Restriction Map of SET1/YHR119W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SET1/YHR119W on chromosome VIII from coordinates 346043 to 349285.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.15245

MboII BbvII* |SduI |HgiAI* || MluI BssKI SapI || AflIII SecI* SfeI* || | FnuDII* EcoRII Ksp632I* || | |MboII | ScrFI TspEI | HgaI || | |TspDTI | BseBI \ \ \ \\ \ \\ \ \ ATGTCAAATTACTATAGAAGAGCACACGCGTCTTCTGGTTCATACAGACAACCCCAGGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTTTAATGATATCTTCTCGTGTGCGCAGAAGACCAAGTATGTCTGTTGGGGTCCTT / // / / // / /// | || | | || AflIII ||EcoRII | || | | || MluI ||BssKI | || | | |FnuDII* |SecI* | || | | |MboII BseBI | || | | BbvII* ScrFI | || | | TspDTI | || | MboII | || | HgaI | || HgiAI* | || SduI | |SfeI* | Ksp632I* | SapI TspEI M S N Y Y R R A H A S S G S Y R Q P Q E C Q I T I E E H T R L L V H T D N P R N V K L L * K S T R V F W F I Q T T P G T ----:----|----:----|----:----|----:----|----:----|----:----| X D F * * L L A C A D E P E Y L C G W S X T L N S Y F L V R T K Q N M C V V G P H * I V I S S C V R R R T * V S L G L F SspI | MnlI CfrI | |FnuDII* |HphI | || MaeIII ||CviJI CviJI | || Tsp45I ||HaeIII BceAI \ \ \\ \ \\\ \ CAGCCTCAATATTCGCGTTCTGGTCACTATCAGTATTCAAACGGCCATTCTCACCAACAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGGAGTTATAAGCGCAAGACCAGTGATAGTCATAAGTTTGCCGGTAAGAGTGGTTGTT / / / / / / / / / CviJI | | FnuDII* Tsp45I | | CfrI BceAI | MnlI MaeIII | HaeIII SspI | CviJI HphI Q P Q Y S R S G H Y Q Y S N G H S H Q Q S L N I R V L V T I S I Q T A I L T N N A S I F A F W S L S V F K R P F S P T I ----:----|----:----|----:----|----:----|----:----|----:----| C G * Y E R E P * * * Y E F P W E * W C V A E I N A N Q D S D T N L R G N E G V L R L I R T R T V I L I * V A M R V L L MaeII | SalI | SgrDI | |TaqI | |AccI | |SetI | |TaiI | ||HindII | ||Hpy166II | |||Hpy99I BccI | ||||MaeII | MslI | ||||| Hpy99I | | BstXI | ||||| |SetI | | | Csp6I SspI | ||||| |TaiI | | | |RsaI | MaeI | ||||| || PsiI | | | ||TsoI Hpy99I \ \ \ \\\\\ \\ \ \ \ \ \\\ \ TATTCTAGTCAATATAATCAACGTCGACGTTATAACCATAATGATGGTACAAGGCGACGC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGATCAGTTATATTAGTTGCAGCTGCAATATTGGTATTACTACCATGTTCCGCTGCG / / // ///// / / // / /// / SspI MaeI || ||||| | PsiI || MslI ||| Hpy99I || ||||| MaeII |BstXI ||Csp6I || ||||SgrDI BccI |RsaI || ||||SalI TsoI || |||AccI || |||TaqI || |||TaiI || |||SetI || ||Hpy166II || ||HindII || |Hpy99I || MaeII |Hpy99I TaiI SetI Y S S Q Y N Q R R R Y N H N D G T R R R I L V N I I N V D V I T I M M V Q G D A F * S I * S T S T L * P * * W Y K A T L ----:----|----:----|----:----|----:----|----:----|----:----| Y E L * Y L * R R R * L W L S P V L R R I N * D I Y D V D V N Y G Y H H Y L A V I R T L I I L T S T I V M I I T C P S A CviRI* | Csp6I | |RsaI HgaI | || FnuDII* | MboI | || | TatI | | DpnI | || | Tsp4CI* | | |PvuI | || | |Csp6I | | |McrI* | || | ||RsaI | | |BstKTI | || | ||ScaI \ \ \\ \ \\ \ \\\ TATAATGACGATCGCCCACATAGTTCAAACAATGCAAGTACGCGACAGTACTATGCTACT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTACTGCTAGCGGGTGTATCAAGTTTGTTACGTTCATGCGCTGTCATGATACGATGA // / / // / / /// || MboI | || | | ||TatI |DpnI | || | | |Csp6I BstKTI | || | | ScaI McrI* | || | | RsaI HgaI | || | Tsp4CI* PvuI | || FnuDII* | |Csp6I | RsaI CviRI* Y N D D R P H S S N N A S T R Q Y Y A T I M T I A H I V Q T M Q V R D S T M L L * * R S P T * F K Q C K Y A T V L C Y * ----:----|----:----|----:----|----:----|----:----|----:----| * L S S R G C L E F L A L V R C Y * A V S Y H R D G V Y N L C H L Y A V T S H * I I V I A W M T * V I C T R S L V I S S AciI BglI MwoI |BisI ||BlsI ||AsuI* |||TauI |||CviJI |||HaeIII Hpy188I |||BmgT120I | FatI CviJI |||| NdeI MmeI Hpy188I MnlI | |CviAII \ \\\\ \ \ \ \ \ \\ AACAACAGCCAAAGCGGCCCATATGTAAATAAGAAATCTGACATCAGTAGTCGGAGGGGC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTGTCGGTTTCGCCGGGTATACATTTATTCTTTAGACTGTAGTCATCAGCCTCCCCG / / ////// / / / / / / | | |||||| NdeI MmeI Hpy188I MnlI | NlaIII | | |||||AsuI* | NspI | | ||||BmgT120I Hpy188I | | |||HaeIII | | |||CviJI | | ||BisI | | ||AciI | | |BlsI | | TauI | MwoI | BglI CviJI N N S Q S G P Y V N K K S D I S S R R G T T A K A A H M * I R N L T S V V G G A Q Q P K R P I C K * E I * H Q * S E G H ----:----|----:----|----:----|----:----|----:----|----:----| L L L W L P G Y T F L F D S M L L R L P * C C G F R G M H L Y S I Q C * Y D S P V V A L A A W I Y I L F R V D T T P P A BsrDI Hpy166II TaqI | MboII | MboII NspI | BbvII* | | MboI NlaIII | | BplI | | XhoII | BsmAI Tsp4CI* | HgaI | BplI | | | DpnI \ \ \ \ \ \ \ \ \ \ \ ATGTCTCAATCACGGTATTCAAATAGCAATGTTCACAATACATTAGCGTCTTCGAGTGGA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGAGTTAGTGCCATAAGTTTATCGTTACAAGTGTTATGTAATCGCAGAAGCTCACCT // // / / / / / // |FatI |Tsp4CI* | | | BbvII* | |DpnI CviAII BsmAI | | MboII | BstKTI | | HgaI MboII | | BplI TaqI | | BplI | Hpy166II BsrDI M S Q S R Y S N S N V H N T L A S S S G C L N H G I Q I A M F T I H * R L R V D V S I T V F K * Q C S Q Y I S V F E W I ----:----|----:----|----:----|----:----|----:----|----:----| M D * D R Y E F L L T * L V N A D E L P C T E I V T N L Y C H E C Y M L T K S H H R L * P I * I A I N V I C * R R R T S BstKTI | BinI* | | Ksp632I* | | | TfiI FalI | | | HinfI FalI | | | | AlwNI | Eco57I Hin4II* | | | | |BplI | Eco57MI | FalI | | | | |BplI | |CviRI* SetI | FalI \ \ \ \ \\ \ \\ \ \ \ TCTCTTCCCACAGAATCTGCTCTGCTTTTGCAACAAAGACCACCTTCAGTTTTGAGATAC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGAAGGGTGTCTTAGACGAGACGAAAACGTTGTTTCTGGTGGAAGTCAAAACTCTATG / / /// / / / / / / / | | ||| HinfI FalI | CviRI* SetI | FalI | | ||| TfiI FalI Eco57MI | FalI | | ||AlwNI Eco57I Hin4II* | | |BplI | | |BplI | | Ksp632I* | BinI* XhoII MboI S L P T E S A L L L Q Q R P P S V L R Y L F P Q N L L C F C N K D H L Q F * D T S S H R I C S A F A T K T T F S F E I Q ----:----|----:----|----:----|----:----|----:----|----:----| D R G V S D A R S K C C L G G E T K L Y I E E W L I Q E A K A V F V V K L K S I R K G C F R S Q K Q L L S W R * N Q S V BinI* | MboI TspDTI | | DpnI BsiYI* TspEI | DdeI | | |BstKTI | MboII \ \ \ \ \ \\ \ \ AACACAGATAATTTGAAGTCTAAGTTTCATTATTTTGATCCCATAAAAGGCGAGTTCTTC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTGTCTATTAAACTTCAGATTCAAAGTAATAAAACTAGGGTATTTTCCGCTCAAGAAG // / / // / / / |TspDTI DdeI | || | | MboII TspEI | || | BsiYI* | || MboI | |DpnI | BstKTI BinI* N T D N L K S K F H Y F D P I K G E F F T Q I I * S L S F I I L I P * K A S S S H R * F E V * V S L F * S H K R R V L Q ----:----|----:----|----:----|----:----|----:----|----:----| L V S L K F D L N * * K S G M F P S N K C C L Y N S T * T E N N Q D W L L R T R V C I I Q L R L K M I K I G Y F A L E E CviJI ApoI SfaNI Hin4II* |SfeI* TspEI Hpy188I SetI \ \ \\ \ \ \ AATAAGGATAAGATGCTTTCGTGGAAGGCTACAGATAAAGAATTTTCTGAAACAGGTTAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTCCTATTCTACGAAAGCACCTTCCGATGTCTATTTCTTAAAAGACTTTGTCCAATA / / / / / / / SfaNI Hin4II* | SfeI* | | SetI CviJI | Hpy188I TspEI ApoI N K D K M L S W K A T D K E F S E T G Y I R I R C F R G R L Q I K N F L K Q V I * G * D A F V E G Y R * R I F * N R L L ----:----|----:----|----:----|----:----|----:----|----:----| L L S L I S E H F A V S L S N E S V P * * Y P Y S A K T S P * L Y L I K Q F L N I L I L H K R P L S C I F F K R F C T I BseGI MaeII | FokI |BsaAI | BetI* |SnaBI | BspMII* || SetI MaeIII Tsp4CI* | |HpaII || TaiI | BccI | MseI FokI | |Hpy178III* \\ \ \ \ \ \ \ \ \\ TACGTAGTCAAAGAGTTACAAGATGGACAGTTTAAGTTCAAAATAAAACACAGACATCCG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCATCAGTTTCTCAATGTTCTACCTGTCAAATTCAAGTTTTATTTTGTGTCTGTAGGC / // / / / / / / / | |MaeII | MaeIII | MseI FokI BseGI Hpy178III* | SnaBI BccI Tsp4CI* HpaII | BsaAI TaiI SetI Y V V K E L Q D G Q F K F K I K H R H P T * S K S Y K M D S L S S K * N T D I R R S Q R V T R W T V * V Q N K T Q T S G ----:----|----:----|----:----|----:----|----:----|----:----| * T T L S N C S P C N L N L I F C L C G N R L * L T V L H V T * T * F L V C V D V Y D F L * L I S L K L E F Y F V S M R Tsp4CI* | FatI | MmeI BseGI | BspHI | Hpy188I | |CviAII | | SfaNI | |Hpy178III* | | | MaeII | || TspDTI | | | |BsaAI | || |NlaIII | | | || SetI | || || MaeI | | | || TaiI | || || | AciI \ \ \ \\ \ \ \\ \\ \ \ GAGATAAAAGCATCCGACCCACGTAATGAAAACGGTATCATGACTAGCGGAAAAGTGGCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTATTTTCGTAGGCTGGGTGCATTACTTTTGCCATAGTACTGATCGCCTTTTCACCGT / / / / // / / // // / / | BseGI | | |SfaNI | | || || | AciI BspMII* | | |MaeII | | || || MaeI BetI* | | BsaAI | | || |BspHI FokI | TaiI | | || |FatI | SetI | | || Hpy178III* Hpy188I | | || CviAII | | |TspDTI | | NlaIII | MmeI Tsp4CI* E I K A S D P R N E N G I M T S G K V A R * K H P T H V M K T V S * L A E K W Q D K S I R P T * * K R Y H D * R K S G N ----:----|----:----|----:----|----:----|----:----|----:----| S I F A D S G R L S F P I M V L P F T A P S L L M R G V Y H F R Y * S * R F L P L Y F C G V W T I F V T D H S A S F H C BsaXI Csp6I Hin4I |RsaI CviRI* TspEI | MnlI |SetI \ \ \ \ \\ ACCCACAGAAAATGCAGGAACTCACTAATTCTATTGCCTCGCATATCTTATGACAGGTAC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TGGGTGTCTTTTACGTCCTTGAGTGATTAAGATAACGGAGCGTATAGAATACTGTCCATG / / / / / / // CviRI* TspEI | BsaXI MnlI | |Csp6I Hin4I | RsaI SetI T H R K C R N S L I L L P R I S Y D R Y P T E N A G T H * F Y C L A Y L M T G T P Q K M Q E L T N S I A S H I L * Q V L ----:----|----:----|----:----|----:----|----:----|----:----| V W L F H L F E S I R N G R M D * S L Y L G C F I C S S V L E I A E C I K H C T G V S F A P V * * N * Q R A Y R I V P V DdeI SauI* | AsuI* | DraII | |TspDTI | |BmgT120I | ||CviJI | ||HaeIII | ||| BsaXI | ||| | Hin4I | ||| | | FatI Hin6I | ||| | | |MnlI |GlaI | ||| | | |CviAII ||HhaI | ||| | | || NlaIII ||| TfiI | ||| | | || | Hin4II* ||| HinfI \ \\\ \ \ \\ \ \ \\\ \ TCCTTAGGGCCTCCCCCTTCATGTGAAATAGTTGTCTATCCAGCGCAAGATTCAACAACA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAATCCCGGAGGGGGAAGTACACTTTATCAACAGATAGGTCGCGTTCTAAGTTGTTGT / // / // / /// / | |Hin4I | || Hin4II* ||Hin6I HinfI | |BsaXI | |FatI |GlaI TfiI | |DraII | CviAII HhaI | |AsuI* NlaIII | BmgT120I MnlI | HaeIII | CviJI TspDTI SauI* DdeI S L G P P P S C E I V V Y P A Q D S T T P * G L P L H V K * L S I Q R K I Q Q Q L R A S P F M * N S C L S S A R F N N N ----:----|----:----|----:----|----:----|----:----|----:----| E K P G G G E H S I T T * G A C S E V V S R L A E G K M H F L Q R D L A L N L L G * P R G R * T F Y N D I W R L I * C C MseI ApoI |AhaIII* TspEI \\ \ ACCAATATCCAAGACATATCAATAAAAAACTATTTTAAAAAGTATGGAGAAATTTCTCAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTATAGGTTCTGTATAGTTATTTTTTGATAAAATTTTTCATACCTCTTTAAAGAGTA // / |MseI TspEI AhaIII* ApoI T N I Q D I S I K N Y F K K Y G E I S H P I S K T Y Q * K T I L K S M E K F L I Q Y P R H I N K K L F * K V W R N F S F ----:----|----:----|----:----|----:----|----:----|----:----| V L I W S M D I F F * K L F Y P S I E * L W Y G L C I L L F S N * F T H L F K E G I D L V Y * Y F V I K F L I S F N R M SetI BinI* Hin6I | FatI |MseI |GlaI | CviRI* || MboI |Eco47III | |CviAII || | DpnI ||HhaI | || NspI || | |BstKTI |||HaeII | || NlaIII PsiI \\ \ \\ \\\\ \ \\ \ \ TTTGAAGCATTTAATGATCCTAATAGCGCTTTACCTTTGCATGTTTATCTTATAAAGTAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTTCGTAAATTACTAGGATTATCGCGAAATGGAAACGTACAAATAGAATATTTCATA / / // / //// / / // / / | | || MboI |||| SetI | |FatI PsiI BsrI | | |DpnI |||Hin6I | CviAII | | BstKTI ||Eco47III CviRI* | MseI ||GlaI NlaIII BinI* |HhaI NspI HaeII F E A F N D P N S A L P L H V Y L I K Y L K H L M I L I A L Y L C M F I L * S M * S I * * S * * R F T F A C L S Y K V C ----:----|----:----|----:----|----:----|----:----|----:----| K S A N L S G L L A K G K C T * R I F Y N Q L M * H D * Y R K V K A H K D * L T K F C K I I R I A S * R Q M N I K Y L I TseI CviRI* |BisI ||BlsI ||| MwoI ||| BceAI ||| | TseI Hpy188I ||| | MwoI | SfaNI ||| | |BisI | | TspEI ||| | ||BlsI BsrI | | | MseI ||| | |||BbvI MwoI | BccI | | | VspI ||| | |||CviJI | BbvI MboII \ \ \ \ \ \ \\\ \ \\\\ \ \ \ GCCAGTTCTGATGGAAAAATTAATGATGCAGCAAAAGCAGCCTTTAGTGCCGTTAGAAAG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTCAAGACTACCTTTTTAATTACTACGTCGTTTTCGTCGGAAATCACGGCAATCTTTC / / / // //// / / /// // / / | Hpy188I | |VspI |||| | | ||| |BbvI BbvI MboII BccI | |MseI |||| | | ||| MwoI | TspEI |||| | | ||CviJI SfaNI |||| | | ||TseI |||| | | |BisI |||| | | BlsI |||| | BceAI |||| MwoI |||MwoI |||TseI ||BisI |BlsI CviRI* A S S D G K I N D A A K A A F S A V R K P V L M E K L M M Q Q K Q P L V P L E S Q F * W K N * * C S K S S L * C R * K A ----:----|----:----|----:----|----:----|----:----|----:----| A L E S P F I L S A A F A A K L A T L F H W N Q H F F * H H L L L L R * H R * F G T R I S F N I I C C F C G K T G N S L MseI FatI |AhaIII* |CviAII || BdaI TfiI || NlaIII TaqI || BdaI HinfI || | CviJI AsuII || BsmI \ \\ \ \ \ \\ \ CACGAATCTTCGGGTTGCTTTATCATGGGCTTCAAGTTCGAAGTGATTTTAAACAAGCAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCTTAGAAGCCCAACGAAATAGTACCCGAAGTTCAAGCTTCACTAAAATTTGTTCGTA / / // / / // / HinfI | || CviJI AsuII || BsmI TfiI | |FatI TaqI || BdaI | CviAII || BdaI NlaIII |MseI AhaIII* H E S S G C F I M G F K F E V I L N K H T N L R V A L S W A S S S K * F * T S I R I F G L L Y H G L Q V R S D F K Q A F ----:----|----:----|----:----|----:----|----:----|----:----| C S D E P Q K I M P K L N S T I K F L C A R I K P N S * * P S * T R L S K L C A V F R R T A K D H A E L E F H N * V L M AluI CviJI ApoI BdaI |SfeI* TspEI BdaI ||SetI MaeIII \ \ \\\ \ TCCATTTTGAATAATATCATTTCTAAATTTGTTGAAATAAATGTCAAAAAGCTACAGAAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTAAAACTTATTATAGTAAAGATTTAAACAACTTTATTTACAGTTTTTCGATGTCTTC / / / / TspEI | | SfeI* BdaI | CviJI BdaI | AluI ApoI SetI S I L N N I I S K F V E I N V K K L Q K P F * I I S F L N L L K * M S K S Y R S H F E * Y H F * I C * N K C Q K A T E V ----:----|----:----|----:----|----:----|----:----|----:----| E M K F L I M E L N T S I F T L F S C F N W K S Y Y * K * I Q Q F L H * F A V S G N Q I I D N R F K N F Y I D F L * L L Hin4II* | SetI | | EcoNI | | | BsiYI* | | | | CviJI Eco57I | | | | | MboII Eco57MI TspEI \ \ \ \ \ \ \ \ TTACAAGAGAACCTGAAGAAGGCTAAAGAGAAAGAAGCAGAAAACGAAAAAGCAAAGGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTTCTCTTGGACTTCTTCCGATTTCTCTTTCTTCGTCTTTTGCTTTTTCGTTTCCTT / // / / / / / | || | | | MboII Eco57MI | || | | CviJI Eco57I | || | EcoNI | || BsiYI* | |Hin4II* | SetI MaeIII L Q E N L K K A K E K E A E N E K A K E Y K R T * R R L K R K K Q K T K K Q R N T R E P E E G * R E R S R K R K S K G I ----:----|----:----|----:----|----:----|----:----|----:----| N C S F R F F A L S F S A S F S F A F S T V L S G S S P * L S L L L F R F L L P * L L V Q L L S F L F F C F V F F C L F NlaIV | Hin4I | Hin4I SetI | |DdeI AccI | StyI | |SauI* SetI | SecI* | ||SetI |Hpy166II \ \ \ \\\ \\ TTACAGGGCAAAGATATTACCTTGCCCAAGGAACCTAAGGTAGACACATTATCTCATTCG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTCCCGTTTCTATAATGGAACGGGTTCCTTGGATTCCATCTGTGTAATAGAGTAAGC / / // / // // TspEI SetI || | || |AccI || | || Hpy166II || | |SauI* || | |DdeI || | SetI || NlaIV || SetI |SecI* |StyI Hin4I Hin4I L Q G K D I T L P K E P K V D T L S H S Y R A K I L P C P R N L R * T H Y L I R T G Q R Y Y L A Q G T * G R H I I S F V ----:----|----:----|----:----|----:----|----:----|----:----| N C P L S I V K G L S G L T S V N D * E I V P C L Y * R A W P V * P L C M I E N * L A F I N G Q G L F R L Y V C * R M R BetI* BspMII* |HpaII NdeI |Hpy178III* ApoI | MboI || Hin4I TspEI | | DpnI || Hin4I EcoRI | | |BstKTI MseI SetI \\ \ \ \ \ \\ \ \ TCCGGAAGTGAAAAAAGAATTCCATATGATCTCTTGGGGGTAGTTAATAACAGACCTGTT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCCTTCACTTTTTTCTTAAGGTATACTAGAGAACCCCCATCAATTATTGTCTGGACAA / // / / // / / / | |BspMII* | | || MboI MseI SetI | |BetI* | | |DpnI | Hpy178III* | | BstKTI | HpaII | NdeI Hin4I EcoRI Hin4I TspEI ApoI S G S E K R I P Y D L L G V V N N R P V P E V K K E F H M I S W G * L I T D L F R K * K K N S I * S L G G S * * Q T C F ----:----|----:----|----:----|----:----|----:----|----:----| D P L S F L I G Y S R K P T T L L L G T T R F H F F F E M H D R P P L * Y C V Q G S T F F S N W I I E Q P Y N I V S R N FatI AflIII BspLU11I* |CviAII || NspI || NlaIII || | BsmAI BsiYI* AjuI || | | SspI | SetI | MseI || | | | AjuI | | MnlI | |AhaIII* \\ \ \ \ \ \ \ \ \ \\ TTACATGTCTCCAAAATATTTGTTGCCAAACATAGGTTCTGCGTTGAGGACTTTAAATAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTACAGAGGTTTTATAAACAACGGTTTGTATCCAAGACGCAACTCCTGAAATTTATG / // / // / / / / // / | || | |SspI | SetI MnlI AjuI || BaeI | || | BsmAI BsiYI* |MseI | || AjuI AhaIII* | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI L H V S K I F V A K H R F C V E D F K Y Y M S P K Y L L P N I G S A L R T L N T T C L Q N I C C Q T * V L R * G L * I Q ----:----|----:----|----:----|----:----|----:----|----:----| K C T E L I N T A L C L N Q T S S K L Y K V H R W F I Q Q W V Y T R R Q P S * I * M D G F Y K N G F M P E A N L V K F V MboI BclI | DpnI BaeI FokI | |BaeI |MseI | ApoI | |BseGI |BciVI | TspEI | |BstKTI BsrI \\ \ \ \ \\ \ AAGTTAAGGGGATACAGATGTGCGAAATTTATTGATCATCCAACTGGTATCTATATTATT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAATTCCCCTATGTCTACACGCTTTAAATAACTAGTAGGTTGACCATAGATATAATAA / / / / / // / / | MseI | | | || BclI BsrI BciVI | | | || MboI | | | |DpnI | | | BstKTI | | | BseGI | | BaeI | TspEI | ApoI FokI K L R G Y R C A K F I D H P T G I Y I I S * G D T D V R N L L I I Q L V S I L F V K G I Q M C E I Y * S S N W Y L Y Y F ----:----|----:----|----:----|----:----|----:----|----:----| L N L P Y L H A F N I S * G V P I * I I C T L P I C I H S I * Q D D L Q Y R Y * L * P S V S T R F K N I M W S T D I N N FatI |CviAII || Hin6I || NlaIII || |GlaI || |MstI* || ||HhaI CviRI* || ||| FatI | BsmI || ||| AflIII | |HinfI || ||| BspLU11I* | || Hpy178III* || ||| |CviAII | || | ApoI || ||| || NspI | || | PleI MseI || ||| || NlaIII | || | TspEI | MmeI || ||| || | TaqI | || | |MlyI | | BsrDI || ||| || | AsuII | || | || MseI \ \ \ \\ \\\ \\ \ \ \ \\ \ \\ \ TTTAATGACATTGCCCATGCGCAAACATGTTCGAATGCAGAGTCAGGAAATTTAACAATA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTACTGTAACGGGTACGCGTTTGTACAAGCTTACGTCTCAGTCCTTTAAATTGTTAT / / / / //// / // / / / / / / / | | BsrDI | |||| | || | | | | | | MseI | MseI | |||| | || | | | | | TspEI MmeI | |||| | || | | | | | ApoI | |||| | || | | | | PleI | |||| | || | | | | MlyI | |||| | || | | | Hpy178III* | |||| | || | | HinfI | |||| | || | CviRI* | |||| | || | BsmI | |||| | || AsuII | |||| | || TaqI | |||| | |BspLU11I* | |||| | |AflIII | |||| | |FatI | |||| | CviAII | |||| NlaIII | |||| NspI | |||Hin6I | ||MstI* | ||GlaI | |FatI | |HhaI | CviAII NlaIII F N D I A H A Q T C S N A E S G N L T I L M T L P M R K H V R M Q S Q E I * Q * * * H C P C A N M F E C R V R K F N N N ----:----|----:----|----:----|----:----|----:----|----:----| K L S M A W A C V H E F A S D P F K V I K * H C Q G H A F M N S H L T L F N L L K I V N G M R L C T R I C L * S I * C Y StyI ApoI AvrII BsmAI TspEI MboII SecI* SetI Hpy188I EcoRI | TspDTI |MaeI NlaIV \ \ \ \ \\ \ ATGTCTCGGAGCAGAAGAATTCCTATTCTAATAAAGTTTCATCTCATTCTCCCTAGGTTC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGAGCCTCGTCTTCTTAAGGATAAGATTATTTCAAAGTAGAGTAAGAGGGATCCAAG / / / // /// / | BsmAI | |TspDTI ||| NlaIV Hpy188I | MboII ||SecI* EcoRI ||AvrII TspEI ||StyI ApoI |MaeI SetI M S R S R R I P I L I K F H L I L P R F C L G A E E F L F * * S F I S F S L G S V S E Q K N S Y S N K V S S H S P * V P ----:----|----:----|----:----|----:----|----:----|----:----| I D R L L L I G I R I F N * R M R G L N L T E S C F F E * E L L T E D * E G * T H R P A S S N R N * Y L K M E N E R P E MaeI MboII | AluI | CviJI | | SetI MaeI | | | BaeI Csp6I | TfiI | | | | ApoI |RsaI | HinfI | | | | TspEI || SetI \ \ \ \ \ \ \ \\ \ CAAAACAGAACTAGATTCAATAAATCTAGCTCATCTTCAAATTCTACAAATGTACCTATA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTGTCTTGATCTAAGTTATTTAGATCGAGTAGAAGTTTAAGATGTTTACATGGATAT / / / //// / // / | HinfI | |||BaeI TspEI || AjuI | TfiI | ||CviJI ApoI |Csp6I MaeI | ||AluI RsaI | |MaeI SetI | SetI MboII Q N R T R F N K S S S S S N S T N V P I K T E L D S I N L A H L Q I L Q M Y L * K Q N * I Q * I * L I F K F Y K C T Y K ----:----|----:----|----:----|----:----|----:----|----:----| W F L V L N L L D L E D E F E V F T G I G F C F * I * Y I * S M K L N * L H V * L V S S S E I F R A * R * I R C I Y R Y AjuI | HinfI AluI | |BaeI CviJI | ||MnlI BseRI | ||| TspDTI |SfeI* | ||| | PleI ||SetI SspI | ||| | |MlyI ||| AjuI | MseI \ \\\ \ \\ \\\ \ \ \ AAATACGAGTCCAAAGAGGAGTTCATTGAAGCTACAGCAAAACAAATATTAAAAGATTTG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTTATGCTCAGGTTTCTCCTCAAGTAACTTCGATGTCGTTTTGTTTATAATTTTCTAAAC / / / / / / / / / BaeI | | PleI | | SfeI* | MseI | | MlyI | CviJI SspI | TspDTI | AjuI | HinfI | AluI MnlI BseRI SetI K Y E S K E E F I E A T A K Q I L K D L N T S P K R S S L K L Q Q N K Y * K I W I R V Q R G V H * S Y S K T N I K R F G ----:----|----:----|----:----|----:----|----:----|----:----| F Y S D L S S N M S A V A F C I N F S K L I R T W L P T * Q L * L L V F I L L N F V L G F L L E N F S C C F L Y * F I Q FatI AflIII BspLU11I* MboII |CviAII |AsuI* || NspI |AvaII || NlaIII ||BmgT120I || | Ksp632I* ||| SfaNI || | |MseI ||| | Tsp4CI* \\ \ \\ \\\ \ \ GAAAAGACTTTACATGTTGATATTAAGAAGAGATTGATTGGTCCTACGGTATTTGATGCT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCTGAAATGTACAACTATAATTCTTCTCTAACTAACCAGGATGCCATAAACTACGA / // / / // / / | || Ksp632I* | || | SfaNI | || MseI | || Tsp4CI* | |BspLU11I* | |AvaII | |AflIII | |AsuI* | |FatI | BmgT120I | CviAII MboII NlaIII NspI E K T L H V D I K K R L I G P T V F D A K R L Y M L I L R R D * L V L R Y L M L K D F T C * Y * E E I D W S Y G I * C F ----:----|----:----|----:----|----:----|----:----|----:----| S F V K C T S I L F L N I P G V T N S A P F S K V H Q Y * S S I S Q D * P I Q H F L S * M N I N L L S Q N T R R Y K I S AsuI* AvaII |BmgT120I || FatI || |CviAII || || CviRI* || || NlaIII AluI || || | ApoI Hpy178III* CviJI Ksp632I* || || | TspEI | TspEI | SetI | BsmAI \\ \\ \ \ \ \ \ \ \ \ TTGGACCATGCAAATTTTCCTGAATTGTTAGCTAAAAGAGAACTAAAGGAGAAAGAGAAG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTGGTACGTTTAAAAGGACTTAACAATCGATTTTCTCTTGATTTCCTCTTTCTCTTC // // / / / / / / / || || | | | | CviJI | BsmAI || || | | | | AluI Ksp632I* || || | | | SetI || || | | TspEI || || | Hpy178III* || || TspEI || || ApoI || |CviRI* || |FatI || CviAII |NlaIII |AvaII |AsuI* BmgT120I L D H A N F P E L L A K R E L K E K E K W T M Q I F L N C * L K E N * R R K R R G P C K F S * I V S * K R T K G E R E E ----:----|----:----|----:----|----:----|----:----|----:----| K S W A F K G S N N A L L S S F S F S F K P G H L N E Q I T L * F L V L P S L S Q V M C I K R F Q * S F S F * L L F L L MboII | MaeII | | SetI | | TaiI | | | TspDTI MboII TspEI | | | Eco57I | CviRI* | SfaNI TspEI | | | Eco57MI CviJI \ \ \ \ \ \ \ \ \ \ AGACAACAGATTGCATCTAAAATTGCTGAAGATGAATTGAAACGTAAAGAAGAAGCCAAA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTTGTCTAACGTAGATTTTAACGACTTCTACTTAACTTTGCATTTCTTCTTCGGTTT / / / / // / // / / | CviRI* | SfaNI || | |Eco57MI | MboII MboII TspEI || | |Eco57I CviJI || | |TspDTI || | MaeII || TaiI || SetI |MboII TspEI R Q Q I A S K I A E D E L K R K E E A K D N R L H L K L L K M N * N V K K K P K T T D C I * N C * R * I E T * R R S Q K ----:----|----:----|----:----|----:----|----:----|----:----| L C C I A D L I A S S S N F R L S S A L S V V S Q M * F Q Q L H I S V Y L L L W S L L N C R F N S F I F Q F T F F F G F ApoI TspEI CviJI | MseI MboII TsoI | CviRI* | |AhaIII* \ \ \ \ \ \\ AGAGATTTTGATTTGTTTGGTTTATATGGTGGCTATGCAAAATCTAATAAAAGAAATTTA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTAAAACTAAACAAACCAAATATACCACCGATACGTTTTAGATTATTTTCTTTAAAT / / / /// TsoI | CviRI* ||MseI CviJI ||MmeI |AhaIII* TspEI ApoI R D F D L F G L Y G G Y A K S N K R N L E I L I C L V Y M V A M Q N L I K E I * R F * F V W F I W W L C K I * * K K F K ----:----|----:----|----:----|----:----|----:----|----:----| L S K S K N P K Y P P * A F D L L L F K F L N Q N T Q N I H H S H L I * Y F F N S I K I Q K T * I T A I C F R I F S I * FnuDII* | MboI | | DpnI | | |BstKTI | | || BinI* | | || | MnlI AluI | | || | | MseI CviJI MmeI TspEI | | || | | |AhaIII* | SetI \ \ \ \ \\ \ \ \\ \ \ AAAAGGCATAATTCACTCGCGTTGGATCATACTTCTTTAAAGAGGAAAAAGCTATCCAAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCCGTATTAAGTGAGCGCAACCTAGTATGAAGAAATTTCTCCTTTTTCGATAGGTTA / / // / // // / / TspEI | || MboI || |MseI | CviJI | |DpnI || AhaIII* | AluI | BstKTI |MnlI SetI FnuDII* BinI* K R H N S L A L D H T S L K R K K L S N K G I I H S R W I I L L * R G K S Y P M K A * F T R V G S Y F F K E E K A I Q W ----:----|----:----|----:----|----:----|----:----|----:----| F L C L E S A N S * V E K F L F F S D L L F A Y N V R T P D Y K K L S S F A I W F P M I * E R Q I M S R * L P F L * G I TfiI HinfI | MboII \ \ GGTATCAAACCAATGGCACATTTACTGAACGAAGAAACCGATTCCAAAGAAACTACCCCA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAGTTTGGTTACCGTGTAAATGACTTGCTTCTTTGGCTAAGGTTTCTTTGATGGGGT // |HinfI |TfiI MboII G I K P M A H L L N E E T D S K E T T P V S N Q W H I Y * T K K P I P K K L P H Y Q T N G T F T E R R N R F Q R N Y P I ----:----|----:----|----:----|----:----|----:----|----:----| P I L G I A C K S F S S V S E L S V V G H Y * V L P V N V S R L F R N W L F * G T D F W H C M * Q V F F G I G F F S G W MboI | DpnI BbvII* | |BstKTI FatI | MboII | || BinI* |CviAII | |MboII Hin4II* | || |TspDTI || NlaIII | |TspDTI | BaeI | || |FnuDII* || |BaeI | || MboII \ \ \ \\ \\ \\ \\ \ \\ \ TTGAACGATGAAGGGATCACTCGCGTATCAAAAGAACATGATGAAGAAGACGAAAATATG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTGCTACTTCCCTAGTGAGCGCATAGTTTTCTTGTACTACTTCTTCTGCTTTTATAC / // / / / / // // / Hin4II* || | | FnuDII* | |FatI || BbvII* BaeI || | | BinI* | CviAII || MboII || | TspDTI NlaIII |MboII || MboI BaeI TspDTI |DpnI MboII BstKTI L N D E G I T R V S K E H D E E D E N M * T M K G S L A Y Q K N M M K K T K I * E R * R D H S R I K R T * * R R R K Y D ----:----|----:----|----:----|----:----|----:----|----:----| N F S S P I V R T D F S C S S S S S F I M S R H L S * E R I L L V H H L L R F Y Q V I F P D S A Y * F F M I F F V F I H MboII | MboII | | AluI | | CviJI | | |Eco57I | | |Eco57MI | | ||SetI | | |||MboII | | |||Hpy178III* | | |||| ApoI Ksp632I* | | |||| TspEI |MnlI | | |||| | Hpy178III* |Hpy188I | | |||| | | BseMII || GsuI | | |||| | | |BspCNI MboII || Eco57MI | | |||| MboII | | || HinfI \ \\ \ \ \ \\\\ \ \ \ \\ \ ACATCTTCATCTTCTGAAGAAGAGGAAGAAGAAGCTCCAGATAAGAAATTCAAGAGTGAG 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TGTAGAAGTAGAAGACTTCTTCTCCTTCTTCTTCGAGGTCTATTCTTTAAGTTCTCACTC / / // / / /// / / //// MboII | |Eco57MI | | ||| | Hpy178III* |||Hpy178III* | |GsuI | | ||| | MboII ||BspCNI | Ksp632I* | | ||| MboII |BseMII Hpy188I | | ||CviJI TspEI MnlI | | ||AluI ApoI | | |Eco57MI | | |Eco57I | | SetI | MboII MboII T S S S S E E E E E E A P D K K F K S E H L H L L K K R K K K L Q I R N S R V S I F I F * R R G R R S S R * E I Q E * V ----:----|----:----|----:----|----:----|----:----|----:----| V D E D E S S S S S S A G S L F N L L S S M K M K Q L L P L L L E L Y S I * S H C R * R R F F L F F F S W I L F E L T L HphI TfiI HinfI | TspDTI | | MboI | | BclI | | Hpy188I | | | DpnI | | | |BstKTI | | | || BceAI | | | || | SetI | | | || | MslI | | | || | |FatI | | | || | ||CviAII | | | || | ||| NlaIII DdeI | | | || | ||| | Hin4II* Csp6I |Hpy188I | | | || | ||| | |MseI |RsaI || PleI | | | || | ||| | || CviJI || MboI || CviJI BdaI | | | || | ||| | || | BdaI || | DpnI || |MlyI BdaI | | | || | ||| | || | BdaI || | |BstKTI \\ \\ \ \ \ \ \\ \ \\\ \ \\ \ \ \\ \ \\ TCTGAGCCAACCACCCCCGAATCTGATCACCTTCATGGTATTAAGCCGTTAGTACCCGAT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTCGGTTGGTGGGGGCTTAGACTAGTGGAAGTACCATAATTCGGCAATCATGGGCTA // /// / / / // // / // // / / / // // || ||| BdaI | | || || | || || | | CviJI || |DpnI || ||| BdaI | | || || | || || | | BdaI || BstKTI || ||PleI | | || || | || || | | BdaI |Csp6I || ||MlyI | | || || | || || | MseI RsaI || |CviJI | | || || | || || Hin4II* || DdeI | | || || | || |FatI |Hpy188I | | || || | || CviAII HinfI | | || || | |NlaIII | | || || | BceAI | | || || | MslI | | || || BclI | | || || MboI | | || || SetI | | || |DpnI | | || BstKTI | | |Hpy188I | | HinfI | | TfiI | TspDTI HphI S E P T T P E S D H L H G I K P L V P D L S Q P P P N L I T F M V L S R * Y P I * A N H P R I * S P S W Y * A V S T R S ----:----|----:----|----:----|----:----|----:----|----:----| D S G V V G S D S * R * P I L G N T G S T Q A L W G R I Q D G E H Y * A T L V R R L W G G G F R I V K M T N L R * Y G I SfaNI Hpy188I | MaeII | | Csp6I | | |RsaI | | |SetI | | |TaiI | | || MboII | | || | BsrI | | || | | BseGI | | || | | | TaqI ApoI | | || | | | | FokI SetI TspEI \ \ \\ \ \ \ \ \ \ \ CAAAATGGGTCGTCTGACGTACTGGATGCTTCTTCGATGTATAAACCTACTGCTACCGAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTACCCAGCAGACTGCATGACCTACGAAGAAGCTACATATTTGGATGACGATGGCTT / / / //// / / / / / MboI | | |||| | BseGI TaqI | SetI | | |||| BsrI FokI | | |||MboII | | ||Csp6I | | |RsaI | | MaeII | | SfaNI | TaiI | SetI Hpy188I Q N G S S D V L D A S S M Y K P T A T E K M G R L T Y W M L L R C I N L L L P K K W V V * R T G C F F D V * T Y C Y R N ----:----|----:----|----:----|----:----|----:----|----:----| * F P D D S T S S A E E I Y L G V A V S D F H T T Q R V P H K K S T Y V * Q * R L I P R R V Y Q I S R R H I F R S S G F Hpy178III* | SetI | | BseMII DdeI | | |BspCNI SauI* MboII | | || MnlI |SetI Hpy188I \ \ \\ \ \\ \ ATTCCCGAACCTGTATATCCACCTGAGGAATATGACTTGAAATATAGTCAGACTTTATCT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGGCTTGGACATATAGGTGGACTCCTTATACTGAACTTTATATCAGTCTGAAATAGA / / / // / / / / | | | || | SetI SauI* Hpy188I | | | || MnlI DdeI MboII | | | |BspCNI | | | BseMII | | SetI | Hpy178III* TspEI ApoI I P E P V Y P P E E Y D L K Y S Q T L S F P N L Y I H L R N M T * N I V R L Y L S R T C I S T * G I * L E I * S D F I F ----:----|----:----|----:----|----:----|----:----|----:----| I G S G T Y G G S S Y S K F Y L * V K D F E R V Q I D V Q P I H S S I Y D S K I N G F R Y I W R L F I V Q F I T L S * R TspEI | MboII | | MseI | | |AhaIII* BsmI | | || TstI CviRI* | MnlI | | || BsaXI \ \ \ \ \ \\ \ TCTATGGATTTGCAGAATGCTATCAAAGATGAGGAAGATATGCTAATTTTAAAGCAGTTA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| AGATACCTAAACGTCTTACGATAGTTTCTACTCCTTCTATACGATTAAAATTTCGTCAAT / / / / / /// / CviRI* | MnlI | | ||| BsaXI BsmI | | ||TstI | | |MseI | | AhaIII* | TspEI MboII S M D L Q N A I K D E E D M L I L K Q L L W I C R M L S K M R K I C * F * S S Y Y G F A E C Y Q R * G R Y A N F K A V I ----:----|----:----|----:----|----:----|----:----|----:----| E I S K C F A I L S S S S I S I K F C N K * P N A S H * * L H P L Y A L K L A T R H I Q L I S D F I L F I H * N * L L * Hin6I |GlaI ||TseI ||HhaI |||BisI ||||BlsI |||||AluI |||||CviJI MaeIII |||||| SetI Tsp45I |||||| |Hpy178III* Tsp4CI* |||||| || BbvI SduI | BsaXI |||||| || | ApoI HgiAI* | | TstI |||||| || | TspEI \ \ \ \ \\\\\\ \\ \ \ TTGAGCACATATACTCCTACCGTCACACCAGAAACAAGCGCAGCTCTGGAATATAAAATT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCGTGTATATGAGGATGGCAGTGTGGTCTTTGTTCGCGTCGAGACCTTATATTTTAA / / / / ////// / / / HgiAI* | | Tsp45I |||||| | | TspEI SduI | | MaeIII |||||| | | ApoI | BsaXI |||||| | BbvI | TstI |||||| Hpy178III* Tsp4CI* |||||CviJI |||||TseI |||||AluI ||||BisI |||BlsI |||SetI ||Hin6I |GlaI HhaI L S T Y T P T V T P E T S A A L E Y K I * A H I L L P S H Q K Q A Q L W N I K F E H I Y S Y R H T R N K R S S G I * N L ----:----|----:----|----:----|----:----|----:----|----:----| N L V Y V G V T V G S V L A A R S Y L I I S C M Y E * R * V L F L R L E P I Y F Q A C I S R G D C W F C A C S Q F I F N MwoI CviJI | AluI Hpy178III* MboII | CviJI |Ksp632I* | MboII | | MseI || Hin4II* | | Hpy188I | | SetI \\ \ \ \ \ \ \ \ TGGCAATCTCGCCGAAAAGTTCTTGAAGAAGAGAAGGCTTCCGATTGGCAAATAGAGCTT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| ACCGTTAGAGCGGCTTTTCAAGAACTTCTTCTCTTCCGAAGGCTAACCGTTTATCTCGAA / / // / / / / / | Ksp632I* || | Hpy188I | | CviJI | Hin4II* || MboII | | AluI Hpy178III* |CviJI | SetI MboII MwoI W Q S R R K V L E E E K A S D W Q I E L G N L A E K F L K K R R L P I G K * S L A I S P K S S * R R E G F R L A N R A * ----:----|----:----|----:----|----:----|----:----|----:----| Q C D R R F T R S S S F A E S Q C I S S K A I E G F L E Q L L S P K R N A F L A P L R A S F N K F F L L S G I P L Y L K Hpy166II | BssKI | SexAI | EcoRII | | ScrFI | | BseBI | | | SetI | | | | AluI | | | | CviJI | | | | | SetI | | | | | | MseI | | | | | | |AhaIII* | | | | | | ||Hin4II* | | | | | | ||| AluI | | | | | | ||| CviJI | | | | | | ||| | SetI Hpy178III* \ \ \ \ \ \ \\\ \ \ \ AATGGAACTTTATTTGATAGTGAACTACAACCAGGTAGCTCTTTTAAAGCTGAAGGGTTC 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCTTGAAATAAACTATCACTTGATGTTGGTCCATCGAGAAAATTTCGACTTCCCAAG / / // // / /// / MseI Hpy166II || || CviJI ||| CviJI || || AluI ||| AluI || |SetI ||SetI || EcoRII |MseI || SexAI AhaIII* || BssKI Hin4II* |BseBI |ScrFI SetI N G T L F D S E L Q P G S S F K A E G F M E L Y L I V N Y N Q V A L L K L K G S W N F I * * * T T T R * L F * S * R V Q ----:----|----:----|----:----|----:----|----:----|----:----| L P V K N S L S S C G P L E K L A S P N * H F K I Q Y H V V V L Y S K * L Q L T I S S * K I T F * L W T A R K F S F P E TspEI | AciI | |Eco57I | |Eco57MI | || TspEI | || | MseI | || | | TspEI | || | | | MseI HphI | || | | | VspI |BccI | || | | | |TspEI SetI |Hpy99I Hpy166II \ \\ \ \ \ \\ \ \\ \ AGGAAAATTGCGGATAAATTAAAAATTAATTACCTACCCCATCGTCGCAGAGTTCACCAA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTTTAACGCCTATTTAATTTTTAATTAATGGATGGGGTAGCAGCGTCTCAAGTGGTT / / / // // / / / / / / | | AciI |MseI || TspEI | | BccI | SetI | Eco57MI TspEI || SetI | HphI Hpy166II | Eco57I |VspI Hpy99I | TspEI |MseI Hpy178III* TspEI R K I A D K L K I N Y L P H R R R V H Q G K L R I N * K L I T Y P I V A E F T N E N C G * I K N * L P T P S S Q S S P T ----:----|----:----|----:----|----:----|----:----|----:----| L F I A S L N F I L * R G W R R L T * W * S F Q P Y I L F * N G V G D D C L E G P F N R I F * F N I V * G M T A S N V L BdaI BdaI |TatI SetI ||Csp6I |MseI |||RsaI ||AhaIII* ||||TspDTI ||| Tsp4CI* ||||Hpy166II ||| | SspI HphI ||||| SetI \\\ \ \ \ \\\\\ \ CCTTTAAATACGGTGAATATTCACAATGAAAGGAATGAGTACACACCTGAACTTTGTCAA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAATTTATGCCACTTATAAGTGTTACTTTCCTTACTCATGTGTGGACTTGAAACAGTT // / / / / //// / |MseI | SspI HphI | |||| SetI | Tsp4CI* | |||TatI AhaIII* | ||Hpy166II | ||Csp6I | |RsaI | TspDTI BdaI BdaI P L N T V N I H N E R N E Y T P E L C Q L * I R * I F T M K G M S T H L N F V K F K Y G E Y S Q * K E * V H T * T L S K ----:----|----:----|----:----|----:----|----:----|----:----| G K F V T F I * L S L F S Y V G S S Q * V K L Y P S Y E C H F S H T C V Q V K D R * I R H I N V I F P I L V C R F K T L TfiI HinfI | BdaI | BdaI | Eco57I | Eco57MI | | TaqI | | | MboII | | | | MnlI | | | | | MlyI | | | | | PleI | | | | | |Bce83I* | | | | | ||SetI | | | | | ||| Hpy188I | | | | | ||| |HinfI | | | | | ||| || DdeI | | | | | ||| || | Hin4II* | | | | | ||| || | | FokI | | | | | ||| || | | | SmlI | | | | | ||| || | | | TspDTI | | | | | ||| || | | | | Hpy178III* | | | | | ||| || | | | | | BspCNI | | | | | ||| || | | | | | |BseMII XbaI | | | | | ||| || | | | | | || MnlI |MaeI | | | | | ||| || | | | | | || | BseGI |Hpy178III* \ \ \ \ \ \\\ \\ \ \ \ \ \ \\ \ \ \\ AGAGAAGAATCCTCGAATAAAGAACCTTCAGACTCAGTTCCTCAAGAAGTTTCATCCTCT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTTCTTAGGAGCTTATTTCTTGGAAGTCTGAGTCAAGGAGTTCTTCAAAGTAGGAGA // / / //// / / / / /// // || | | |||| | | | | ||| |BseGI || | | |||| | | | | ||| MnlI || | | |||| | | | | ||Hpy178III* || | | |||| | | | | ||BseMII || | | |||| | | | | ||SmlI || | | |||| | | | | |BspCNI || | | |||| | | | | FokI || | | |||| | | | TspDTI || | | |||| | | DdeI || | | |||| | Hin4II* || | | |||| | HinfI || | | |||| Hpy188I || | | |||PleI || | | ||MlyI || | | |Bce83I* || | | SetI || | MnlI || MboII || TaqI |HinfI |TfiI Eco57MI Eco57I BdaI BdaI R E E S S N K E P S D S V P Q E V S S S E K N P R I K N L Q T Q F L K K F H P L R R I L E * R T F R L S S S R S F I L * ----:----|----:----|----:----|----:----|----:----|----:----| L S S D E F L S G E S E T G * S T E D E F L L I R S Y L V K L S L E E L L K M R S F F G R I F F R * V * N R L F N * G R MwoI | CviJI | |AciI | |BisI | ||BlsI | |||TauI MboII | ||||MfeI MnlI SfaNI |MnlI | ||||TspEI \ \ \\ \ \\\\\ AGAGATAATAGGGCATCAAATAGAAGATTTCAGCAGGACATAGAGGCACAGAAAGCCGCA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTATTATCCCGTAGTTTATCTTCTAAAGTCGTCCTGTATCTCCGTGTCTTTCGGCGT // / / // / //// || MnlI SfaNI |MnlI MwoI |||AciI |XbaI MboII ||BisI Hpy178III* |BlsI MaeI CviJI TauI R D N R A S N R R F Q Q D I E A Q K A A E I I G H Q I E D F S R T * R H R K P Q R * * G I K * K I S A G H R G T E S R N ----:----|----:----|----:----|----:----|----:----|----:----| L S L L A D F L L N * C S M S A C F A A * L Y Y P M L Y F I E A P C L P V S L R S I I P C * I S S K L L V Y L C L F G C EcoP15I | BbvI | Csp6I | BseMII | |RsaI | |BspCNI | ||Hin4I | ||| TfiI | ||| HinfI | ||| | DdeI | ||| | |Hpy188I | ||| | || TseI | ||| | || AluI | ||| | || CviJI | ||| | || |BisI | ||| | || ||BlsI TspEI | ||| | || ||SetI | MseI CviJI | ||| | || ||| TspGWI | | Hin4I |BsrI \ \\\ \ \\ \\\ \ \ \ \ \\ ATTGGTACGGAATCTGAGCTGCTATCACTAAATCAATTAAATAAAAGAAAAAAGCCAGTT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TAACCATGCCTTAGACTCGACGATAGTGATTTAGTTAATTTATTTTCTTTTTTCGGTCAA /// // / // ////// / // // ||| || | || |||||TseI | |MseI |CviJI ||| || | || ||||TspGWI | TspEI BsrI ||| || | || ||||BisI Hin4I ||| || | || |||BlsI ||| || | || ||CviJI ||| || | || ||AluI ||| || | || |DdeI ||| || | || SetI ||| || | |Hpy188I ||| || | HinfI ||| || | TfiI ||| || BbvI ||| |Csp6I ||| RsaI ||BspCNI |EcoP15I |BseMII |TspEI |MfeI Hin4I I G T E S E L L S L N Q L N K R K K P V L V R N L S C Y H * I N * I K E K S Q L W Y G I * A A I T K S I K * K K K A S Y ----:----|----:----|----:----|----:----|----:----|----:----| I P V S D S S S D S F * N F L L F F G T L Q Y P I Q A A I V L D I L Y F F F A L N T R F R L Q * * * I L * I F S F L W N BfiI | MlyI | PleI | | XbaI | | |MaeI TseI MwoI | | |Hpy178III* |BisI | TspEI BsrI | | || HinfI ||BlsI \ \ \ \ \ \\ \ \\\ ATGTTCGCTCGTTCAGCAATTCACAACTGGGGTTTATATGCTCTAGACTCTATCGCAGCA 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAGCGAGCAAGTCGTTAAGTGTTGACCCCAAATATACGAGATCTGAGATAGCGTCGT / / / / // // / /// MwoI TspEI BsrI BfiI || || HinfI ||TseI || |XbaI |BisI || Hpy178III* BlsI || MaeI |PleI MlyI M F A R S A I H N W G L Y A L D S I A A C S L V Q Q F T T G V Y M L * T L S Q Q V R S F S N S Q L G F I C S R L Y R S K ----:----|----:----|----:----|----:----|----:----|----:----| I N A R E A I * L Q P K Y A R S E I A A * T R E N L L E C S P N I H E L S * R L H E S T * C N V V P T * I S * V R D C C MboI TaqI | DpnI | Csp6I | |BstKTI | |RsaI | || HphI | ||MaeII | || | BinI* | ||| SetI | || | | SfeI* BbvI | ||| TaiI | || | | |SetI \ \ \\\ \ \ \\ \ \ \\ AAGGAAATGATTATCGAGTACGTTGGTGAAAGGATCAGGCAACCTGTAGCAGAAATGAGA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTTTACTAATAGCTCATGCAACCACTTTCCTAGTCCGTTGGACATCGTCTTTACTCT / / // / // / / / BbvI | || MaeII || HphI BinI* SfeI* | |Csp6I || MboI SetI | RsaI |DpnI | TaiI BstKTI | SetI TaqI K E M I I E Y V G E R I R Q P V A E M R R K * L S S T L V K G S G N L * Q K * E G N D Y R V R W * K D Q A T C S R N E R ----:----|----:----|----:----|----:----|----:----|----:----| F S I I I S Y T P S L I L C G T A S I L L P F S * R T R Q H F S * A V Q L L F S L F H N D L V N T F P D P L R Y C F H S BinI* | MboI | BamHI | XhoII | | DpnI | | NlaIV | | |BstKTI | | ||BsrI | | ||| MaeIII | | ||| | BinI* EcoRV | | ||| | | SetI | Hpy188I | | ||| | | | BsiYI* SfaNI \ \ \ \ \\\ \ \ \ \ \ GAGAAAAGATATCTGAAAAATGGGATTGGATCCAGTTACCTTTTTAGGGTTGATGAAAAC 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTTTCTATAGACTTTTTACCCTAACCTAGGTCAATGGAAAAATCCCAACTACTTTTG / / / // / / / / | Hpy188I | || | | | BsiYI* EcoRV | || | | MaeIII | || | BinI* | || | SetI | || XhoII | || BamHI | || MboI | |NlaIV | |DpnI | |BsrI | BstKTI BinI* E K R Y L K N G I G S S Y L F R V D E N R K D I * K M G L D P V T F L G L M K T E K I S E K W D W I Q L P F * G * * K H ----:----|----:----|----:----|----:----|----:----|----:----| S F L Y R F F P I P D L * R K L T S S F L S F I D S F H S Q I W N G K * P Q H F L F S I Q F I P N S G T V K K P N I F V BinI* |MslI Tsp4CI* SetI CspCI || MboI | CspCI | TspDTI | MseI || | DpnI | | TspDTI | | CviJI | VspI || | |BstKTI \ \ \ \ \ \ \ \ \\ \ \\ ACGGTTATTGATGCCACCAAGAAAGGTGGTATAGCCCGTTTCATTAATCATTGTTGTGAT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| TGCCAATAACTACGGTGGTTCTTTCCACCATATCGGGCAAAGTAATTAGTAACAACACTA / / / / / / / / / // | | TspDTI SetI | | CspCI VspI | |DpnI | SfaNI | CviJI MseI | BstKTI | CspCI TspDTI BinI* Tsp4CI* MslI T V I D A T K K G G I A R F I N H C C D R L L M P P R K V V * P V S L I I V V I G Y * C H Q E R W Y S P F H * S L L * S ----:----|----:----|----:----|----:----|----:----|----:----| V T I S A V L F P P I A R K M L * Q Q S C P * Q H W W S L H Y L G N * * D N N H R N N I G G L F T T Y G T E N I M T T I PsiI | FauI | |BceAI TspEI | || SetI | Csp6I | || | AciI BtsI | |RsaI | || | Hin4II* TspEI CviRI* \ \\ \ \\ \ \ \ \ CCAAATTGTACGGCAAAGATTATAAAGGTTGGCGGGAGAAGGAGAATTGTTATCTATGCA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTAACATGCCGTTTCTAATATTTCCAACCGCCCTCTTCCTCTTAACAATAGATACGT / / // / / // / / / / / MboI | |Csp6I | | || | AciI TspEI | CviRI* | RsaI | | || Hin4II* TspRI TspEI | | |BceAI BtsI | | FauI | SetI PsiI P N C T A K I I K V G G R R R I V I Y A Q I V R Q R L * R L A G E G E L L S M H K L Y G K D Y K G W R E K E N C Y L C T ----:----|----:----|----:----|----:----|----:----|----:----| G F Q V A F I I F T P P L L L I T I * A D L N Y P L S * L P Q R S F S F Q * R H W I T R C L N Y L N A P S P S N N D I C DraIII |TspRI || EcoRV || | AciI || | FnuDII* || | |BisI || | ||BlsI HindII || | |||TauI Hpy166II || | ||||Ksp632I* | NdeI ApoI || | |||||Cac8I | |MboII TspEI MnlI \\ \ \\\\\\ \ \\ \ \ CTGCGTGATATCGCGGCAAGCGAAGAGTTGACATATGATTACAAATTTGAGAGAGAAAAG 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| GACGCACTATAGCGCCGTTCGCTTCTCAACTGTATACTAATGTTTAAACTCTCTCTTTTC / / /// / / / / / / // DraIII | ||| | Ksp632I* | | NdeI TspEI |MnlI | ||| Cac8I | MboII ApoI FalI | ||BisI Hpy166II FalI | ||AciI HindII | |BlsI | FnuDII* | TauI EcoRV L R D I A A S E E L T Y D Y K F E R E K C V I S R Q A K S * H M I T N L R E K R A * Y R G K R R V D I * L Q I * E R K G ----:----|----:----|----:----|----:----|----:----|----:----| S R S I A A L S S N V Y S * L N S L S F V A H Y R P L R L T S M H N C I Q S L F Q T I D R C A F L Q C I I V F K L S F L FalI FalI |SduI FalI |HgiAI* FalI FokI || SetI SetI | BseGI |XmnI || TspEI | Hpy178III* \ \ \\ \\ \ \ \ GATGACGAGGAAAGACTTCCTTGTTTATGTGGAGCACCTAATTGTAAAGGTTTCTTGAAC 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGCTCCTTTCTGAAGGAACAAATACACCTCGTGGATTAACATTTCCAAAGAACTTG / / / / / / / / / BseGI | FokI | | SetI | SetI Hpy178III* XmnI | HgiAI* TspEI | SduI FalI FalI D D E E R L P C L C G A P N C K G F L N M T R K D F L V Y V E H L I V K V S * T * R G K T S L F M W S T * L * R F L E L ----:----|----:----|----:----|----:----|----:----|----:----| S S S S L S G Q K H P A G L Q L P K K F P H R P F V E K N I H L V * N Y L N R S I V L F S K R T * T S C R I T F T E Q V TGA --- ACT * X X --- Q S S # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 6 BspACI,SsiI AflIII 4 AhaIII* 8 DraI AjuI 2 AluI 11 AluBI AlwNI 1 CaiI ApoI 14 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BaeI 3 BamHI 1 BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 1 BpuEI BceAI 4 BciVI 1 BfuI BclI 2 FbaI,Ksp22I BdaI 6 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglI 1 BinI* 9 AlwI,BspPI,AclWI BisI 8 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 8 BmgT120I 4 BplI 2 BsaAI 2 BstBAI,Ppu21I BsaXI 2 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 4 BseRI 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BsmAI 4 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI BspCNI 4 BspHI 1 CciI,PagI,RcaI BspLU11I* 3 PscI,PciI BspMII* 2 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 2 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 13 BstXI 1 BtsI 1 Cac8I 1 BstC8I CfrI 1 AcoI,EaeI Csp6I 11 CviQI,RsaNI CspCI 1 CviAII 12 CviJI 28 CviKI-1 CviRI* 11 HpyCH4V DdeI 7 BstDEI,HpyF3I DpnI 13 MalI DraII 1 EcoO109I DraIII 1 AdeI Eco47III 1 Aor51HI,AfeI Eco57I 6 AcuI Eco57MI 7 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRI 2 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 2 Eco32I FalI 4 FatI 12 FauI 1 SmuI FnuDII* 6 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 4 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiAI* 3 Bbv12I,BsiHKAI,Alw21I HhaI 4 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 10 HpyAV Hin6I 4 HinP1I,HspAI HindII 2 HincII HinfI 13 HpaII 2 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 7 Hpy8I Hpy178III* 15 Hpy188III Hpy188I 15 Hpy99I 4 Ksp632I* 7 Eam1104I,EarI,Bst6I MaeI 7 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 5 MboI 13 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 30 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MluI 1 MlyI 5 SchI MmeI 4 MnlI 15 MseI 23 Tru1I,Tru9I MslI 3 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 7 HpyF10VI,BstMWI NdeI 3 FauNDI NlaIII 12 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspI 5 BstNSI,XceI PleI 5 PpsI PsiI 3 AanI PvuI 1 MvrI,Ple19I,BpvUI RsaI 11 AfaI SalI 1 SapI 1 LguI,PciSI,BspQI SauI* 3 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 45 SexAI 1 MabI SfaNI 8 LweI SfeI* 5 BstSFI,SfcI,BfmI SgrDI 1 SmlI 1 SmoI SnaBI 1 Eco105I,BstSNI SspI 5 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 7 TaqI 7 TatI 2 TauI 3 TfiI 8 PfeI TseI 5 ApeKI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 14 TspEI 34 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI TstI 1 VspI 3 PshBI,AseI XbaI 2 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AgeI AlfI AloI ApaI ApaLI AscI Asp718I AvaI BalI BarI BbvCI BcgI BglII BmeT110I BmtI Bpu10I BsaBI BsePI BseSI BseYI BsgI BsiI* BslFI BsmFI Bsp120I Bsp1407I BspMI BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtrI CauII* Cfr10I Cfr9I ClaI DinI DrdI DsaI* Eam1105I EciI Ecl136II Eco31I EcoICRI EcoT22I EgeI EheI Esp3I EspI* FaqI FseI FspAI GsaI HgiCI* HgiJII* HindIII HpaI KasI KpnI MauBI Mph1103I MroNI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuII RsrII SacI SacII SanDI SfiI SfoI SgfI SgrAI SmaI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TspMI Tth111I XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769