S P N E G R F S C L R T L R R W R G E I L Q M R E G S V A * G L C V A G E E R F S K * G K V Q * ----:----|----:----|----:----|----:----|----:----|----:----| N G L S K A D S A L L S E G F S P L N L T A * P S Q T A P S S L N E L H P F T * Q R L V K R R Q R P S I R W I L S P E T AsuI* |BmgT120I Hpy166II MnlI ||CviJI | TspRI PpiI MseI BceAI MaeIII |CspCI ||HaeIII \ \ \ \ \ \ \\ \\\ GAACAGGACGGCGAAACTTTAATACGATTTGGGTCGTTACAGATTGACGGAGAGAGGGCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTCCTGCCGCTTTGAAATTATGCTAAACCCAGCAATGTCTAACTGCCTCTCTCCCGG / / / / / / /// | PpiI MseI BceAI | CspCI ||TspGWI Hpy166II | MnlI |AsuI* MaeIII BmgT120I HaeIII CviJI E Q D G E T L I R F G S L Q I D G E R A N R T A K L * Y D L G R Y R L T E R G P T G R R N F N T I W V V T D * R R E G H ----:----|----:----|----:----|----:----|----:----|----:----| S C S P S V K I R N P D N C I S P S L A H V P R R F K L V I Q T T V S Q R L S P F L V A F S * Y S K P R * L N V S L P G AluI CviJI |MaeI CspCI ||SetI | Hpy166II |||HphI | | Hin4II* |||| MaeII | | | BsrI |||| |BccI | | | | MaeIII |||| ||Csp6I | | | | Tsp45I |||| |||RsaI | | | | |BfiI |||| |||SetI TspGWI | | | | ||SetI |||| |||TaiI \ \ \ \ \ \\\ \\\\ \\\\ ACATTGTTTGTCGGCAAGAAACAGCGTTTACTGGGGAAGGTGACAAAGCTAGACGTACCG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAACAAACAGCCGTTCTTTGTCGCAAATGACCCCTTCCACTGTTTCGATCTGCATGGC / // / / / / / / /// /// CspCI || | | BfiI | | | ||| ||Csp6I || | SetI | | | ||| |RsaI || BsrI | | | ||| MaeII |Hin4II* | | | ||| BccI Hpy166II | | | ||TaiI | | | ||SetI | | | |MaeI | | | HphI | | CviJI | | AluI | SetI Tsp45I MaeIII T L F V G K K Q R L L G K V T K L D V P H C L S A R N S V Y W G R * Q S * T Y R I V C R Q E T A F T G E G D K A R R T D ----:----|----:----|----:----|----:----|----:----|----:----| V N N T P L F C R K S P F T V F S S T G W M T Q R C S V A N V P S P S L A L R V C Q K D A L F L T * Q P L H C L * V Y R CviRI* | EcoT22I | | TspEI TaqI | | | TaqI SetI FalI | | | AsuII | TspEI FalI \ \ \ \ \ \ \ ATGGGTATAATGCATTTCAATTCGAAAGATAATAAGGTCGAATTAGTTGATGTAATGAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCATATTACGTAAAGTTAAGCTTTCTATTATTCCAGCTTAATCAACTACATTACTTT / / / / / / / / | CviRI* | AsuII SetI | TspEI FalI EcoT22I | TaqI TaqI FalI TspEI M G I M H F N S K D N K V E L V D V M K W V * C I S I R K I I R S N * L M * * N G Y N A F Q F E R * * G R I S * C N E I ----:----|----:----|----:----|----:----|----:----|----:----| I P I I C K L E F S L L T S N T S T I F S P Y L A N * N S L Y Y P R I L Q H L S H T Y H M E I R F I I L D F * N I Y H F StuI CviJI SetI HaeIII | TspDTI | FalI SetI | | MseI | FalI | MnlI \ \ \ \ \ \ \ TATAAGGTTATCTTTAAGGATAGGCCTCTACCTATTATGTAA 370 380 390 400 ----:----|----:----|----:----|----:----|-- ATATTCCAATAGAAATTCCTATCCGGAGATGGATAATACATT / / / / / / / | TspDTI MseI | | SetI MnlI SetI | HaeIII | CviJI | StuI FalI FalI Y K V I F K D R P L P I M * I R L S L R I G L Y L L C X * G Y L * G * A S T Y Y V X ----:----|----:----|----:----|----:----|-- Y L T I K L S L G R G I I Y I Y P * R * P Y A E V * * T I L N D K L I P R * R N H L # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AluI 1 AluBI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BccI 1 BceAI 1 BfiI 1 BmrI,BmuI BmgT120I 1 BplI 2 BseGI 1 BstF5I,BtsCI BseRI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsrI 1 BseNI,Bse1I,BsrSI Cac8I 1 BstC8I Csp6I 1 CviQI,RsaNI CspCI 1 CviJI 3 CviKI-1 CviRI* 1 HpyCH4V DdeI 1 BstDEI,HpyF3I DsaI* 1 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco57MI 1 EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 2 FokI 1 GsuI 1 BpmI HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI Hin4I 2 Hin4II* 2 HpyAV HindII 1 HincII HinfI 2 HphI 3 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 1 Hpy188III Hpy99I 1 MaeI 4 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 2 MnlI 4 MseI 2 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI PpiI 1 RsaI 1 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI SecI* 1 BseDI,BssECI,BsaJI SetI 8 SfaNI 2 LweI StuI 1 Eco147I,PceI,SseBI,AatI TaiI 1 TaqI 2 TfiI 2 PfeI Tsp45I 1 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 2 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI Tth111I 1 PflFI,PsyI,AspI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvI BbvII* Bce83I* BcgI BciVI BclI BdaI BetI* BglI BglII BinI* BisI BlsI BmeT110I BmtI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseSI BseYI BsgI BsiI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CviAII DinI DpnI DraII DraIII DrdI EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EgeI EheI Esp3I EspI* FaqI FatI FauI Fnu4HI FnuDII* FseI FspAI GlaI GsaI HaeII HgiAI* HgiCI* HgiJII* HhaI Hin6I HindIII HinP1I HpaI HpaII Hpy188I HspAI KasI KpnI Ksp632I* MauBI MboI MboII McrI* MfeI MluI MlyI MmeI MroNI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NlaIV NmeAIII NotI NruI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI ScaI SchI ScrFI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StyD4I StyI SwaI TaqII TatI TauI TseI TsoI TspMI TstI VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769