Restriction Map of CIA2/YHR122W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

CIA2/YHR122W on chromosome VIII from coordinates 353625 to 354320.


Hpy178III* DdeI | MnlI BseRI |Hpy188I | | TspDTI | MaeI \\ \ \ \ \ \ ATGTCTGAGTTTTTGAATGAAAATCCCGACATTTTAGAGGAGAACCAACTTCCCACTAGA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGACTCAAAAACTTACTTTTAGGGCTGTAAAATCTCCTCTTGGTTGAAGGGTGATCT / / / // / / | DdeI | |TspDTI BseRI MaeI Hpy188I | MnlI Hpy178III* M S E F L N E N P D I L E E N Q L P T R C L S F * M K I P T F * R R T N F P L E V * V F E * K S R H F R G E P T S H * K ----:----|----:----|----:----|----:----|----:----|----:----| X D S N K F S F G S M K S S F W S G V L X T Q T K S H F D R C K L P S G V E W * H R L K Q I F I G V N * L L V L K G S S Csp6I |RsaI || StyI || SecI* || | MboII || | | AsuI* || | | AvaII || | | DraII || | | PpuMI || | | |BmgT120I AluI || | | || SetI CviJI || | | || | FauI AciI MwoI | SetI \\ \ \ \\ \ \ \ \ \ \ AAAGAAGATAGTACCAAGGACCTTTTGTTAGGCGGGTTCAGCAACGAAGCTACGCTGGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTCTATCATGGTTCCTGGAAAACAATCCGCCCAAGTCGTTGCTTCGATGCGACCTT // / //// / // / / || | |||PpuMI FauI |MwoI | CviJI || | |||DraII AciI | AluI || | |||AvaII SetI || | |||AsuI* || | ||BmgT120I || | |SetI || | SecI* || | StyI || MboII |Csp6I RsaI K E D S T K D L L L G G F S N E A T L E K K I V P R T F C * A G S A T K L R W K R R * Y Q G P F V R R V Q Q R S Y A G K ----:----|----:----|----:----|----:----|----:----|----:----| F S S L V L S R K N P P N L L S A V S S F L L Y Y W P G K T L R T * C R L * A P F F I T G L V K Q * A P E A V F S R Q F MseI |AhaIII* || DdeI || | BsmAI || | | SetI || | | | CviRI* || | | | | MnlI || | | | | BspCNI CviJI || | | | | |BseMII \ \\ \ \ \ \ \\ AGGAGAAGCCTTTTGCTGAAAATAGACCATTCTTTAAAGTCTCAGGTATTGCAAGATATA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTCTTCGGAAAACGACTTTTATCTGGTAAGAAATTTCAGAGTCCATAACGTTCTATAT / // // / /// CviJI |MseI || | ||BseMII AhaIII* || | ||MnlI || | |BspCNI || | CviRI* || BsmAI |DdeI SetI R R S L L L K I D H S L K S Q V L Q D I G E A F C * K * T I L * S L R Y C K I * E K P F A E N R P F F K V S G I A R Y R ----:----|----:----|----:----|----:----|----:----|----:----| L L L R K S F I S W E K F D * T N C S I F S F G K A S F L G N K L T E P I A L Y P S A K Q Q F Y V M R * L R L Y Q L I Y TaqI HindIII AsuII | AluI | ApoI SetI | CviJI | TspEI MnlI |DdeI | | SetI | EcoRI | Hpy188I \\ \ \ \ \ \ \ \ GAGGTCTTAGACAAGCTTCTTTCCATTCGAATTCCACCAGAACTGACTTCCGATGAGGAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCAGAATCTGTTCGAAGAAAGGTAAGCTTAAGGTGGTCTTGACTGAAGGCTACTCCTA / / / / / / / / / SetI | | | HindIII | EcoRI | Hpy188I | | CviJI | TspEI MnlI | | AluI | ApoI | SetI AsuII DdeI TaqI E V L D K L L S I R I P P E L T S D E D R S * T S F F P F E F H Q N * L P M R I G L R Q A S F H S N S T R T D F R * G * ----:----|----:----|----:----|----:----|----:----|----:----| S T K S L S R E M R I G G S S V E S S S L P R L C A E K W E F E V L V S K R H P L D * V L K K G N S N W W F Q S G I L I MnlI AciI FokI | TspDTI TfiI | EcoP15I Cac8I HinfI | | MnlI | Hin4I | FauI | | Hin4I SapI | | MnlI TspGWI | BseGI | | | MnlI Ksp632I* CviJI \ \ \ \ \ \ \ \ \ \ \ \ AGTTTGCCAGCAGAAAGCGAGGATGAATCCGTAGCGGGTGGAGGAAAGGAGGAGGAAGAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAACGGTCGTCTTTCGCTCCTACTTAGGCATCGCCCACCTCCTTTCCTCCTCCTTCTC / / / / / // / /// // / / / | | MnlI TspGWI | || | ||| || MnlI | Bce83I* | Cac8I | || | ||| |MnlI | CviJI Hin4I | || | ||| EcoP15I Ksp632I* | || | ||FokI SapI | || | |Hin4I | || | TspDTI | || | AciI | || MnlI | |FauI | HinfI | TfiI BseGI S L P A E S E D E S V A G G G K E E E E V C Q Q K A R M N P * R V E E R R R K S F A S R K R G * I R S G W R K G G G R A ----:----|----:----|----:----|----:----|----:----|----:----| L K G A S L S S S D T A P P P F S S S S Y N A L L F R P H I R L P H L F P P P L T Q W C F A L I F G Y R T S S L L L F L Bce83I* |MboI |SfaNI BseMII ||BseRI |BspCNI |||DpnI AluI || Hpy188I ||||BstKTI SmlI CviJI || | DdeI |||||MboII | Hpy178III* | SetI || | Bpu10I \\\\\\ \ \ \ \ \\ \ \ CCTGATCTCATTGATGCTCAAGAAATATATGATTTGATAGCTCATATTTCCGACCCTGAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTAGAGTAACTACGAGTTCTTTATATACTAAACTATCGAGTATAAAGGCTGGGACTC / //// / / / // / // | |||SfaNI Hpy178III* | | || Hpy188I |Bpu10I | |||MboI SmlI | | |BspCNI |DdeI | ||MboII | | BseMII HgiAI* | |DpnI | CviJI SduI | BstKTI | AluI BseRI SetI P D L I D A Q E I Y D L I A H I S D P E L I S L M L K K Y M I * * L I F P T L S * S H * C S R N I * F D S S Y F R P * A ----:----|----:----|----:----|----:----|----:----|----:----| G S R M S A * S I Y S K I A * I E S G S A Q D * Q H E L F I H N S L E Y K R G Q R I E N I S L F Y I I Q Y S M N G V R L MboII | FatI | BspHI | |CviAII | |Hpy178III* SduI BslFI | || TfiI HgiAI* | ApoI | || HinfI | MseI MmeI | TspEI TspDTI | || NlaIII \ \ \ \ \ \ \ \\ \ CACCCGTTAAGTCTGGGACAACTCTCTGTTGTAAATTTGGAAGATATTGATGTTCATGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTGGGCAATTCAGACCCTGTTGAGAGACAACATTTAAACCTTCTATAACTACAAGTACTA / / / / / / / // | MmeI | | TspDTI | | |BspHI MseI | TspEI | | |FatI | ApoI | | Hpy178III* BslFI | | CviAII | NlaIII MboII H P L S L G Q L S V V N L E D I D V H D T R * V W D N S L L * I W K I L M F M I P V K S G T T L C C K F G R Y * C S * F ----:----|----:----|----:----|----:----|----:----|----:----| C G N L R P C S E T T F K S S I S T * S A G T L D P V V R Q Q L N P L Y Q H E H V R * T Q S L E R N Y I Q F I N I N M I Hpy178III* | MboI | BclI Eco57I | | DpnI Eco57MI Hpy178III* CviJI | | |BstKTI | TspEI \ \ \ \ \\ \ \ TCAGGAAACCAGAACGAAATGGCTGAAGTCGTGATCAAAATAACACCAACAATTACCCAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCCTTTGGTCTTGCTTTACCGACTTCAGCACTAGTTTTATTGTGGTTGTTAATGGGTA / / / /// / / / | Hpy178III* CviJI ||| BclI Eco57MI TspEI HinfI ||| MboI Eco57I TfiI ||DpnI |BstKTI Hpy178III* S G N Q N E M A E V V I K I T P T I T H Q E T R T K W L K S * S K * H Q Q L P I R K P E R N G * S R D Q N N T N N Y P L ----:----|----:----|----:----|----:----|----:----|----:----| E P F W F S I A S T T I L I V G V I V W N L F G S R F P Q L R S * F L V L L * G * S V L V F H S F D H D F Y C W C N G M AclI SetI MaeII | BsmAI | SetI SetI | Eco31I | TaiI BciVI | MboII | | Ksp632I* \ \ \ \ \ \ \ \ TGTTCTCTGGCAACGTTGATTGGTCTGGGGATACGGGTCAGGTTAGAAAGGTCTCTTCCC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAGAGACCGTTGCAACTAACCAGACCCCTATGCCCAGTCCAATCTTTCCAGAGAAGGG / / / / / / / | MaeII BciVI SetI | SetI Eco31I | AclI MboII BsmAI TaiI SetI C S L A T L I G L G I R V R L E R S L P V L W Q R * L V W G Y G S G * K G L F P F S G N V D W S G D T G Q V R K V S S P ----:----|----:----|----:----|----:----|----:----|----:----| Q E R A V N I P R P I R T L N S L D R G N N E P L T S Q D P S V P * T L F T E E T R Q C R Q N T Q P Y P D P * F P R K G Csp6I |RsaI |SetI || FatI || BspHI BssKI || MboII SexAI || |CviAII EcoRII || |Hpy178III* | ScrFI || || NlaIII | BseBI TspEI || || |MslI | | SetI \ \\ \\ \\ \ \ \ CCAAGATTTAGAATTACTATTTTGTTGAAGAAAGGTACTCATGATAGTGAGAACCAGGTA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTCTAAATCTTAATGATAAAACAACTTCTTTCCATGAGTACTATCACTCTTGGTCCAT / / / //// /// // / Ksp632I* TspEI | |||| ||MslI || EcoRII | |||| |BspHI || SexAI | |||| |FatI || BssKI | |||| Hpy178III* |BseBI | |||| CviAII |ScrFI | |||NlaIII SetI | ||MboII | |Csp6I | RsaI SetI P R F R I T I L L K K G T H D S E N Q V Q D L E L L F C * R K V L M I V R T R * K I * N Y Y F V E E R Y S * * * E P G K ----:----|----:----|----:----|----:----|----:----|----:----| G L N L I V I K N F F P V * S L S F W T G L I * F * * K T S S L Y E H Y H S G P W S K S N S N Q Q L F T S M I T L V L Y BbvI | MaeII | AflIII | | SetI | | TaiI | | | TseI | | | |BisI | | | ||BlsI | | | |||TseI | | | |||AluI | | | |||CviJI | | | |||PvuII | | | |||NspBII* | | | ||||BisI | | | |||||BlsI | | | |||||SetI | | | ||||||FatI | | | ||||||CviRI* | | | |||||||CviAII | | | |||||||| NspI | | | |||||||| NlaIII | | | |||||||| | BbvI TaqII Tsp4CI* \ \ \ \\\\\\\\ \ \ \ \ AATAAACAACTAAATGATAAGGAACGTGTAGCAGCTGCATGTGAGAATGAACAACTGTTG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTGTTGATTTACTATTCCTTGCACATCGTCGACGTACACTCTTACTTGTTGACAAC / // / ////// // / / / | || | |||||| |FatI TaqII | TspDTI | || | |||||| CviAII BbvI Tsp4CI* | || | |||||CviRI* | || | |||||NlaIII | || | |||||TseI | || | |||||NspI | || | ||||BisI | || | |||BlsI | || | ||NspBII* | || | ||PvuII | || | ||CviJI | || | ||TseI | || | ||AluI | || | |BisI | || | BlsI | || | SetI | || AflIII | |MaeII | BbvI TaiI SetI N K Q L N D K E R V A A A C E N E Q L L I N N * M I R N V * Q L H V R M N N C W * T T K * * G T C S S C M * E * T T V G ----:----|----:----|----:----|----:----|----:----|----:----| F L C S F S L S R T A A A H S F S C S N L Y V V L H Y P V H L L Q M H S H V V T I F L * I I L F T Y C S C T L I F L Q Q DdeI MaeIII TspDTI |BsmAI Tsp45I \ \\ \ GGTGTAGTCTCTAAGATGTTAGTGACTTGTAAGTAA 670 680 690 ----:----|----:----|----:----|----:- CCACATCAGAGATTCTACAATCACTGAACATTCATT / / / | BsmAI Tsp45I DdeI MaeIII G V V S K M L V T C K * V * S L R C * * L V S X C S L * D V S D L * V X ----:----|----:----|----:----|----:- P T T E L I N T V Q L Y P H L R * S T L S K Y T T Y D R L H * H S T L L # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AclI 1 Psp1406I AflIII 1 AhaIII* 1 DraI AluI 4 AluBI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I Bce83I* 1 BpuEI BciVI 1 BfuI BclI 1 FbaI,Ksp22I BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 Bpu10I 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 2 BseRI 2 BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BspCNI 2 BspHI 2 CciI,PagI,RcaI BssKI 1 BstSCI,StyD4I BstKTI 2 Cac8I 1 BstC8I Csp6I 2 CviQI,RsaNI CviAII 3 CviJI 7 CviKI-1 CviRI* 2 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 2 MalI DraII 1 EcoO109I Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 1 EcoP15I 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI FatI 3 FauI 2 SmuI FokI 1 HgiAI* 1 Bbv12I,BsiHKAI,Alw21I Hin4I 1 HindIII 1 HinfI 2 Hpy178III* 6 Hpy188III Hpy188I 3 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 1 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MmeI 1 MnlI 7 MseI 2 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NlaIII 3 Hin1II,Hsp92II,FaeI NspBII* 1 MspA1I NspI 1 BstNSI,XceI PpuMI 1 Psp5II,PspPPI PvuII 1 RsaI 2 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 13 SexAI 1 MabI SfaNI 1 LweI SmlI 1 SmoI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 1 TaqII 1 TfiI 2 PfeI TseI 2 ApeKI Tsp45I 1 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 4 TasI,Tsp509I,Sse9I TspGWI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BalI BamHI BarI BbvCI BbvII* BccI BceAI BcgI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmtI BplI BsaAI BsaBI BsaXI BsePI BseSI BseYI BsgI BsiI* BsiYI* BsmI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HaeIII HgaI HgiCI* HgiJII* HhaI Hin4II* Hin6I HindII HinP1I HpaI HpaII HphI Hpy166II Hpy8I Hpy99I HspAI KasI KpnI MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SauI* ScaI SchI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TatI TauI TsoI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769