Restriction Map of SPL2/YHR136C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SPL2/YHR136C on chromosome VIII from coordinates 375100 to 374654.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.5691

EMBOSS_001 AclI MaeII SduI MseI | SetI BseSI VspI TspDTI | TaiI \ \ \ \ \ ATGGGCACATATACGCCATTAATATACAATATATATAACGTTCATATATGGGTATTTACA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCCGTGTATATGCGGTAATTATATGTTATATATATTGCAAGTATATACCCATAAATGT / / / / / BseSI VspI TspDTI | MaeII SduI MseI | AclI TaiI SetI M G T Y T P L I Y N I Y N V H I W V F T W A H I R H * Y T I Y I T F I Y G Y L Q G H I Y A I N I Q Y I * R S Y M G I Y R ----:----|----:----|----:----|----:----|----:----|----:----| X P V Y V G N I Y L I Y L T * I H T N V X P C M Y A M L I C Y I Y R E Y I P I * H A C I R W * Y V I Y I V N M Y P Y K C BssKI BsmAI CviJI | AciI EcoRII | FnuDII* |SecI* | |BisI ||ScrFI XcmI | ||BlsI ||BseBI |TspEI PshAI | |||TauI \\\ \\ \ \ \\\\ GAGAGCCAGGGGCAAATTGGACAGATGTCTCCACGCGGCAAAATGGAAACAGCAGTTTCA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTCGGTCCCCGTTTAACCTGTCTACAGAGGTGCGCCGTTTTACCTTTGTCGTCAAAGT / / / / / / /// | | | XcmI TspEI PshAI ||BisI | | EcoRII ||AciI | | BssKI |BsmAI | | SecI* |BlsI | BseBI FnuDII* | ScrFI TauI CviJI E S Q G Q I G Q M S P R G K M E T A V S R A R G K L D R C L H A A K W K Q Q F H E P G A N W T D V S T R Q N G N S S F T ----:----|----:----|----:----|----:----|----:----|----:----| S L W P C I P C I D G R P L I S V A T E L S G P A F Q V S T E V R C F P F L L K L A L P L N S L H R W A A F H F C C N * MnlI BccI | Hin4I |MseI MaeIII | | SecI* |EcoP15I Tsp45I | | MboII || HphI BstEII BsiYI* | | |Hpy188I \\ \ \ \ \ \ \\ CAAGGACAACACAAACAACTTAAAGATGGTCACCAGCATAAGGGAAGAAAACTCTCCGAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCTGTTGTGTTTGTTGAATTTCTACCAGTGGTCGTATTCCCTTCTTTTGAGAGGCTC /// / / // // / ||EcoP15I | BsiYI* |MnlI || SecI* ||MseI BstEII Hin4I |Hpy188I |HphI Tsp45I MboII BccI MaeIII Q G Q H K Q L K D G H Q H K G R K L S E K D N T N N L K M V T S I R E E N S P R R T T Q T T * R W S P A * G K K T L R G ----:----|----:----|----:----|----:----|----:----|----:----| C P C C L C S L S P * W C L P L F S E S V L V V C V V * L H D G A Y P F F V R R L S L V F L K F I T V L M L S S F E G L MboI CviJI | DpnI | Hin4I | |BstKTI | |Hin4I MaeI | || MnlI | || MnlI |BsgI BtgZI | || | BseRI | || | CviRI* CviJI ||MaeIII Hin4I \ \\ \ \ \ \\ \ \ \ \\\ \ GAGATCGCTTCTCTATTGAGGCTCAAAGAGTGCAGGAGGCTCAATCCTGCTAGTTACTAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTAGCGAAGAGATAACTCCGAGTTTCTCACGTCCTCCGAGTTAGGACGATCAATGATA // / // // / / / / / / / || | |BseRI |Hin4I | CviRI* CviJI | | | MaeIII || | MnlI Hin4I MnlI | | Hin4I || MboI CviJI | MaeI |DpnI BsgI BstKTI E I A S L L R L K E C R R L N P A S Y Y R S L L Y * G S K S A G G S I L L V T I D R F S I E A Q R V Q E A Q S C * L L Y ----:----|----:----|----:----|----:----|----:----|----:----| S I A E R N L S L S H L L S L G A L * * P S R K E I S A * L T C S A * D Q * N S L D S R * Q P E F L A P P E I R S T V I MboI | DpnI | TspRI | |BstKTI | || BspCNI MaeII | || |BinI* |BsaAI | || |BseMII || SetI MaeIII | || || MseI || TaiI Tsp45I DdeI | || || |AhaIII* \\ \ \ \ \ \\ \\ \\ ACTCCACGTAGAACATCGCAGTCACAATCTCTCAGTGGATCAACTTTTAAAGAGTATAAC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGGTGCATCTTGTAGCGTCAGTGTTAGAGAGTCACCTAGTTGAAAATTTCTCATATTG / / // / / / // /// / // | | |MaeII | | | || ||| | |MseI | | BsaAI | | | || ||| | AhaIII* | TaiI | | | || ||| BinI* | SetI | | | || ||BseMII BtgZI | | | || |BspCNI | | | || MboI | | | |DpnI | | | BstKTI | | DdeI | TspRI Tsp45I MaeIII T P R R T S Q S Q S L S G S T F K E Y N L H V E H R S H N L S V D Q L L K S I T S T * N I A V T I S Q W I N F * R V * R ----:----|----:----|----:----|----:----|----:----|----:----| V G R L V D C D C D R L P D V K L S Y L Y E V Y F M A T V I E * H I L K * L T Y S W T S C R L * L R E T S * S K F L I V Hin6I BbvI |GlaI |TseI ||BbvI ||BisI TatI ||TseI |||BlsI |Csp6I ||HhaI |||| AciI ||RsaI |||BisI |||| BisI ||| MseI TfiI ||||BlsI |||| |BlsI ||| VspI HinfI HgaI ||||| BceAI |||| ||TauI MseI \\\ \ \ \ \\\\\ \ \\\\ \\\ \ GAGTACATTAATGAGAAAGATTCAAGTAGAGCGCAGCGTCAAAACGCTGCCGCCGTTTTA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTCATGTAATTACTCTTTCTAAGTTCATCTCGCGTCGCAGTTTTGCGACGGCGGCAAAAT /// / / //////// / ////// / ||| VspI HinfI |||||||| BceAI |||||AciI MseI ||| MseI TfiI |||||||BbvI ||||BisI ||TatI ||||||TseI |||BlsI |Csp6I |||||BisI ||BbvI RsaI ||||BlsI ||TseI |||Hin6I ||TauI ||GlaI |BisI |HhaI BlsI HgaI E Y I N E K D S S R A Q R Q N A A A V L S T L M R K I Q V E R S V K T L P P F * V H * * E R F K * S A A S K R C R R F K ----:----|----:----|----:----|----:----|----:----|----:----| S Y M L S F S E L L A C R * F A A A T K R T C * H S L N L Y L A A D F R Q R R K L V N I L F I * T S R L T L V S G G N * Cac8I | AluI | CviJI | | SetI | | Cac8I BbvII* | | | FatI | TaqI | | | |CviAII Tsp4CI* | AsuII | | | || NlaIII Tth111I | | MboII \ \ \ \\ \ \ \ \ \ AGCAAGCTCGCCCATGACTTTTGGGAGAACGACTGTGTCATTGACGAAGACATATTCGAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTTCGAGCGGGTACTGAAAACCCTCTTGCTGACACAGTAACTGCTTCTGTATAAGCTT / / / / // / / // | | | | |FatI | Tth111I |AsuII | | | | CviAII Tsp4CI* |TaqI | | | NlaIII BbvII* | | Cac8I MboII | CviJI | AluI Cac8I SetI S K L A H D F W E N D C V I D E D I F E A S S P M T F G R T T V S L T K T Y S K Q A R P * L L G E R L C H * R R H I R R ----:----|----:----|----:----|----:----|----:----|----:----| L L S A W S K Q S F S Q T M S S S M N S L C A R G H S K P S R S H * Q R L C I R A L E G M V K P L V V T D N V F V Y E F FatI BspHI |CviAII |Hpy178III* TfiI Hpy188I || MboII HinfI |MboII || |NlaIII \ \\ \\ \\ GATTCGTCTGACGAAGAACAATCATGA 430 440 ----:----|----:----|----:-- CTAAGCAGACTGCTTCTTGTTAGTACT / // / /// | |MboII | ||BspHI | Hpy188I | ||FatI HinfI | |Hpy178III* TfiI | |CviAII | MboII NlaIII D S S D E E Q S * I R L T K N N H X F V * R R T I M X ----:----|----:----|----:-- S E D S S S C D H L N T Q R L V I M I R R V F F L * S # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AclI 1 Psp1406I AhaIII* 1 DraI AluI 1 AluBI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 1 BceAI 1 BinI* 1 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BsaAI 1 BstBAI,Ppu21I BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseMII 1 BseRI 1 BseSI 1 BaeGI,BstSLI BsgI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BspCNI 1 BspHI 1 CciI,PagI,RcaI BssKI 1 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 2 BtgZI 1 Cac8I 2 BstC8I Csp6I 1 CviQI,RsaNI CviAII 2 CviJI 4 CviKI-1 CviRI* 1 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI FatI 2 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GlaI 1 HgaI 1 CseI HhaI 1 BstHHI,CfoI,AspLEI Hin4I 2 Hin6I 1 HinP1I,HspAI HinfI 2 HphI 1 AsuHPI Hpy178III* 1 Hpy188III Hpy188I 2 MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 3 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MnlI 3 MseI 5 Tru1I,Tru9I NlaIII 2 Hin1II,Hsp92II,FaeI PshAI 1 BstPAI,BoxI RsaI 1 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 3 TaiI 2 TaqI 1 TatI 1 TauI 2 TfiI 2 PfeI TseI 2 ApeKI Tsp45I 2 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 1 TasI,Tsp509I,Sse9I TspRI 1 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 2 PshBI,AseI XcmI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuI* AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BmeT110I BmgT120I BmtI BplI Bpu10I BsaBI BsaXI BseGI BsePI BseYI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssNAI Bst1107I BstAPI BstF5I BstXI BstZ17I BtrI BtsCI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FokI FseI FspAI GsaI GsuI HaeII HaeIII HgiAI* HgiCI* HgiJII* Hin4II* HindII HindIII HpaI HpaII Hpy166II Hpy8I Hpy99I KasI KpnI Ksp632I* MauBI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MslI MstI* MwoI NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqII TsoI TspGWI TspMI TstI XbaI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769