Restriction Map of WSS1/YHR134W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

WSS1/YHR134W on chromosome VIII from coordinates 371749 to 372558.


FatI |CviAII || FauI || |NlaIII || || PflMI || || BsiYI* || || | AciI || || | | BplI || || | | BplI || || | | Cac8I Hin4II* || || | | | CviJI | BbvII* || || | | | |NlaIV | | MboII || || | | | ||SduI | | |TspDTI CviJI BccI || || | | | ||HgiJII* \ \ \\ \ \ \\ \\ \ \ \ \\\ ATGAAGACAGAAGGAATAAAAAGCCCATCGGCAAAATACCATGATATGGCGGGCTCCCAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCTGTCTTCCTTATTTTTCGGGTAGCCGTTTTATGGTACTATACCGCCCGAGGGTC / / / / / /// / / // Hin4II* TspDTI CviJI BccI | ||| BplI | |NlaIV BbvII* | ||| BplI | CviJI MboII | ||FauI HgiJII* | |FatI Cac8I | BsiYI* SduI | CviAII AciI | PflMI NlaIII M K T E G I K S P S A K Y H D M A G S Q * R Q K E * K A H R Q N T M I W R A P R E D R R N K K P I G K I P * Y G G L P E ----:----|----:----|----:----|----:----|----:----|----:----| X F V S P I F L G D A F Y W S I A P E W X S S L L F L F G M P L I G H Y P P S G H L C F S Y F A W R C F V M I H R A G L MnlI | AciI CviRI* | | BplI | MwoI TfiI | | BplI | | CviJI HinfI | | | FauI CviJI | | | SfaNI \ \ \ \ \ \ \ \ \ \ AGAATCCCTCACAAGAACCCGCACATTCAAAAAGTGGCTGTTTTGCAAAGTAAGCCCAAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTAGGGAGTGTTCTTGGGCGTGTAAGTTTTTCACCGACAAAACGTTTCATTCGGGTTA / / / / / / / / / HinfI | | AciI FauI CviJI | MwoI CviJI TfiI | BplI CviRI* | BplI MnlI R I P H K N P H I Q K V A V L Q S K P N E S L T R T R T F K K W L F C K V S P I N P S Q E P A H S K S G C F A K * A Q * ----:----|----:----|----:----|----:----|----:----|----:----| L I G * L F G C M * F T A T K C L L G L S F G E C S G A C E F L P Q K A F Y A W S D R V L V R V N L F H S N Q L T L G I Hin6I |GlaI ||HhaI ||| ApoI ||| TspEI ||| |MboII ||| || MseI Hin4II* \\\ \\ \ \ AAGGAAGATGCGCTAAATTTAATAAAGGAAATCGCACATAAAGTTTCCTATCTAATGAAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTTCTACGCGATTTAAATTATTTCCTTTAGCGTGTATTTCAAAGGATAGATTACTTC / /// / / / / SfaNI ||| | | MseI Hin4II* ||| | TspEI ||| | ApoI ||| MboII ||Hin6I |GlaI HhaI K E D A L N L I K E I A H K V S Y L M K R K M R * I * * R K S H I K F P I * * R G R C A K F N K G N R T * S F L S N E G ----:----|----:----|----:----|----:----|----:----|----:----| L S S A S F K I F S I A C L T E * R I F Y P L H A L N L L P F R V Y L K R D L S L F I R * I * Y L F D C M F N G I * H L MaeII |PmaCI |BsaAI || MboI || BclI || SetI || TaiI || | MlyI || | PleI || | DpnI || | |BstKTI || | || HinfI || | || | BssKI || | || | EcoRII TspDTI || | || | |SecI* | MaeIII || | || | ||ScrFI | Tsp45I BstXI || | || | ||BseBI \ \ \ \\ \ \\ \ \\\ GAAAATCACTTCAAAGTGACCAACTTGGTGGAGTTTTACCCACGTGATCAAAGACTCCTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTAGTGAAGTTTCACTGGTTGAACCACCTCAAAATGGGTGCACTAGTTTCTGAGGAC / / / / // //// / / TspDTI | BstXI | || |||BclI | BseBI Tsp45I | || |||MboI | ScrFI MaeIII | || ||PleI HinfI | || |DpnI | || |MlyI | || BstKTI | |MaeII | BsaAI | PmaCI TaiI SetI E N H F K V T N L V E F Y P R D Q R L L K I T S K * P T W W S F T H V I K D S W K S L Q S D Q L G G V L P T * S K T P G ----:----|----:----|----:----|----:----|----:----|----:----| S F * K L T V L K T S N * G R S * L S R P F D S * L S W S P P T K G V H D F V G F I V E F H G V Q H L K V W T I L S E Q MaeII | SetI | TaiI | |HindII | |Hpy166II | || FatI | || NcoI | || StyI | || SecI* | || DsaI* | || |CviAII | || || MboI | || || XhoII | || || NlaIII | || || TspDTI | || || | DpnI | || || | |BstKTI | || || | ||DdeI | || || | ||| BinI* | || || | ||| | MaeIII | || || | ||| | | SfaNI | || || | ||| | | | Tsp4CI* SecI* | || || | ||| | | | | MseI DsaI* BseGI \ \\ \\ \ \\\ \ \ \ \ \ \ \ GGAATGAACGTCAACCATGGATCTAAGATAATGTTACGGTTAAGATGCTCCACGGATGAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTACTTGCAGTTGGTACCTAGATTCTATTACAATGCCAATTCTACGAGGTGCCTACTC / / / / / ///// / / / // / / / | | | | | ||||| | | BinI* || MseI | BseGI | | | | | ||||| | DdeI |SfaNI DsaI* | | | | | ||||| XhoII Tsp4CI* SecI* | | | | | ||||| MboI MaeIII | | | | | ||||DpnI | | | | | |||BstKTI | | | | | ||DsaI* | | | | | ||SecI* | | | | | ||StyI | | | | | ||NcoI | | | | | ||FatI | | | | | |CviAII | | | | | TspDTI | | | | NlaIII | | | Hpy166II | | | HindII | | MaeII | TaiI | SetI EcoRII BssKI SecI* G M N V N H G S K I M L R L R C S T D E E * T S T M D L R * C Y G * D A P R M S N E R Q P W I * D N V T V K M L H G * V ----:----|----:----|----:----|----:----|----:----|----:----| P I F T L W P D L I I N R N L H E V S S P F S R * G H I * S L T V T L I S W P H S H V D V M S R L Y H * P * S A G R I L HgiCI* | NlaIV FatI | |SduI NcoI | |BseSI StyI | ||FatI SecI* | |||CviAII DsaI* | |||| TseI |CviAII | |||| NlaIII || NlaIII | |||| |BisI || | AlfI | |||| ||BlsI AlfI TspEI || | AlfI | |||| |||CviRI* AlfI | FokI || | | BsgI | |||| |||| TspEI TaqII | TspGWI || | | |BbvI | |||| |||| | MseI | TspEI \ \ \\ \ \ \\ \ \\\\ \\\\ \ \ \ \ TTCCAATTTTTACCCATGGAGTGTATAATGGGCACCATGCTGCACGAATTAACTCACAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTTAAAAATGGGTACCTCACATATTACCCGTGGTACGACGTGCTTAATTGAGTGTTA / / / / /// / / / / ///// // / | | | | ||| BsgI | | | ||||CviRI* || TaqII | | | | ||AlfI | | | ||||TseI || AlfI | | | | ||AlfI | | | |||BisI || AlfI | | | | |DsaI* | | | ||BlsI |MseI | | | | |SecI* | | | |FatI TspEI | | | | |StyI | | | CviAII | | | | |NcoI | | HgiCI* | | | | |FatI | | NlaIII | | | | CviAII | NlaIV | | | NlaIII BseSI | | FokI SduI | TspEI BbvI TspGWI F Q F L P M E C I M G T M L H E L T H N S N F Y P W S V * W A P C C T N * L T I P I F T H G V Y N G H H A A R I N S Q F ----:----|----:----|----:----|----:----|----:----|----:----| N W N K G M S H I I P V M S C S N V * L T G I K V W P T Y L P C W A A R I L E C E L K * G H L T Y H A G H Q V F * S V I AsuI* AluI AvaII CviJI |BmgT120I |MaeI || Hpy166II ||SetI Hin4II* \\ \ \\\ \ TTATTCGGTCCACACGACAAAAAGTTCTACAATAAGCTAGATGAGTTGATTGGAAGGCAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AATAAGCCAGGTGTGCTGTTTTTCAAGATGTTATTCGATCTACTCAACTAACCTTCCGTT / // / / / / TspEI |Hpy166II | | MaeI Hin4II* |AvaII | CviJI |AsuI* | AluI BmgT120I SetI L F G P H D K K F Y N K L D E L I G R Q Y S V H T T K S S T I S * M S * L E G N I R S T R Q K V L Q * A R * V D W K A M ----:----|----:----|----:----|----:----|----:----|----:----| K N P G C S L F N * L L S S S N I P L C N I R D V R C F T R C Y A L H T S Q F A * E T W V V F L E V I L * I L Q N S P L Tsp4CI* | HindII | Hpy166II | | MaeII | | | SetI | | | TaiI | | | | SapI SetI | | | | Ksp632I* | Csp6I | | | | |BsmAI BsrDI MnlI | |RsaI | | | | |Esp3I \ \ \ \\ \ \ \ \ \\ TGGGTTATTGAACAAAGAGGTTTGTACGACACATTTTTGGGGAACGGTCAACGTCTCGGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCAATAACTTGTTTCTCCAAACATGCTGTGTAAAAACCCCTTGCCAGTTGCAGAGCCA / / / // / // / / BsrDI MnlI SetI |Csp6I | || MaeII Ksp632I* RsaI | |TaiI SapI | |SetI | Hpy166II | HindII Tsp4CI* W V I E Q R G L Y D T F L G N G Q R L G G L L N K E V C T T H F W G T V N V S V G Y * T K R F V R H I F G E R S T S R W ----:----|----:----|----:----|----:----|----:----|----:----| H T I S C L P K Y S V N K P F P * R R P I P * Q V F L N T R C M K P S R D V D R P N N F L S T Q V V C K Q P V T L T E T MboII TatI |MaeII |Csp6I || SetI EcoNI ||RsaI || TaiI EcoRV | BsiYI* ||ScaI \\ \ \ \ \ \\\ GGAAGAGCAAACTTACGTTCAAATAGATATCCTATGACAGGAATAAGTACTAACACAGGG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTCTCGTTTGAATGCAAGTTTATCTATAGGATACTGTCCTTATTCATGATTGTGTCCC / // / / / / /// Esp3I || MaeII EcoRV | EcoNI ||TatI BsmAI |TaiI BsiYI* |Csp6I |SetI ScaI MboII RsaI G R A N L R S N R Y P M T G I S T N T G E E Q T Y V Q I D I L * Q E * V L T Q G K S K L T F K * I S Y D R N K Y * H R D ----:----|----:----|----:----|----:----|----:----|----:----| P L A F K R E F L Y G I V P I L V L V P H F L L S V N L Y I D * S L F L Y * C L S S C V * T * I S I R H C S Y T S V C P Hin4I | MnlI | BseGI SetI | CviRI* | Hin4I | | Hpy178III* | | FokI | | | SfaNI Hin4I \ \ \ \ \ \ \ \ ATAGTGAGAAAAAGGGGCAAAGGTGTGAAGTTAGGGAGTTTGCATCCAGAGGGTATATCA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TATCACTCTTTTTCCCCGTTTCCACACTTCAATCCCTCAAACGTAGGTCTCCCATATAGT / / / / /// / // | Hin4I | | ||| | |SfaNI SetI | | ||| | Hin4I | | ||| Hpy178III* | | ||CviRI* | | |MnlI | | BseGI | Hin4I FokI I V R K R G K G V K L G S L H P E G I S * * E K G A K V * S * G V C I Q R V Y H S E K K G Q R C E V R E F A S R G Y I I ----:----|----:----|----:----|----:----|----:----|----:----| I T L F L P L P T F N P L K C G S P I D S L S F F P C L H S T L S N A D L P Y I Y H S F P A F T H L * P T Q M W L T Y * AciI |BisI ||BlsI |||TauI |||CviJI |||| MwoI |||| | TseI |||| | MwoI |||| | CviRI* Hin4I |||| | |BisI SfeI* | SetI AvaI |||| | ||BlsI | MnlI | TspEI |BmeT110I |||| | |||CviJI BbvI \ \ \ \ \\ \\\\ \ \\\\ \ TCTATAGATAGAGGTAATTCCCCGAGAGAGTTGGCGGCTTTTGCAGCCGAAAGGAGATAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGATATCTATCTCCATTAAGGGGCTCTCTCAACCGCCGAAAACGTCGGCTTTCCTCTATA / // / / // //// / //// / | || SetI | |AvaI |||| | |||CviJI BbvI | |Hin4I | BmeT110I |||| | |||TseI | SfeI* TspEI |||| | ||BisI MnlI |||| | |BlsI |||| | CviRI* |||| MwoI |||CviJI |||MwoI ||BisI ||AciI |BlsI TauI S I D R G N S P R E L A A F A A E R R Y L * I E V I P R E S W R L L Q P K G D I Y R * R * F P E R V G G F C S R K E I * ----:----|----:----|----:----|----:----|----:----|----:----| D I S L P L E G L S N A A K A A S L L Y M * L Y L Y N G S L T P P K Q L R F S I R Y I S T I G R S L Q R S K C G F P S I MboI MboI Esp3I MboII | DpnI BsmAI | DpnI | |BstKTI |AciI | |BstKTI SspI \ \\ \\ \ \\ \ AGAGATGATCGCTGGTGCGGAGAGACGAAGAATAACAAAGATCAAATAATAAGTGATAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTACTAGCGACCACGCCTCTCTGCTTCTTATTGTTTCTAGTTTATTATTCACTATTA // / // / // / / || MboI |BsmAI | || MboI SspI |DpnI |Esp3I | |DpnI BstKTI AciI | BstKTI MboII R D D R W C G E T K N N K D Q I I S D N E M I A G A E R R R I T K I K * * V I I R * S L V R R D E E * Q R S N N K * * Y ----:----|----:----|----:----|----:----|----:----|----:----| L S S R Q H P S V F F L L S * I I L S L Y L H D S T R L S S S Y C L D F L L H Y S I I A P A S L R L I V F I L Y Y T I I Csp6I |RsaI |SetI || BssKI || |AvaI || |BssKI || |SecI* || |Cfr9I TseI || ||HpaII |BisI || ||ScrFI ||BlsI || ||CauII* |||AluI || ||BmeT110I |||CviJI || |||SmaI |||| SetI || |||ScrFI |||| | DdeI BbvI MnlI || |||CauII* \\\\ \ \ \ \ \\ \\\\ ATTAGCAGCTCCTTAGAAGTTGTAATCCTTGATGATGATGACGAGGTACTCCCGGGAGAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TAATCGTCGAGGAATCTTCAACATTAGGAACTACTACTACTGCTCCATGAGGGCCCTCTA /// / / / / // //// ||CviJI DdeI BbvI MnlI | || |||BssKI ||TseI | || ||Cfr9I ||AluI | || ||BssKI |BisI | || ||SecI* BlsI | || ||AvaI SetI | || |BmeT110I | || |CauII* | || |HpaII | || |ScrFI | || CauII* | || ScrFI | || SmaI | |Csp6I | RsaI SetI I S S S L E V V I L D D D D E V L P G D L A A P * K L * S L M M M T R Y S R E I * Q L L R S C N P * * * * R G T P G R Y ----:----|----:----|----:----|----:----|----:----|----:----| I L L E K S T T I R S S S S S T S G P S Y * C S R L L Q L G Q H H H R P V G P L N A A G * F N Y D K I I I V L Y E R S I MboI | DpnI | |BstKTI TaqI | || MseI \ \ \\ \ ACTCTTATCGAAGTTATTGATCTCACTTAA 790 800 810 ----:----|----:----|----:----| TGAGAATAGCTTCAATAACTAGAGTGAATT / // / / TaqI || MboI MseI |DpnI BstKTI T L I E V I D L T * L L S K L L I S L X S Y R S Y * S H L X ----:----|----:----|----:----| V R I S T I S R V * Y E * R L * Q D * K S K D F N N I E S L # Enzymes that cut Frequency Isoschizomers AciI 4 BspACI,SsiI AlfI 2 AluI 2 AluBI ApoI 1 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 1 BclI 1 FbaI,Ksp22I BinI* 1 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmeT110I 2 BmgT120I 1 BplI 2 BsaAI 1 BstBAI,Ppu21I BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseSI 1 BaeGI,BstSLI BsgI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 2 Alw26I,BstMAI BsrDI 1 BseMI,Bse3DI BssKI 3 BstSCI,StyD4I BstKTI 5 BstXI 1 Cac8I 1 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr9I 1 TspMI,XmaCI,XmaI Csp6I 3 CviQI,RsaNI CviAII 4 CviJI 8 CviKI-1 CviRI* 4 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 5 MalI DsaI* 3 BtgI,BstDSI EcoNI 1 BstENI,XagI EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 2 BsmBI FatI 4 FauI 2 SmuI FokI 2 GlaI 1 HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 3 HpyAV Hin6I 1 HinP1I,HspAI HindII 2 HincII HinfI 2 HpaII 1 HapII,BsiSI,MspI Hpy166II 3 Hpy8I Hpy178III* 1 Hpy188III Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 2 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MlyI 1 SchI MnlI 5 MseI 4 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NcoI 2 Bsp19I NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I PflMI 1 BasI,AccB7I,Van91I PleI 1 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI RsaI 3 AfaI SapI 1 LguI,PciSI,BspQI ScaI 1 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 10 SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SmaI 1 SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 1 TaqII 1 TatI 1 TauI 1 TfiI 1 PfeI TseI 3 ApeKI Tsp45I 1 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 5 TasI,Tsp509I,Sse9I TspGWI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BceAI BcgI BciVI BdaI BetI* BfiI BglI BglII BmtI Bpu10I BsaBI BsaXI BseMII BsePI BseRI BseYI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtrI BtsI Cfr10I CfrI ClaI CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoP15I EcoRI EcoT22I EgeI EheI EspI* FalI FaqI FnuDII* FseI FspAI GsaI GsuI HaeII HaeIII HgaI HgiAI* HindIII HpaI HphI Hpy188I Hpy99I KasI KpnI MauBI McrI* MfeI MluI MmeI Mph1103I MroNI MslI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PfoI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TsoI TspRI TstI Tth111I VspI XbaI XcmI XhoI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769