Restriction Map of ERG9/YHR190W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ERG9/YHR190W on chromosome VIII from coordinates 484845 to 486179.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.27172

BsrDI | BseGI | CviRI* | | BetI* | | |HpaII | | || TaqI | | || McrI* | | || |SfaNI | | || |Hin4II* | | || |Hpy178III* | | || || TseI | | || || |BisI | | || || ||BlsI | | || || |||AluI | | || || |||CviJI AluI | | || || |||| SetI CviJI | | || || |||| | TspDTI | SetI | | || || |||| | | AluI | | FokI | | || || |||| | | CviJI | | | MfeI | | || || |||| | | |BbvI | | | TspEI | | || || |||| | | ||SetI \ \ \ \ \ \ \\ \\ \\\\ \ \ \\\ ATGGGAAAGCTATTACAATTGGCATTGCATCCGGTCGAGATGAAGGCAGCTTTGAAGCTG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCTTTCGATAATGTTAACCGTAACGTAGGCCAGCTCTACTTCCGTCGAAACTTCGAC / / / / / / /// // / /// / / / | CviJI | | | | ||| || SfaNI ||| | | CviJI | AluI | | | | ||| || ||| | | AluI SetI | | | | ||| || ||| | SetI | | | | ||| || ||| TspDTI | | | | ||| || ||CviJI | | | | ||| || ||TseI | | | | ||| || ||AluI | | | | ||| || |BisI | | | | ||| || BlsI | | | | ||| || SetI | | | | ||| |Hpy178III* | | | | ||| TaqI | | | | ||Hin4II* | | | | |BetI* | | | | HpaII | | | | McrI* | | | CviRI* | | BseGI | TspEI | BsrDI | MfeI FokI M G K L L Q L A L H P V E M K A A L K L W E S Y Y N W H C I R S R * R Q L * S * G K A I T I G I A S G R D E G S F E A E ----:----|----:----|----:----|----:----|----:----|----:----| X P F S N C N A N C G T S I F A A K F S X P F A I V I P M A D P R S S P L K S A H S L * * L Q C Q M R D L H L C S Q L Q MboI BclI |BccI ||DpnI |||BstKTI |||| Hpy166II |||| | MaeII |||| | |BtrI |||| | || SetI AciI |||| | || TaiI | Eco57I |||| | || | BsmAI CviRI* | Eco57MI |||| | || | Esp3I CviRI* \ \ \ \\\\ \ \\ \ \ \ AAGTTTTGCAGAACACCGCTATTCTCCATCTATGATCAGTCCACGTCTCCATATCTCTTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAAAACGTCTTGTGGCGATAAGAGGTAGATACTAGTCAGGTGCAGAGGTATAGAGAAC / / // // / // // / / / BbvI CviRI* |AciI || | || |MaeII | | CviRI* Eco57MI || | || BtrI | TspRI Eco57I || | |TaiI Esp3I || | |SetI BsmAI || | Hpy166II || BclI || MboI |BccI |DpnI BstKTI K F C R T P L F S I Y D Q S T S P Y L L S F A E H R Y S P S M I S P R L H I S C V L Q N T A I L H L * S V H V S I S L A ----:----|----:----|----:----|----:----|----:----|----:----| F N Q L V G S N E M * S * D V D G Y R K S T K C F V A I R W R H D T W T E M D R L K A S C R * E G D I I L G R R W I E Q BbvI |SetI ||Hpy178III* ||| MboI ||| | DpnI ||| | |BstKTI ||| | || MnlI ||| | || | TseI ||| | || | BsaXI ||| | || | |BisI ||| | || | ||BlsI ||| | || | ||AloI ||| | || | ||PpiI ||| | || | ||| BbvI ||| | || | ||| | FokI ||| | || | ||| | MboI ||| | || | ||| | BclI Tsp4CI* ||| | || | ||| | | DpnI | TspRI ||| | || | ||| | | |BstKTI | |TaqI ||| | || | ||| | | || Hpy188I | |AsuII ||| | || | ||| | | || | TseI | || AloI ||| | || | ||| | | || | AluI | || PpiI ||| | || | ||| | | || | CviJI | || BsaXI ||| | || | ||| | | || | |BisI | || | GsuI ||| | || | ||| | | || | ||BlsI | || | Eco57MI ||| | || | ||| | | || | ||SetI | || | |EcoP15I ||| | || | ||| | | || | |||BseGI | || | ||Tsp4CI* ||| | || | ||| | | || | |||CviRI* \ \\ \ \\\ \\\ \ \\ \ \\\ \ \ \\ \ \\\\ CACTGTTTCGAACTGTTGAACTTGACCTCCAGATCGTTTGCTGCTGTGATCAGAGAGCTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTGACAAAGCTTGACAACTTGAACTGGAGGTCTAGCAAACGACGACACTAGTCTCTCGAC / / / / / / / /// / / /// // / / //// | | | | | EcoP15I SetI ||| | | ||TseI || | | |||CviRI* | | | | Tsp4CI* ||| | | |BisI || | | |||TseI | | | Eco57MI ||| | | BlsI || | | ||BisI | | | AsuII ||| | BsaXI || | | |BseGI | | | TaqI ||| | PpiI || | | |BlsI | | | GsuI ||| | AloI || | | CviJI | | BsaXI ||| MnlI || | | AluI | PpiI ||| MboI || | SetI | AloI ||DpnI || Hpy188I Tsp4CI* |BstKTI || BclI Hpy178III* || MboI BbvI || FokI |DpnI BstKTI BbvI H C F E L L N L T S R S F A A V I R E L T V S N C * T * P P D R L L L * S E S C L F R T V E L D L Q I V C C C D Q R A A ----:----|----:----|----:----|----:----|----:----|----:----| C Q K S S N F K V E L D N A A T I L S S A S N R V T S S S R W I T Q Q Q S * L A V T E F Q Q V Q G G S R K S S H D S L Q Hpy178III* | TspEI Tsp4CI* BciVI Hin4I | | SfaNI | MaeIII MseI |CviJI Hin4I \ \ \ \ \ \ \\ \ CATCCAGAATTGAGAAACTGTGTTACTCTCTTTTATTTGATTTTAAGGGCTTTGGATACC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTAGGTCTTAACTCTTTGACACAATGAGAGAAAATAAACTAAAATTCCCGAAACCTATGG / / / / / / / / / | | | Tsp4CI* MaeIII | | | Hin4I | | SfaNI | | | Hin4I | TspEI | | CviJI Hpy178III* | BciVI MseI H P E L R N C V T L F Y L I L R A L D T I Q N * E T V L L S F I * F * G L W I P S R I E K L C Y S L L F D F K G F G Y H ----:----|----:----|----:----|----:----|----:----|----:----| C G S N L F Q T V R K * K I K L A K S V A D L I S F S H * E R K N S K L P K P Y M W F Q S V T N S E K I Q N * P S Q I G BccI | BbvII* Hin4I | |Eam1105I Hin4I | || MboII | TspEI MaeIII TaqI | || | TaqI BccI | | HgaI Tsp45I BsiI* \ \ \\ \ \ \ \ \ \ \ \ ATCGAAGACGATATGTCCATCGAACACGATTTGAAAATTGACTTGTTGCGTCACTTCCAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTTCTGCTATACAGGTAGCTTGTGCTAAACTTTTAACTGAACAACGCAGTGAAGGTG / / / / / // / / / | | | BbvII* | |BccI | HgaI Tsp45I | | | MboII | Hin4I TspEI MaeIII | | Eam1105I | Hin4I | BccI TaqI TaqI I E D D M S I E H D L K I D L L R H F H S K T I C P S N T I * K L T C C V T S T R R R Y V H R T R F E N * L V A S L P R ----:----|----:----|----:----|----:----|----:----|----:----| M S S S I D M S C S K F I S K N R * K W W R L R Y T W R V R N S F Q S T A D S G D F V I H G D F V I Q F N V Q Q T V E V MseI |HpaI Hin4II* |HindII |BceAI |Hpy166II ||TspGWI TspEI || BcgI TaqI Hpy99I ||| BcgI \ \\ \ \ \ \\\ \ GAGAAATTGTTGTTAACTAAATGGAGTTTCGACGGAAATGCCCCCGATGTGAAGGACAGA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTTAACAACAATTGATTTACCTCAAAGCTGCCTTTACGGGGGCTACACTTCCTGTCT / / // / / / // / / / BsiI* TspEI || BcgI | TaqI || | BcgI Hin4I |MseI Hpy99I || BceAI Hin4I Hpy166II |TspGWI HindII Hin4II* HpaI E K L L L T K W S F D G N A P D V K D R R N C C * L N G V S T E M P P M * R T E E I V V N * M E F R R K C P R C E G Q S ----:----|----:----|----:----|----:----|----:----|----:----| S F N N N V L H L K S P F A G S T F S L R S I T T L * I S N R R F H G R H S P C L F Q Q * S F P T E V S I G G I H L V S TaqI AsuII | TfiI | HinfI | | TaqI ApoI | | ClaI TspEI CviJI | | |XmnI EcoRI | Hin4I | | ||TfiI | Hin4I | Hin4I | | ||HinfI | Hin4I TspEI \ \ \ \ \\\ \ \ \ GCCGTTTTGACAGATTTCGAATCGATTCTTATTGAATTCCACAAATTGAAACCAGAATAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCAAAACTGTCTAAAGCTTAGCTAAGAATAACTTAAGGTGTTTAACTTTGGTCTTATA / / /// / / / / CviJI | ||| | Hin4I EcoRI TspEI | ||| | Hin4I TspEI | ||| HinfI ApoI | ||| TfiI | ||ClaI | ||TaqI | |XmnI | HinfI | TfiI AsuII TaqI A V L T D F E S I L I E F H K L K P E Y P F * Q I S N R F L L N S T N * N Q N I R F D R F R I D S Y * I P Q I E T R I S ----:----|----:----|----:----|----:----|----:----|----:----| A T K V S K S D I R I S N W L N F G S Y L R K S L N R I S E * Q I G C I S V L I G N Q C I E F R N K N F E V F Q F W F I MboI CfrI | DpnI | CviJI Hpy178III* HphI | |BstKTI | HaeIII DdeI \ \ \ \\ \ \ \ CAAGAAGTCATCAAGGAGATCACCGAGAAAATGGGTAATGGTATGGCCGACTACATCTTA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTCAGTAGTTCCTCTAGTGGCTCTTTTACCCATTACCATACCGGCTGATGTAGAAT / / // / / / / | HphI || MboI | CfrI DdeI Hpy178III* |DpnI HaeIII BstKTI CviJI Q E V I K E I T E K M G N G M A D Y I L K K S S R R S P R K W V M V W P T T S * R S H Q G D H R E N G * W Y G R L H L R ----:----|----:----|----:----|----:----|----:----|----:----| * S T M L S I V S F I P L P I A S * M K D L L * * P S * R S F P Y H Y P R S C R L F D D L L D G L F H T I T H G V V D * MaeII AflIII |BtrI ||Hpy99I |||TatI |||SetI |||TaiI ||||Csp6I ||||Hpy166II |||||RsaI CviRI* |||||| MaeIII | Tsp4CI* |||||| Tsp45I TspEI TspDTI | | Hpy166II |||||| Tsp4CI* \ \ \ \ \ \\\\\\ \ GATGAAAATTACAACTTGAATGGGTTGCAAACCGTCCACGACTACGACGTGTACTGTCAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTTTAATGTTGAACTTACCCAACGTTTGGCAGGTGCTGATGCTGCACATGACAGTG / / / / / / / // //// / | TspDTI | | | | | || |||| Tsp45I TspEI | | | | | || |||| MaeIII | | | | | || |||Tsp4CI* | | | | | || |||TatI | | | | | || ||Csp6I | | | | | || |RsaI | | | | | || Hpy166II | | | | | || AflIII | | | | | |MaeII | | | | | BtrI | | | | TaiI | | | | SetI | | | Hpy99I | | Hpy166II | Tsp4CI* CviRI* D E N Y N L N G L Q T V H D Y D V Y C H M K I T T * M G C K P S T T T T C T V T * K L Q L E W V A N R P R L R R V L S L ----:----|----:----|----:----|----:----|----:----|----:----| S S F * L K F P N C V T W S * S T Y Q * L H F N C S S H T A F R G R S R R T S D I F I V V Q I P Q L G D V V V V H V T V MaeII |BsaAI |SnaBI || SetI || TaiI || | AluI || | CviJI || | | SetI BccI HphI BsrDI MwoI \\ \ \ \ \ \ \ \ TACGTAGCTGGTTTGGTCGGTGATGGTTTGACCCGTTTGATTGTCATTGCCAAGTTTGCC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCATCGACCAAACCAGCCACTACCAAACTGGGCAAACTAACAGTAACGGTTCAAACGG / /// / / / / / | ||| CviJI BccI HphI BsrDI MwoI | ||| AluI | ||SetI | |MaeII | SnaBI | BsaAI TaiI SetI Y V A G L V G D G L T R L I V I A K F A T * L V W S V M V * P V * L S L P S L P R S W F G R * W F D P F D C H C Q V C Q ----:----|----:----|----:----|----:----|----:----|----:----| * T A P K T P S P K V R K I T M A L N A S R L Q N P R H H N S G N S Q * Q W T Q V Y S T Q D T I T Q G T Q N D N G L K G FatI |CviAII TfiI MfeI || NlaIII HinfI TspEI || | TspDTI \ \ \\ \ \ AACGAATCTTTGTATTCTAATGAGCAATTGTATGAAAGCATGGGTCTTTTCCTACAAAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTTAGAAACATAAGATTACTCGTTAACATACTTTCGTACCCAGAAAAGGATGTTTTT / / / // / HinfI TspEI | || TspDTI TfiI MfeI | |FatI | CviAII NlaIII N E S L Y S N E Q L Y E S M G L F L Q K T N L C I L M S N C M K A W V F S Y K K R I F V F * * A I V * K H G S F P T K N ----:----|----:----|----:----|----:----|----:----|----:----| L S D K Y E L S C N Y S L M P R K R C F W R I K T N * H A I T H F C P D K G V F V F R Q I R I L L Q I F A H T K E * L F Hin4I Hin4I | BccI AsuI* | | TaqI |CviJI | | | MboII |HaeIII | | | |BinI* |BmgT120I | | | |TspDTI || StyI | | | || MboI || SecI* | | | || XhoII || |Hin4II* | | | || | DpnI || || Hin4I Hpy188I | | | || | |BstKTI || || Hin4I \ \ \ \ \\ \ \\ \\ \\ \ ACCAACATCATCAGAGATTACAATGAAGATTTGGTCGATGGTAGATCCTTCTGGCCCAAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTGTAGTAGTCTCTAATGTTACTTCTAAACCAGCTACCATCTAGGAAGACCGGGTTC / / / // / // / /// / Hpy188I Hin4I | || | || XhoII ||| SecI* Hin4I | || | || MboI ||| StyI | || | |DpnI ||Hin4II* | || | BstKTI ||AsuI* | || BinI* |BmgT120I | |TaqI |Hin4I | TspDTI |Hin4I | MboII HaeIII BccI CviJI T N I I R D Y N E D L V D G R S F W P K P T S S E I T M K I W S M V D P S G P R Q H H Q R L Q * R F G R W * I L L A Q G ----:----|----:----|----:----|----:----|----:----|----:----| V L M M L S * L S S K T S P L D K Q G L F W C * * L N C H L N P R H Y I R R A W G V D D S I V I F I Q D I T S G E P G L DdeI |Hin4II* || TspDTI || | MnlI || | | XmnI || | | | BspCNI || | | | |BseMII || | | | ||FatI || | | | ||BspHI || | | | |||CviAII || | | | |||Hpy178III* || | | | |||| NlaIII || | | | |||| | MmeI || | | | |||| | |SetI MaeIII || | | | |||| | || BdaI Tsp45I BdaI || | | | |||| | || BdaI | BseRI BdaI || | | | |||| | || | TspDTI \ \ \ \\ \ \ \ \\\\ \ \\ \ \ GAAATCTGGTCACAATACGCTCCTCAGTTGAAGGACTTCATGAAACCTGAAAACGAACAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAGACCAGTGTTATGCGAGGAGTCAACTTCCTGAAGTACTTTGGACTTTTGCTTGTT / / / / // / // / // // / / | | BdaI | |DdeI | || | || |MmeI | TspDTI | | BdaI | | | || | || SetI BdaI | Tsp45I | | | || | |BspHI BdaI | MaeIII | | | || | |FatI BseRI | | | || | Hpy178III* | | | || | CviAII | | | || NlaIII | | | |BseMII | | | BspCNI | | | XmnI | | MnlI | TspDTI Hin4II* E I W S Q Y A P Q L K D F M K P E N E Q K S G H N T L L S * R T S * N L K T N N N L V T I R S S V E G L H E T * K R T T ----:----|----:----|----:----|----:----|----:----|----:----| S I Q D C Y A G * N F S K M F G S F S C P F R T V I R E E T S P S * S V Q F R V F D P * L V S R L Q L V E H F R F V F L HinfI | FatI | |CviAII | || NlaIII | || |PleI | || ||MlyI BfiI MseI | || ||| TaqI BsrI | Tsp4CI* SetI | MnlI | || ||| ClaI \ \ \ \ \ \ \ \\ \\\ \ CTGGGGTTGGACTGTATAAACCACCTCGTCTTAAACGCATTGAGTCATGTTATCGATGTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GACCCCAACCTGACATATTTGGTGGAGCAGAATTTGCGTAACTCAGTACAATAGCTACAC / / / / / / // / / BsrI | Tsp4CI* SetI MnlI | || | ClaI BfiI MseI | || | TaqI | || PleI | || MlyI | |FatI | CviAII NlaIII HinfI L G L D C I N H L V L N A L S H V I D V W G W T V * T T S S * T H * V M L S M C G V G L Y K P P R L K R I E S C Y R C V ----:----|----:----|----:----|----:----|----:----|----:----| S P N S Q I F W R T K F A N L * T I S T V P T P S Y L G G R R L R M S D H * R H Q P Q V T Y V V E D * V C Q T M N D I H CfrI | TstI | CviJI | Cfr10I HindII | HaeIII TspEI Hpy166II | |HpaII BsiI* BciVI | TstI \ \ \\ \ \ \ \ TTGACTTATTTGGCCGGTATCCACGAGCAATCCACTTTCCAATTTTGTGCCATTCCCCAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGAATAAACCGGCCATAGGTGCTCGTTAGGTGAAAGGTTAAAACACGGTAAGGGGTT / / / /// // / / / | TstI | ||Cfr10I |BciVI | TspEI BsiYI* Hpy166II | |HpaII BsiI* TstI PflMI HindII | CfrI HaeIII CviJI L T Y L A G I H E Q S T F Q F C A I P Q * L I W P V S T S N P L S N F V P F P K D L F G R Y P R A I H F P I L C H S P S ----:----|----:----|----:----|----:----|----:----|----:----| N V * K A P I W S C D V K W N Q A M G W T S K N P R Y G R A I W K G I K H W E G Q S I Q G T D V L L G S E L K T G N G L PflMI BsiYI* | CfrI | | BalI | | CviJI | | HaeIII | | |BsrDI | | || CviRI* | | || | XcmI | | || | | StyI | | || | | SecI* FatI | | || | | | SetI |CviAII | | || | | | MwoI || NlaIII | | || | | | | CviJI Tsp4CI* || |MslI \ \ \\ \ \ \ \ \ \ \\ \\ GTTATGGCCATTGCAACCTTGGCTTTGGTATTCAACAACCGTGAAGTGCTACATGGCAAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CAATACCGGTAACGTTGGAACCGAAACCATAAGTTGTTGGCACTTCACGATGTACCGTTA // / //// // / / /// || | |||MwoI |CviJI Tsp4CI* | ||MslI || | ||SetI SecI* | |FatI || | |XcmI StyI | CviAII || | CviRI* NlaIII || CfrI |HaeIII |CviJI |BalI BsrDI V M A I A T L A L V F N N R E V L H G N L W P L Q P W L W Y S T T V K C Y M A M Y G H C N L G F G I Q Q P * S A T W Q C ----:----|----:----|----:----|----:----|----:----|----:----| T I A M A V K A K T N L L R S T S C P L L * P W Q L R P K P I * C G H L A V H C N H G N C G Q S Q Y E V V T F H * M A I BsrDI MseI | TfiI Csp6I BspMI | HinfI |RsaI SetI |TspEI TstI CviJI \ \ \\ \ \\ \ \ GTAAAGATTCGTAAGGGTACTACCTGCTATTTAATTTTGAAATCAAGGACTTTGCGTGGC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CATTTCTAAGCATTCCCATGATGGACGATAAATTAAAACTTTAGTTCCTGAAACGCACCG / / // / //// / BsrDI HinfI || SetI |||TspEI CviJI TfiI |Csp6I ||BspMI RsaI |TstI MseI V K I R K G T T C Y L I L K S R T L R G * R F V R V L P A I * F * N Q G L C V A K D S * G Y Y L L F N F E I K D F A W L ----:----|----:----|----:----|----:----|----:----|----:----| T F I R L P V V Q * K I K F D L V K R P H L S E Y P Y * R S N L K S I L S K A H Y L N T L T S G A I * N Q F * P S Q T A CviJI | BinI* Hin4I | | Hin4I Hin4I | | Hin4I | MaeII | | CviRI* | |BsaAI | | | MboI TaqI | || SetI | | | XhoII |Hpy178III* | || TaiI | | | | DpnI || TstI | || | EcoRV TspEI | | | | |BstKTI \\ \ \ \\ \ \ \ \ \ \ \ \\ TGTGTCGAGATTTTTGACTATTACTTACGTGATATCAAATCTAAATTGGCTGTGCAAGAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| ACACAGCTCTAAAAACTGATAATGAATGCACTATAGTTTAGATTTAACCGACACGTTCTA /// / / // / / / // // ||| Hin4I | || EcoRV | | || |DpnI ||| Hin4I | |MaeII | | || BstKTI ||Hpy178III* | BsaAI | | |CviRI* |TaqI TaiI | | BinI* TstI SetI | Hin4I | Hin4I | CviJI TspEI C V E I F D Y Y L R D I K S K L A V Q D V S R F L T I T Y V I S N L N W L C K I C R D F * L L L T * Y Q I * I G C A R S ----:----|----:----|----:----|----:----|----:----|----:----| Q T S I K S * * K R S I L D L N A T C S S H R S K Q S N S V H Y * I * I P Q A L T D L N K V I V * T I D F R F Q S H L I MboI | DpnI | |TaqI ApoI MseI | |BstKTI TspEI | TspEI | || Tsp4CI* Csp6I \ \ \ \ \\ \ \ CCAAATTTCTTAAAATTGAACATTCAAATCTCCAAGATCGAACAGTTTATGGAAGAAATG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTAAAGAATTTTAACTTGTAAGTTTAGAGGTTCTAGCTTGTCAAATACCTTCTTTAC / / / / // // / XhoII | MseI TspEI || || Tsp4CI* MboI TspEI || |TaqI ApoI || MboI |DpnI BstKTI P N F L K L N I Q I S K I E Q F M E E M Q I S * N * T F K S P R S N S L W K K C K F L K I E H S N L Q D R T V Y G R N V ----:----|----:----|----:----|----:----|----:----|----:----| G F K K F N F M * I E L I S C N I S S I D L N R L I S C E F R W S R V T * P L F W I E * F Q V N L D G L D F L K H F F H RsaI |BssKI MaeII |EcoRII | SetI || ScrFI | TaiI TspDTI || BseBI | MnlI |Hpy178III* || MboII TspEI SetI | | CviJI TspEI || MseI \\ \ \ \ \ \ \ \ \\ \ TACCAGGATAAATTACCTCCTAACGTGAAGCCAAATGAAACTCCAATTTTCTTGAAAGTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGTCCTATTTAATGGAGGATTGCACTTCGGTTTACTTTGAGGTTAAAAGAACTTTCAA /// / / / / / / / / ||| | EcoRII TspEI | | CviJI | Hpy178III* ||| | BssKI SetI | MaeII TspDTI ||| BseBI | MnlI TspEI ||| ScrFI TaiI ||MboII SetI |Csp6I RsaI Y Q D K L P P N V K P N E T P I F L K V T R I N Y L L T * S Q M K L Q F S * K L P G * I T S * R E A K * N S N F L E S * ----:----|----:----|----:----|----:----|----:----|----:----| Y W S L N G G L T F G F S V G I K K F T T G P Y I V E * R S A L H F E L K R S L V L I F * R R V H L W I F S W N E Q F N BinI* | MboI TatI | XhoII |Csp6I | | DpnI TspEI TspDTI ||RsaI | | |BstKTI | XmnI | PpiI ||| MmeI | | ||Hpy178III* | | NlaIV | |Ksp632I* ||| MboII \ \ \\\ \ \ \ \ \\ \\\ \ AAAGAAAGATCCAGATACGATGATGAATTGGTTCCAACCCAACAAGAAGAAGAGTACAAG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTTCTAGGTCTATGCTACTACTTAACCAAGGTTGGGTTGTTCTTCTTCTCATGTTC / / // / / / / / / / /// / | | || | Hpy178III* | | | PpiI | ||| MboII | | || XhoII | | TspDTI | ||MboII | | || MboI | NlaIV | ||TatI | | |DpnI TspEI | |Csp6I | | BstKTI XmnI | |MmeI | BinI* | RsaI MseI Ksp632I* K E R S R Y D D E L V P T Q Q E E E Y K K K D P D T M M N W F Q P N K K K S T S R K I Q I R * * I G S N P T R R R V Q V ----:----|----:----|----:----|----:----|----:----|----:----| L S L D L Y S S S N T G V W C S S S Y L * L F I W I R H H I P E L G V L L L T C F F S G S V I I F Q N W G L L F F L V L PpiI MboII | TspGWI MboII \ \ \ \ TTCAATATGGTTTTATCTATCATCTTGTCCGTTCTTCTTGGGTTTTATTATATATACACT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTATACCAAAATAGATAGTAGAACAGGCAAGAAGAACCCAAAATAATATATATGTGA / / / PpiI TspGWI MboII F N M V L S I I L S V L L G F Y Y I Y T S I W F Y L S S C P F F L G F I I Y T L Q Y G F I Y H L V R S S W V L L Y I H F ----:----|----:----|----:----|----:----|----:----|----:----| N L I T K D I M K D T R R P N * * I Y V T * Y P K I * * R T R E E Q T K N Y I C E I H N * R D D Q G N K K P K I I Y V S TTACACAGAGCGTGA 1330 ----:----|----: AATGTGTCTCGCACT L H R A * Y T E R X T Q S V X ----:----|----: K C L A H K V C L T * V S R S # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AflIII 1 AloI 1 AluI 5 AluBI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 BceAI 1 BcgI 1 BciVI 2 BfuI BclI 2 FbaI,Ksp22I BdaI 2 BetI* 1 BsaWI BfiI 1 BmrI,BmuI BinI* 3 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 1 BsaAI 2 BstBAI,Ppu21I BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BseRI 1 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BspCNI 1 BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrDI 4 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 8 BtrI 2 BmgBI,AjiI Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 3 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 4 CviJI 15 CviKI-1 CviRI* 7 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 8 MalI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco57I 1 AcuI Eco57MI 2 EcoP15I 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FatI 4 FokI 2 GsuI 1 BpmI HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI Hin4I 8 Hin4II* 4 HpyAV HindII 2 HincII HinfI 5 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 2 Hpy99I 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeII 5 HpyCH4IV MaeIII 4 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 2 MunI MlyI 1 SchI MmeI 2 MnlI 4 MseI 6 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I PflMI 1 BasI,AccB7I,Van91I PleI 1 PpsI PpiI 2 RsaI 4 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 16 SfaNI 2 LweI SnaBI 1 Eco105I,BstSNI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 11 TatI 2 TfiI 4 PfeI TseI 3 ApeKI Tsp45I 3 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 8 TspEI 16 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI TstI 2 XcmI 1 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AgeI AhaIII* AjuI AlfI AlwNI ApaI ApaLI AscI Asp718I AvaI AvaII AvrII BaeI BamHI BarI BbvCI Bce83I* BglI BglII BmeT110I BmtI BplI Bpu10I BsaBI BsePI BseSI BseYI BsgI BslFI BsmFI BsmI Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtsI Cac8I CauII* Cfr9I CspCI DinI DraII DraIII DrdI DsaI* EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoT22I EgeI EheI EspI* FalI FaqI FauI FnuDII* FseI FspAI GlaI GsaI HaeII HgiAI* HgiCI* HgiJII* HhaI Hin6I HindIII HinP1I HspAI KasI KpnI MaeI MauBI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PmaCI PmeI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TauI TsoI TspMI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769