Restriction Map of SFB3/YHR098C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SFB3/YHR098C on chromosome VIII from coordinates 301934 to 299145.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.9585

EMBOSS_001 SspI | BspCNI | |BseMII BbvI | || TseI | Hin6I | || |BisI | EcoP15I | || ||BlsI | |GlaI | || |||AluI | |Eco47III | || |||CviJI | || Hpy178III* DdeI | || ||||MaeI | ||HhaI | TfiI | BsmAI | || |||||SetI | |||HaeII | HinfI Tsp4CI* \ \ \ \\ \\\\\\ \ \\\\ \ \ \ ATGTCTCAGCAGAATATTTTGGCAGCTAGTGTTTCAGCGCTCTCTCTTGATGAATCTACT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGAGTCGTCTTATAAAACCGTCGATCACAAAGTCGCGAGAGAGAACTACTTAGATGA / / /// /// / //// / / / | | ||| ||| MaeI |||EcoP15I | | Tsp4CI* | | ||| ||CviJI |||Hin6I | HinfI | | ||| ||TseI ||Eco47III | TfiI | | ||| ||AluI ||BbvI Hpy178III* | | ||| |BisI ||GlaI | | ||| BlsI |HhaI | | ||| SetI HaeII | | ||BseMII | | |BspCNI | | SspI | BsmAI DdeI M S Q Q N I L A A S V S A L S L D E S T C L S R I F W Q L V F Q R S L L M N L L V S A E Y F G S * C F S A L S * * I Y C ----:----|----:----|----:----|----:----|----:----|----:----| X D * C F I K A A L T E A S E R S S D V X T E A S Y K P L * H K L A R E Q H I * H R L L I N Q C S T N * R E R K I F R S CviRI* SetI | TspDTI BbvII* | | AciI SfaNI | MboII | | MboII |EciI | | MnlI \ \ \ \\ \ \ \ GTGCATACGGGCGGAGCATCTTCCAAAAAAAGTAGAAGACCTCACAGAGCATATCATAAC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CACGTATGCCCGCCTCGTAGAAGGTTTTTTTCATCTTCTGGAGTGTCTCGTATAGTATTG / / / / / / / / TspDTI | AciI EciI SfaNI SetI | MnlI CviRI* MboII BbvII* MboII V H T G G A S S K K S R R P H R A Y H N C I R A E H L P K K V E D L T E H I I T A Y G R S I F Q K K * K T S Q S I S * L ----:----|----:----|----:----|----:----|----:----|----:----| T C V P P A D E L F L L L G * L A Y * L Q A Y P R L M K W F F Y F V E C L M D Y H M R A S C R G F F T S S R V S C I M V SecI* |AvaI ||BmeT110I ||| SduI ||| BseSI MfeI ||| | MnlI BsiYI* TspEI ||| | Tsp4CI* |HphI | TfiI ||| | | TspRI || TspEI | HinfI \\\ \ \ \ \\ \ \ \ TTTTCCTCGGGCACTGTTCCTACTTTGGGCAATTCACCCTACACTACACCCCAATTGAAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAGGAGCCCGTGACAAGGATGAAACCCGTTAAGTGGGATGTGATGTGGGGTTAACTTA // / / / / / / || Tsp4CI* | HphI TspEI | HinfI || MnlI BsiYI* | TfiI |AvaI TspEI BmeT110I MfeI SecI* BseSI TspRI SduI F S S G T V P T L G N S P Y T T P Q L N F P R A L F L L W A I H P T L H P N * I F L G H C S Y F G Q F T L H Y T P I E S ----:----|----:----|----:----|----:----|----:----|----:----| K E E P V T G V K P L E G * V V G W N F S K R P C Q E * K P C N V R C * V G I S K G R A S N R S Q A I * G V S C G L Q I FokI | SmlI | |SetI | || CviJI | || | EcoP15I | || | | DdeI Bce83I* | || | | Bpu10I BccI | BseGI | || | |MnlI | TspEI CviJI \ \ \ \ \\ \ \\ \ \ \ CAGCAGGATGGTTTTCAACAACCTCAAGCCTTTACCCCTAAGCAATTTGGTGGCTTCAAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGTCCTACCAAAAGTTGTTGGAGTTCGGAAATGGGGATTCGTTAAACCACCGAAGTTG / / / / / // / / / / / | | BseGI | | || | EcoP15I | TspEI CviJI | Bce83I* | | || MnlI Bpu10I BccI | | |CviJI DdeI | | SmlI | FokI SetI Q Q D G F Q Q P Q A F T P K Q F G G F N S R M V F N N L K P L P L S N L V A S T A G W F S T T S S L Y P * A I W W L Q Q ----:----|----:----|----:----|----:----|----:----|----:----| * C S P K * C G * A K V G L C N P P K L D A P H N E V V E L R * G * A I Q H S * L L I T K L L R L G K G R L L K T A E V HinfI | Hpy178III* | | PleI | | |MlyI | | |HphI | | || TfiI | | || HinfI | | || | BplI | | || | BplI TspGWI Hpy166II | | || | | MnlI |Tsp4CI* NlaIV | XcmI | | || | | | BseRI \\ \ \ \ \ \ \\ \ \ \ \ AACGGTTCGGGTTCCGTTATGTCCACGCCTGTAATGGTGAGTCAAGAGCGATTCGGTGCG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCCAAGCCCAAGGCAATACAGGTGCGGACATTACCACTCAGTTCTCGCTAAGCCACGC / / / / / / / // / / / / | Tsp4CI* NlaIV | XcmI | | || | | | BseRI TspGWI Hpy166II | | || | | MnlI | | || | HinfI | | || | TfiI | | || BplI | | || BplI | | |PleI | | |MlyI | | HphI | Hpy178III* HinfI N G S G S V M S T P V M V S Q E R F G A T V R V P L C P R L * W * V K S D S V R R F G F R Y V H A C N G E S R A I R C E ----:----|----:----|----:----|----:----|----:----|----:----| L P E P E T I D V G T I T L * S R N P A C R N P N R * T W A Q L P S D L A I R H V T R T G N H G R R Y H H T L L S E T R MwoI Hin6I | StuI NdeI |GlaI | CviJI MnlI BplI ||HhaI SetI | HaeIII | MnlI BplI Hin4I |||HaeII | MnlI \ \ \ \ \ \ \\\\ \ \ AGTGAGGCCTCCTCGCCATATGGTCAATCTATGCTTGATATGACAGCGCCTCAACCTACA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTCCGGAGGAGCGGTATACCAGTTAGATACGAACTATACTGTCGCGGAGTTGGATGT / / / / / / //// / / / MwoI HaeIII | | BplI Hin4I |||| SetI | Hin4I CviJI | | BplI |||Hin6I MnlI StuI | MnlI ||GlaI | NdeI |HhaI MnlI HaeII S E A S S P Y G Q S M L D M T A P Q P T V R P P R H M V N L C L I * Q R L N L H * G L L A I W S I Y A * Y D S A S T Y I ----:----|----:----|----:----|----:----|----:----|----:----| L S A E E G Y P * D I S S I V A G * G V S H P R R A M H D I * A Q Y S L A E V * T L G G R W I T L R H K I H C R R L R C MboI | DpnI | |BstKTI | || AluI | || MmeI MboI | || CviJI | DpnI | || | SetI | |BstKTI | || | |MboII | || TaqI Hin4I | || | || SspI | || AsuII \ \ \\ \ \\ \ \ \\ \ TCTCACATTGTTCCAACTCAAAGATTTGAAGATCAAGCTCAATATTTACAACGATCTTTC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGTGTAACAAGGTTGAGTTTCTAAACTTCTAGTTCGAGTTATAAATGTTGCTAGAAAG // // / / / // // || || | | SspI || |PpiI || || | MboII || MboI || || CviJI |DpnI || || AluI BstKTI || |MmeI || |SetI || MboI |DpnI BstKTI S H I V P T Q R F E D Q A Q Y L Q R S F L T L F Q L K D L K I K L N I Y N D L S S H C S N S K I * R S S S I F T T I F R ----:----|----:----|----:----|----:----|----:----|----:----| D * M T G V * L N S S * A * Y K C R D K M E C Q E L E F I Q L D L E I N V V I K R V N N W S L S K F I L S L I * L S R E TaqII |TspDTI ||HindII EciI ||Hpy166II | TfiI BfiI ||| StyI PpiI | HinfI AciI |PpiI BsrI ||| SecI* \ \ \ \ \\ \ \\\ \ GAAACTTGTAGAGATTCTGTTCCGCCCTTGCCGACCACCCAGTTTTATTGTGTTGACCAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGAACATCTCTAAGACAAGGCGGGAACGGCTGGTGGGTCAAAATAACACAACTGGTT / / / / / / / // / / AsuII EciI HinfI AciI | BfiI BsrI || | SetI TaqI TfiI PpiI || Hpy166II || HindII |TspDTI TaqII E T C R D S V P P L P T T Q F Y C V D Q K L V E I L F R P C R P P S F I V L T K N L * R F C S A L A D H P V L L C * P R ----:----|----:----|----:----|----:----|----:----|----:----| S V Q L S E T G G K G V V W N * Q T S W R F K Y L N Q E A R A S W G T K N H Q G F S T S I R N R G Q R G G L K I T N V L SetI FokI |FatI | FatI |BinI* | |CviAII ||CviAII | || TatI ||| NlaIII | || Bsp1407I ||| |MboI | || |Csp6I ||| || DpnI | || |NlaIII ||| || |BstKTI | || ||RsaI Hpy166II ||| || ||AciI | || ||| BseGI | SmlI \\\ \\ \\\ \ \\ \\\ \ \ \ GGTTCATGTGATCCGCACTTGATGAGTTTATCCATGTACAACATCCCCGAAAGTGAACAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAGTACACTAGGCGTGAACTACTCAAATAGGTACATGTTGTAGGGGCTTTCACTTGTG / // // // / / / ///// / | || || || | AciI | ||||Bsp1407I Hpy166II | || || || MboI | ||||BseGI | || || |DpnI | ||||TatI | || || BstKTI | |||Csp6I | || |FatI | ||RsaI | || CviAII | |FatI | |BinI* | CviAII | NlaIII NlaIII SecI* FokI StyI G S C D P H L M S L S M Y N I P E S E H V H V I R T * * V Y P C T T S P K V N T F M * S A L D E F I H V Q H P R K * T L ----:----|----:----|----:----|----:----|----:----|----:----| P E H S G C K I L K D M Y L M G S L S C L N M H D A S S S N I W T C C G R F H V T * T I R V Q H T * G H V V D G F T F V AluI CviJI CviJI | SetI |AciI | Hin4I TsoI |BisI | Hin4I | Hin4I ||BlsI | |Bce83I* MseI | Hin4I |||TauI | ||FokI | BseGI BccI | | SfaNI \\\\ \ \\\ \ \ \ \ \ \ TTGAGAGCCGCCACGAAGCTACCACTTGGATTAACCATCCAACCATTTTCCACTTTGACA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCTCGGCGGTGCTTCGATGGTGAACCTAATTGGTAGGTTGGTAAAAGGTGAAACTGT / //// // // / / / // | |||AciI || || FokI BseGI | |Hin4I | ||BisI || |Bce83I* MseI | |Hin4I | |BlsI || CviJI | TsoI | CviJI || AluI BccI | TauI |SetI SmlI Hin4I Hin4I L R A A T K L P L G L T I Q P F S T L T * E P P R S Y H L D * P S N H F P L * H E S R H E A T T W I N H P T I F H F D T ----:----|----:----|----:----|----:----|----:----|----:----| K L A A V F S G S P N V M W G N E V K V S S L R W S A V V Q I L W G V M K W K S Q S G G R L * W K S * G D L W K G S Q C PflMI BsiYI* | Csp6I | |RsaI MmeI CviRI* TspEI BccI | |BseGI FokI AccI \ \ \ \ \ \\ \ \ CCGAATGATGCAGAAGTTCCCACAATTCCATTACCAATGGATGGTACGCCTTTGCGTTGT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTTACTACGTCTTCAAGGGTGTTAAGGTAATGGTTACCTACCATGCGGAAACGCAACA / / / / / / // / SfaNI CviRI* TspEI | | | |Csp6I FokI MmeI | | | RsaI | | BseGI | BsiYI* | PflMI BccI P N D A E V P T I P L P M D G T P L R C R M M Q K F P Q F H Y Q W M V R L C V V E * C R S S H N S I T N G W Y A F A L * ----:----|----:----|----:----|----:----|----:----|----:----| G F S A S T G V I G N G I S P V G K R Q V S H H L L E W L E M V L P H Y A K A N R I I C F N G C N W * W H I T R R Q T T Hpy166II | MaeII | | Tth111I Hpy166II | | |SetI ApoI | TfiI | | |TaiI TspEI | HinfI \ \ \\ \ \ \ AGACGTTGTCGTGCGTATGCTAATCCTAAATTTCAGTTCACTTATGATTCAAGTGTTATT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGCAACAGCACGCATACGATTAGGATTTAAAGTCAAGTGAATACTAAGTTCACAATAA // // / / / || |Tth111I TspEI Hpy166II HinfI || MaeII ApoI TfiI |AccI |TaiI |SetI Hpy166II R R C R A Y A N P K F Q F T Y D S S V I D V V V R M L I L N F S S L M I Q V L F T L S C V C * S * I S V H L * F K C Y L ----:----|----:----|----:----|----:----|----:----|----:----| L R Q R A Y A L G L N * N V * S E L T I Y V N D H T H * D * I E T * K H N L H * S T T T R I S I R F K L E S I I * T N N BslFI | MwoI | |HphI | |Hin6I | ||GlaI | |||HhaI | |||| FatI | |||| NcoI | |||| StyI | |||| SecI* | |||| DsaI* | |||| |CviAII | |||| || NlaIII | |||| || |AsuI* | |||| || |AvaII CviRI* | |||| || |DraII | BssKI | |||| || |PpuMI | EcoRII | |||| || |SanDI | | ScrFI | |||| || ||NlaIV | | BseBI | |||| || ||BmgT120I SspI SfaNI MseI | | | SetI | |||| || |||NlaIV \ \ \ \ \ \ \ \ \\\\ \\ \\\\ TGTAATATTTGTAGAGTTAAGATGCAAGTTCCAGGTGAGCATTTTGCGCCCATGGGTCCC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| ACATTATAAACATCTCAATTCTACGTTCAAGGTCCACTCGTAAAACGCGGGTACCCAGGG / / / / // / / //// / // /// SspI | MseI CviRI* || EcoRII | |||| | || ||SanDI SfaNI || BssKI | |||| | || ||PpuMI |BseBI | |||| | || ||DraII |ScrFI | |||| | || ||AvaII SetI | |||| | || ||AsuI* | |||| | || |BmgT120I | |||| | || |NlaIV | |||| | || NlaIV | |||| | |DsaI* | |||| | |SecI* | |||| | |StyI | |||| | |NcoI | |||| | |FatI | |||| | CviAII | |||| NlaIII | |||Hin6I | ||GlaI | |HhaI | BslFI | HphI MwoI C N I C R V K M Q V P G E H F A P M G P V I F V E L R C K F Q V S I L R P W V P * Y L * S * D A S S R * A F C A H G S Q ----:----|----:----|----:----|----:----|----:----|----:----| Q L I Q L T L I C T G P S C K A G M P G K Y Y K Y L * S A L E L H A N Q A W P D T I N T S N L H L N W T L M K R G H T G Tsp4CI* Hpy188I CviRI* | TaqI TspGWI \ \ \ \ \ AATGGGCAACGAAGTGATTTGAACGAAAAATCAGAGTTATTGCACGGAACAGTCGATTTC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTACCCGTTGCTTCACTAAACTTGCTTTTTAGTCTCAATAACGTGCCTTGTCAGCTAAAG / / / / / Hpy188I CviRI* | | TspGWI | TaqI Tsp4CI* N G Q R S D L N E K S E L L H G T V D F M G N E V I * T K N Q S Y C T E Q S I S W A T K * F E R K I R V I A R N S R F L ----:----|----:----|----:----|----:----|----:----|----:----| L P C R L S K F S F D S N N C P V T S K W H A V F H N S R F I L T I A R F L R N I P L S T I Q V F F * L * Q V S C D I E MaeII AflIII |BsaAI AluI |DraIII HgiCI* Hin4II* CviJI || SetI | NlaIV |Hpy178III* | SetI || TaiI \ \ \\ \ \ \\ \ TTGGTGCCAAGTATTTACAATGCTATTCAGGAGAAGGAGCTTTTACCACTACACTACGTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AACCACGGTTCATAAATGTTACGATAAGTCCTCTTCCTCGAAAATGGTGATGTGATGCAC / / / / / / // // / | HgiCI* | | | CviJI || || AflIII NlaIV | | | AluI || |MaeII | | SetI || BsaAI | Hpy178III* |TaiI Hin4II* |SetI DraIII L V P S I Y N A I Q E K E L L P L H Y V W C Q V F T M L F R R R S F Y H Y T T C G A K Y L Q C Y S G E G A F T T T L R V ----:----|----:----|----:----|----:----|----:----|----:----| K T G L I * L A I * S F S S K G S C * T R P A L Y K C H * E P S P A K V V V S R Q H W T N V I S N L L L L K * W * V V H CviJI |FatI |NcoI |StyI |SecI* |DsaI* |TspGWI AluI ||CviAII CviJI |||Hin4II* TspDTI | SetI |||| NlaIII \ \ \ \\\\ \ TTTTTGATTGATGTTTCATTGTTAGCTAATGAGAACGGAAGTTCTTTAGCCATGGTGGAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAACTAACTACAAAGTAACAATCGATTACTCTTGCCTTCAAGAAATCGGTACCACCTT / / / //// // / TspDTI | CviJI |||| || SetI | AluI |||| |DsaI* SetI |||| |SecI* |||| |StyI |||| |NcoI |||| |FatI |||| CviAII |||Hin4II* ||NlaIII |CviJI TspGWI F L I D V S L L A N E N G S S L A M V E F * L M F H C * L M R T E V L * P W W K F D * C F I V S * * E R K F F S H G G R ----:----|----:----|----:----|----:----|----:----|----:----| N K I S T E N N A L S F P L E K A M T S T K S Q H K M T L * H S R F N K L W P P K Q N I N * Q * S I L V S T R * G H H F FatI SetI CviJI SetI |CviAII | MnlI TsoI || NlaIII Hpy188I | TspEI SetI \ \\ \ \ \ \ \ GGTGTCAGGTCATGTATTGAGTATATTTCAGATTTCCAGCCAAATTGTGAGGTTGCTATA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAGTCCAGTACATAACTCATATAAAGTCTAAAGGTCGGTTTAACACTCCAACGATAT / / / // / / / / / TsoI | | |FatI Hpy188I | MnlI | SetI | | CviAII CviJI TspEI | NlaIII SetI G V R S C I E Y I S D F Q P N C E V A I V S G H V L S I F Q I S S Q I V R L L * C Q V M Y * V Y F R F P A K L * G C Y N ----:----|----:----|----:----|----:----|----:----|----:----| P T L D H I S Y I E S K W G F Q S T A I L H * T M Y Q T Y K L N G A L N H P Q * T D P * T N L I N * I E L W I T L N S Y MseI |BsmAI |TspEI AciI |Eco31I CviRI* \ \\ \ ATCGTTTATGATAATAAGTTGCGGTTCTTTAATTTGAGACCAGATTTAGATAATGCACAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCAAATACTATTATTCAACGCCAAGAAATTAAACTCTGGTCTAAATCTATTACGTGTT / / / / AciI | Eco31I CviRI* | TspEI | BsmAI MseI I V Y D N K L R F F N L R P D L D N A Q S F M I I S C G S L I * D Q I * I M H K R L * * * V A V L * F E T R F R * C T R ----:----|----:----|----:----|----:----|----:----|----:----| I T * S L L N R N K L K L G S K S L A C L R K H Y Y T A T R * N S V L N L Y H V D N I I I L Q P E K I Q S W I * I I C L TatI |Csp6I ||RsaI TspEI PsiI MseI \\\ \ \ \ GAGTACATTGTAAGTGAATTGGACGATGTTTTCTTACCATTTTATAATGGATTATTTGTT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTCATGTAACATTCACTTAACCTGCTACAAAAGAATGGTAAAATATTACCTAATAAACAA /// / / ||TatI TspEI PsiI |Csp6I RsaI E Y I V S E L D D V F L P F Y N G L F V S T L * V N W T M F S Y H F I M D Y L L V H C K * I G R C F L T I L * W I I C * ----:----|----:----|----:----|----:----|----:----|----:----| S Y M T L S N S S T K K G N * L P N N T L T C Q L H I P R H K R V M K Y H I I Q L V N Y T F Q V I N E * W K I I S * K N BssKI | HpaII | ScrFI MseI TsoI | CauII* TaqI BsaBI VspI TspDTI | TspEI MaeIII \ \ \ \ \ \ \ \ \ AAACCCGGAAACTCGATGAAAATCATTAATGACACATTGATAAAAATTAGTGGTTACATC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGGCCTTTGAGCTACTTTTAGTAATTACTGTGTAACTATTTTTAATCACCAATGTAG / /// / / // / / / MseI ||BssKI | BsaBI |TspDTI TsoI TspEI MaeIII |HpaII TaqI VspI CauII* MseI ScrFI K P G N S M K I I N D T L I K I S G Y I N P E T R * K S L M T H * * K L V V T S T R K L D E N H * * H I D K N * W L H L ----:----|----:----|----:----|----:----|----:----|----:----| L G P F E I F I M L S V N I F I L P * M * V R F S S S F * * H C M S L F * H N C F G S V R H F D N I V C Q Y F N T T V D MaeIII Tsp45I | MaeII MwoI | |BsaAI | CviJI | ||Csp6I | |AciI | |||RsaI | |BisI | |||SetI | ||BlsI | |||TaiI XcmI | |||TauI \ \\\\ \ \ \\\\ TCCACCGACAAGTATAGTCACGTACCCCAAGTCTGTTATGGTTCTGCTTTACAAGCCGCA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTGGCTGTTCATATCAGTGCATGGGGTTCAGACAATACCAAGACGAAATGTTCGGCGT / //// / / //// | |||Csp6I XcmI MwoI |||AciI | ||RsaI ||BisI | |MaeII |BlsI | Tsp45I CviJI | MaeIII TauI | BsaAI TaiI SetI S T D K Y S H V P Q V C Y G S A L Q A A P P T S I V T Y P K S V M V L L Y K P Q H R Q V * S R T P S L L W F C F T S R K ----:----|----:----|----:----|----:----|----:----|----:----| E V S L Y L * T G W T Q * P E A K C A A R W R C T Y D R V G L R N H N Q K V L R G G V L I T V Y G L D T I T R S * L G C MaeIII Tsp4CI* |FauI || AlwNI || | AciI TspEI || | |BsrI | MwoI || | ||Cac8I SetI \ \ \\ \ \\\ \ AAATTAGCGTTAGACACAGTAACTGGCGGGCAAGGTGGTAAGATTATTTGTTCTTTGAAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAATCGCAATCTGTGTCATTGACCGCCCGTTCCACCATTCTAATAAACAAGAAACTTG / / / / / / / / / / | TspEI | | | | | | SetI SetI MwoI | | | | | Cac8I | | | | | AciI | | | | BsrI | | | MaeIII | | FauI | AlwNI Tsp4CI* K L A L D T V T G G Q G G K I I C S L N N * R * T Q * L A G K V V R L F V L * T I S V R H S N W R A R W * D Y L F F E Q ----:----|----:----|----:----|----:----|----:----|----:----| F N A N S V T V P P C P P L I I Q E K F L I L T L C L L Q R A L H Y S * K N K S F * R * V C Y S A P L T T L N N T R Q V MboI CviRI* | DpnI | BsrDI AluI | BsiYI* | | MwoI CviJI | |PvuI | | BslFI | SetI | |McrI* ApoI | | BstAPI | Cac8I | |BstKTI TspEI | | | FatI \ \ \ \\ \ \ \ \ \ AGCTTGCCAACGATCGGCAACGGGAATTTATCGCTAAAAAGGGACAATGCACACATTGCT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAACGGTTGCTAGCCGTTGCCCTTAAATAGCGATTTTTCCCTGTTACGTGTGTAACGA / / / // / / / // // | Cac8I | || MboI TspEI | |BstAPI |NlaIII CviJI | |DpnI ApoI | |MwoI BslFI AluI | BstKTI | BsrDI | McrI* CviRI* | PvuI BsiYI* S L P T I G N G N L S L K R D N A H I A A C Q R S A T G I Y R * K G T M H T L L L A N D R Q R E F I A K K G Q C T H C S ----:----|----:----|----:----|----:----|----:----|----:----| L K G V I P L P F K D S F L S L A C M A C S A L S R C R S N I A L F P C H V C Q A Q W R D A V P I * R * F P V I C V N S CviAII | NlaIII Hpy188I | |MseI TspEI | SfaNI \ \\ \ \ \ CATGTTAAATGCGACAATGGGTTCTATAAGAAATTAGCATCGGATTTTTTGAAATCCTAC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GTACAATTTACGCTGTTACCCAAGATATTCTTTAATCGTAGCCTAAAAAACTTTAGGATG // / / / / || MseI TspEI Hpy188I SfaNI |FatI CviAII H V K C D N G F Y K K L A S D F L K S Y M L N A T M G S I R N * H R I F * N P T C * M R Q W V L * E I S I G F F E I L H ----:----|----:----|----:----|----:----|----:----|----:----| * T L H S L P N * L F N A D S K K F D * E H * I R C H T R Y S I L M P N K S I R M N F A V I P E I L F * C R I K Q F G V MslI | FokI | CfrI | | BalI | | CviJI | | HaeIII AjuI | | | AjuI | MaeIII | | | | Tsp4CI* | Tsp45I | | | | | AsuI* | | FauI | | | | | TspRI | | | TspDTI | | | | | |BmgT120I | | | | AciI | | | | | ||CviJI | | | | | TfiI | | | | | ||HaeIII | | | | | HinfI | | | | | |||BseGI \ \ \ \ \ \ \ \ \ \ \ \\\\ ATTTCTTTAGATTTATATGTGACCAATGCGGGATTCATTGATATGGCCACTGTGGGCCAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGAAATCTAAATATACACTGGTTACGCCCTAAGTAACTATACCGGTGACACCCGGTA / // / / / / // / / /// AjuI |Tsp45I AciI | | | || | | ||AsuI* |MaeIII | | | || | | |BmgT120I |FauI | | | || | | |HaeIII TspDTI | | | || | | |CviJI | | | || | | BseGI | | | || | Tsp4CI* | | | || CfrI | | | || FokI | | | |HaeIII | | | |CviJI | | | |BalI | | | TspRI | | AjuI | MslI HinfI TfiI I S L D L Y V T N A G F I D M A T V G H F L * I Y M * P M R D S L I W P L W A I F F R F I C D Q C G I H * Y G H C G P S ----:----|----:----|----:----|----:----|----:----|----:----| M E K S K Y T V L A P N M S I A V T P W C K K L N I H S W H P I * Q Y P W Q P G N R * I * I H G I R S E N I H G S H A M Esp3I SfeI* BetI* BsmAI | BccI |HpaII SspI | SfaNI \ \ \\ \ \ \ CCTGTAGAGATGACTTCCGGTATTTTGAAATATTATCCCCACTTTCAACAAGAGACGGAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GGACATCTCTACTGAAGGCCATAAAACTTTATAATAGGGGTGAAAGTTGTTCTCTGCCTA / // / / / / SfeI* |BetI* SspI | SfaNI TsoI BccI HpaII BsmAI Esp3I P V E M T S G I L K Y Y P H F Q Q E T D L * R * L P V F * N I I P T F N K R R M C R D D F R Y F E I L S P L S T R D G C ----:----|----:----|----:----|----:----|----:----|----:----| G T S I V E P I K F Y * G W K * C S V S D Q L S S K R Y K S I N D G S E V L S P R Y L H S G T N Q F I I G V K L L L R I FokI TspGWI | Hin4II* | |TsoI | ||MseI | |||HpaI | |||HindII | |||Hpy166II | |||| FatI HindIII | |||| |CviAII TsoI | AluI TsoI | |||| || MaeIII |BsmAI | CviJI | BseGI | |||| || NlaIII || SspI | | SetI \ \ \ \\\\ \\ \ \\ \ \ \ \ GCCTTCACTTTGGTTAACGACATGGTTACAAATGTCTCCAATATTGTTGGTTATCAAGCT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAAGTGAAACCAATTGCTGTACCAATGTTTACAGAGGTTATAACAACCAATAGTTCGA / / / /// / // / / // / / / BseGI | | ||| | |FatI MaeIII TsoI |BsmAI | | HindIII | | ||| | CviAII SspI | CviJI | | ||| NlaIII | AluI | | ||MseI SetI | | |Hpy166II | | |HindII | | |HpaI | | FokI | Hin4II* | TsoI TspGWI A F T L V N D M V T N V S N I V G Y Q A P S L W L T T W L Q M S P I L L V I K L L H F G * R H G Y K C L Q Y C W L S S F ----:----|----:----|----:----|----:----|----:----|----:----| A K V K T L S M T V F T E L I T P * * A H R * K P * R C P * L H R W Y Q Q N D L G E S Q N V V H N C I D G I N N T I L S TatI Tsp4CI* |Csp6I BsrI ||RsaI CviJI ||ScaI TfiI | BfiI |||TspDTI HinfI Hpy188I \ \ \\\\ \ \ TTATTGAAAGTTCGCTGTTCTACTGGGCTATCTGTGGAACAGTACTACTGCGATTCATCT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AATAACTTTCAAGCGACAAGATGACCCGATAGACACCTTGTCATGATGACGCTAAGTAGA / / / / //// / / | | BfiI | |||TatI | Hpy188I | CviJI | ||Csp6I HinfI BsrI | |ScaI TfiI | |RsaI | TspDTI Tsp4CI* L L K V R C S T G L S V E Q Y Y C D S S Y * K F A V L L G Y L W N S T T A I H L I E S S L F Y W A I C G T V L L R F I * ----:----|----:----|----:----|----:----|----:----|----:----| K N F T R Q E V P S D T S C Y * Q S E D K I S L E S N * Q A I Q P V T S S R N M * Q F N A T R S P * R H F L V V A I * R MboI |BinI* ||DpnI |||FatI |||BspHI |||BstKTI ||||CviAII ||||Hpy178III* |||||BsaBI ||||||MboI |||||||NlaIII ||||||||DpnI ||||||||BinI* |||||||||BstKTI |||||||||| TspEI DdeI |||||||||| | TspGWI MaeI |SetI \\\\\\\\\\ \ \ \ \\ GATAATACGGATCATGATCCAATTATTCCTGTATTGACTAGAGATACCACCTTAGATGTC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTATGCCTAGTACTAGGTTAATAAGGACATAACTGATCTCTATGGTGGAATCTACAG /////////// / / / / ||||||||||| TspEI MaeI SetI DdeI ||||||||||TspGWI |||||||||MboI ||||||||BinI* |||||||DpnI ||||||BstKTI ||||||BspHI ||||||FatI |||||Hpy178III* |||||CviAII ||||BsaBI |||MboI ||NlaIII |BinI* |DpnI BstKTI D N T D H D P I I P V L T R D T T L D V I I R I M I Q L F L Y * L E I P P * M S * Y G S * S N Y S C I D * R Y H L R C L ----:----|----:----|----:----|----:----|----:----|----:----| S L V S * S G I I G T N V L S V V K S T Q Y Y P D H D L * E Q I S * L Y W R L H I I R I M I W N N R Y Q S S I G G * I D Tsp4CI* TspDTI AloI | AloI | NlaIV CviRI* \ \ \ \ \ TTACTAAAATATGACAGTAAAATAAAAACAGGAACCGATGTTCATTTCCAAACTGCATTG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AATGATTTTATACTGTCATTTTATTTTTGTCCTTGGCTACAAGTAAAGGTTTGACGTAAC / / / / / / | AloI | NlaIV AloI CviRI* Tsp4CI* TspDTI L L K Y D S K I K T G T D V H F Q T A L Y * N M T V K * K Q E P M F I S K L H C T K I * Q * N K N R N R C S F P N C I V ----:----|----:----|----:----|----:----|----:----|----:----| K S F Y S L L I F V P V S T * K W V A N R V L I H C Y F L F L F R H E N G F Q M * * F I V T F Y F C S G I N M E L S C Q MseI | AflIII | | MaeII | | |BtrI | | || SetI SetI BccI Hpy188I | | || TaiI |AciI \ \ \ \ \\ \ \\ TTATATACTGATATTGATGGTGTCAGAAAAGTTCGTTCTATTAACACGTCAGGTGCGGTA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AATATATGACTATAACTACCACAGTCTTTTCAAGCAAGATAATTGTGCAGTCCACGCCAT / / / / // / / BccI Hpy188I | | || SetI AciI | | |AflIII | | |MaeII | | BtrI | TaiI | SetI MseI L Y T D I D G V R K V R S I N T S G A V Y I L I L M V S E K F V L L T R Q V R Y I Y * Y * W C Q K S S F Y * H V R C G I ----:----|----:----|----:----|----:----|----:----|----:----| N Y V S I S P T L F T R E I L V D P A T T I Y Q Y Q H H * F L E N * * C T L H P * I S I N I T D S F N T R N V R * T R Y FatI BspHI Hpy178III* |CviAII | ApoI |Hpy178III* MboI | TspEI PsiI || NlaIII BclI \ \ \ \\ \ \ TCTAATAACATTCGTGAAATTTTCAAGTTTATAAATCAAAATCCTGTCATGAGAATAATG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AGATTATTGTAAGCACTTTAAAAGTTCAAATATTTAGTTTTAGGACAGTACTCTTATTAC / / / / // / | TspEI PsiI | |BspHI BstKTI | ApoI | |FatI Hpy178III* | Hpy178III* | CviAII NlaIII S N N I R E I F K F I N Q N P V M R I M L I T F V K F S S L * I K I L S * E * * * * H S * N F Q V Y K S K S C H E N N D ----:----|----:----|----:----|----:----|----:----|----:----| D L L M R S I K L N I F * F G T M L I I I * Y C E H F K * T * L D F D Q * S F L R I V N T F N E L K Y I L I R D H S Y H MboI | DpnI | |BstKTI HgaI | || Hpy188I | MaeIII | || | MseI DpnI | Tsp45I | || | VspI |BstKTI | | HphI | || | |TspEI \\ \ \ \ \ \\ \ \\ ATCAAAGATGTCATAAAGACGCTCGGTGATTGTGACTTTGTAAAGATCAGAAGATTAATT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTTCTACAGTATTTCTGCGAGCCACTAACACTGAAACATTTCTAGTCTTCTAATTAA / / / / // / / / | BclI | Tsp45I || Hpy188I | TspEI | MboI | MaeIII || MboI VspI DpnI | HphI |DpnI MseI HgaI BstKTI I K D V I K T L G D C D F V K I R R L I S K M S * R R S V I V T L * R S E D * L Q R C H K D A R * L * L C K D Q K I N * ----:----|----:----|----:----|----:----|----:----|----:----| I L S T M F V S P S Q S K T F I L L N I S * L H * L S A R H N H S Q L S * F I L D F I D Y L R E T I T V K Y L D S S * N Hpy178III* MboII DrdI | MnlI |BccI | TaqI | | TsoI MaeIII \\ \ \ \ \ \ \ GATGACAAGATGGTCGAAATCTTGACCCAATATAGAGGATTGGTTAGCAGTAACTCATCA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGTTCTACCAGCTTTAGAACTGGGTTATATCTCCTAACCAATCGTCATTGAGTAGT / / / / / / / / | | DrdI TaqI | | TsoI MaeIII | BccI | MnlI MboII Hpy178III* D D K M V E I L T Q Y R G L V S S N S S M T R W S K S * P N I E D W L A V T H Q * Q D G R N L D P I * R I G * Q * L I N ----:----|----:----|----:----|----:----|----:----|----:----| S S L I T S I K V W Y L P N T L L L E D Q H C S P R F R S G I Y L I P * C Y S M I V L H D F D Q G L I S S Q N A T V * * FatI AflIII BspLU11I* HpaII |CviAII MfeI | TfiI || NspI TspEI | HinfI BsrDI Cac8I || NlaIII \ \ \ \ \ \\ \ ACGCAATTGATACTGCCGGATTCTATAAAGACATTGCCTGCTTACATGTTAGCATTTGAA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TGCGTTAACTATGACGGCCTAAGATATTTCTGTAACGGACGAATGTACAATCGTAAACTT / / / / / / // TspEI | HinfI BsrDI Cac8I | |BspLU11I* MfeI | TfiI | |AflIII HpaII | |FatI | CviAII NlaIII NspI T Q L I L P D S I K T L P A Y M L A F E R N * Y C R I L * R H C L L T C * H L K A I D T A G F Y K D I A C L H V S I * K ----:----|----:----|----:----|----:----|----:----|----:----| V C N I S G S E I F V N G A * M N A N S L A I S V A P N * L S M A Q K C T L M Q R L Q Y Q R I R Y L C Q R S V H * C K F TspDTI | Csp6I TspEI | |RsaI | MseI | || SecI* ApoI | VspI CviJI | || DsaI* TspEI TspDTI \ \ \ \ \\ \ \ \ AAAAGCGAATTAATGAAGCCAAACGCTCAAAGTACCCGTGGTAATGAACGAATTTATGAT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCGCTTAATTACTTCGGTTTGCGAGTTTCATGGGCACCATTACTTGCTTAAATACTA // / / // / / / |VspI CviJI TspDTI |Csp6I DsaI* | TspDTI |MseI RsaI SecI* TspEI TspEI ApoI K S E L M K P N A Q S T R G N E R I Y D K A N * * S Q T L K V P V V M N E F M I K R I N E A K R S K Y P W * * T N L * F ----:----|----:----|----:----|----:----|----:----|----:----| F L S N I F G F A * L V R P L S R I * S F F R I L S A L R E F Y G H Y H V F K H F A F * H L W V S L T G T T I F S N I I TspDTI | Csp6I | |RsaI | || TfiI | || HinfI | || | AlfI BspCNI AlfI | || | AlfI DdeI |BseMII AlfI TspEI \ \\ \ \ \ \\ \ \ TTATTGAAGTACGATTCATTGAACTCAGCACAACTTTGCTACAAACTTTATCCACAAATT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AATAACTTCATGCTAAGTAACTTGAGTCGTGTTGAAACGATGTTTGAAATAGGTGTTTAA / // // / // / / TspDTI || |HinfI DdeI |BseMII AlfI TspEI || |TfiI BspCNI AlfI || AlfI || AlfI |Csp6I RsaI L L K Y D S L N S A Q L C Y K L Y P Q I Y * S T I H * T Q H N F A T N F I H K L I E V R F I E L S T T L L Q T L S T N C ----:----|----:----|----:----|----:----|----:----|----:----| K N F Y S E N F E A C S Q * L S * G C I N I S T R N M S S L V V K S C V K D V F * Q L V I * Q V * C L K A V F K I W L N MboI | DpnI FatI | |BstKTI |CviAII | || Hpy188I TspEI || NlaIII | || |SfaNI | GsuI || | MnlI | || || SetI | Eco57MI \\ \ \ \ \\ \\ \ \ \ GTGCCATTCCATGTATTATTAGAGGAAACTGATCTGACCTTTTACGATGCTAATGATAAA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CACGGTAAGGTACATAATAATCTCCTTTGACTAGACTGGAAAATGCTACGATTACTATTT / /// // / / / / | ||MnlI || | | SfaNI Eco57MI | |FatI || | SetI GsuI | CviAII || Hpy188I NlaIII || MboI |DpnI BstKTI V P F H V L L E E T D L T F Y D A N D K C H S M Y Y * R K L I * P F T M L M I N A I P C I I R G N * S D L L R C * * * I ----:----|----:----|----:----|----:----|----:----|----:----| T G N W T N N S S V S R V K * S A L S L Q A M G H I I L P F Q D S R K R H * H Y H W E M Y * * L F S I Q G K V I S I I F AluI CviJI CviJI MboI | SetI | TspDTI | DpnI | | MseI | | MnlI | |BstKTI | | VspI | | TspEI \ \\ \ \ \ \ \ \ TTATTACAGATCAACTCCAGCTCTATTAATAATCTATCTGTAAGAGCCTCACACTCTAAT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| AATAATGTCTAGTTGAGGTCGAGATAATTATTAGATAGACATTCTCGGAGTGTGAGATTA / // / / / / / / / TspEI || MboI | CviJI VspI | TspDTI MnlI |DpnI | AluI MseI CviJI BstKTI SetI L L Q I N S S S I N N L S V R A S H S N Y Y R S T P A L L I I Y L * E P H T L I I T D Q L Q L Y * * S I C K S L T L * F ----:----|----:----|----:----|----:----|----:----|----:----| N N C I L E L E I L L R D T L A E C E L I I V S * S W S * * Y D I Q L L R V S * * * L D V G A R N I I * R Y S G * V R I StyI MseI AciI BceAI SecI* SetI HphI MseI \ \ \ \ \ \ \ TTCATTAACGGCGGTTGCTACTTGATTTTCCAAGGTGATACTATCTATCTATGGTTTAAT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAATTGCCGCCAACGATGAACTAAAAGGTTCCACTATGATAGATAGATACCAAATTA / / / / / / / / TspEI MseI AciI BceAI | SecI* HphI MseI | StyI SetI F I N G G C Y L I F Q G D T I Y L W F N S L T A V A T * F S K V I L S I Y G L M H * R R L L L D F P R * Y Y L S M V * * ----:----|----:----|----:----|----:----|----:----|----:----| K M L P P Q * K I K W P S V I * R H N L N * * R R N S S S K G L H Y * R D I T * E N V A T A V Q N E L T I S D I * P K I Hin4I Hin4I TspRI |BsmI | TfiI || CviRI* | HinfI || | MwoI | | BseGI || | BstAPI | | | Hin4I || | | SetI | | | Hin4I || | | |Eam1105I | | | | FokI EcoP15I || | | || BspMI | | | | | TspDTI \ \\ \ \ \\ \ \ \ \ \ \ \ GAGAACACCAATAGAATGCTCTTGCAAGACCTGCTGTCAGTGGATGAATCCTTGCCCGTC 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTGTGGTTATCTTACGAGAACGTTCTGGACGACAGTCACCTACTTAGGAACGGGCAG / / / / // / / / / / / / EcoP15I | BsmI | || | TspRI | | HinfI | FokI Hin4I | || Eam1105I | | TfiI TspDTI Hin4I | |SetI | Hin4I | BstAPI | Hin4I | MwoI | BseGI CviRI* BspMI E N T N R M L L Q D L L S V D E S L P V R T P I E C S C K T C C Q W M N P C P S E H Q * N A L A R P A V S G * I L A R Q ----:----|----:----|----:----|----:----|----:----|----:----| S F V L L I S K C S R S D T S S D K G T H S C W Y F A R A L G A T L P H I R A R L V G I S H E Q L V Q Q * H I F G Q G D BseMII |BspCNI BsiYI* ||BsrDI | SpeI CviJI ||| Esp3I | SduI | ApoI ||| BsmAI | BseSI MseI | TspEI ||| | DdeI | |MaeI VspI \ \ \\\ \ \ \ \\ \ AGCCAAATTTCGTTATTTAGTGGAACATTGCCTGAGACGGGCACTAGTATTAATCAAAAG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TCGGTTTAAAGCAATAAATCACCTTGTAACGGACTCTGCCCGTGATCATAATTAGTTTTC / / /// / // / // / CviJI TspEI ||BsrDI | || BseSI |SpeI VspI ApoI |BspCNI | || SduI MaeI MseI BseMII | |DdeI | BsiYI* BsmAI Esp3I S Q I S L F S G T L P E T G T S I N Q K A K F R Y L V E H C L R R A L V L I K R P N F V I * W N I A * D G H * Y * S K G ----:----|----:----|----:----|----:----|----:----|----:----| L W I E N N L P V N G S V P V L I L * F * G F K T I * H F M A Q S P C * Y * D F A L N R * K T S C Q R L R A S T N I L L MaeII | SetI BceAI | TaiI HindII CviJI | | MseI BsrI Hpy166II BsrDI MnlI \ \ \ \ \ \ \ \ GCTTCAAACGTCATTAAAAACTGGCAACAAGTAGTCAACAAGTCATCATTGCCGTTAGTC 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGTTTGCAGTAATTTTTGACCGTTGTTCATCAGTTGTTCAGTAGTAACGGCAATCAG / / / / / / / / / CviJI | MaeII MseI BsrI | BceAI BsrDI MnlI TaiI Hpy166II SetI HindII A S N V I K N W Q Q V V N K S S L P L V L Q T S L K T G N K * S T S H H C R * S F K R H * K L A T S S Q Q V I I A V S L ----:----|----:----|----:----|----:----|----:----|----:----| A E F T M L F Q C C T T L L D D N G N T P K L R * * F S A V L L * C T M M A T L S * V D N F V P L L Y D V L * * Q R * D HinfI MboI | MfeI BclI | TspEI StuI | DpnI | | PleI CviJI | |BstKTI | | |MnlI HaeIII | || SspI Tsp4CI* | | |MlyI \ \ \\ \ \ \ \ \\ TTGTTGAGGCCTAATGTTGATCAATATTACAGTAATGTGATGAGTCAATTGCTTTGCGAG 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| AACAACTCCGGATTACAACTAGTTATAATGTCATTACACTACTCAGTTAACGAAACGCTC / // / / / / // HaeIII || | SspI Tsp4CI* | |PleI CviJI || BclI | |MlyI StuI || MboI | TspEI |DpnI | MfeI BstKTI | MnlI HinfI L L R P N V D Q Y Y S N V M S Q L L C E C * G L M L I N I T V M * * V N C F A R V E A * C * S I L Q * C D E S I A L R G ----:----|----:----|----:----|----:----|----:----|----:----| K N L G L T S * Y * L L T I L * N S Q S R T S A * H Q D I N C Y H S S D I A K R Q Q P R I N I L I V T I H H T L Q K A L DrdI | Tsp4CI* | | HindII | | Hpy166II CviRI* | | | TfiI | EcoT22I | | | HinfI | |HphI | | | | TaqI | || FalI | | | | | TfiI | || FalI | | | | | HinfI | || | ApoI | | | | | | NdeI TspEI | || | TspEI \ \ \ \ \ \ \ \ \ \\ \ \ GACAAGACCGTCAACAGAATCGAATCATATGACAATTACTTGGTGATAATGCATAAAAAA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTCTGGCAGTTGTCTTAGCTTAGTATACTGTTAATGAACCACTATTACGTATTTTTT / / / / / / / / / / / | | | | | | NdeI TspEI | | HphI | | | | | HinfI | CviRI* | | | | | TfiI | FalI | | | | TaqI | FalI | | | HinfI EcoT22I | | | TfiI | | Hpy166II | | HindII | Tsp4CI* DrdI D K T V N R I E S Y D N Y L V I M H K K T R P S T E S N H M T I T W * * C I K K Q D R Q Q N R I I * Q L L G D N A * K N ----:----|----:----|----:----|----:----|----:----|----:----| S L V T L L I S D Y S L * K T I I C L F P C S R * C F R I M H C N S P S L A Y F V L G D V S D F * I V I V Q H Y H M F F Hpy178III* |TaqI || BsmAI || | AciI FalI || | BisI Hpy178III* FalI || | |BlsI | XmnI TspDTI | MseI || | ||TauI Hpy178III* \ \ \ \ \ \\ \ \\\ \ ATTCAAGAAAAACTTCAAAAAGACGATTTCATTAAAGTCTCGACTGCCGCAACTCACGAA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTTCTTTTTGAAGTTTTTCTGCTAAAGTAATTTCAGAGCTGACGGCGTTGAGTGCTT / / / / / / // //// / | | XmnI TspDTI FalI MseI || |||AciI Hpy178III* | Hpy178III* FalI || ||BisI TspEI || |BlsI ApoI || BsmAI || TauI |TaqI Hpy178III* I Q E K L Q K D D F I K V S T A A T H E F K K N F K K T I S L K S R L P Q L T K S R K T S K R R F H * S L D C R N S R K ----:----|----:----|----:----|----:----|----:----|----:----| I * S F S * F S S K M L T E V A A V * S F E L F V E F L R N * * L R S Q R L E R N L F F K L F V I E N F D R S G C S V F ApoI TspEI |BccI CviRI* \\ \ AATATCCATCAAAAATTTGTGCAGTTTTGA 2770 2780 2790 ----:----|----:----|----:----| TTATAGGTAGTTTTTAAACACGTCAAAACT / / / | | CviRI* | TspEI | ApoI BccI N I H Q K F V Q F * I S I K N L C S F X Y P S K I C A V L X ----:----|----:----|----:----| F I W * F N T C N Q F Y G D F I Q A T K I D M L F K H L K S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 11 BspACI,SsiI AflIII 3 AjuI 1 AlfI 2 AloI 1 AluI 8 AluBI AlwNI 1 CaiI ApoI 7 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 7 Bce83I* 2 BpuEI BceAI 2 BclI 2 FbaI,Ksp22I BetI* 1 BsaWI BfiI 2 BmrI,BmuI BinI* 3 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmeT110I 1 BmgT120I 2 BplI 2 Bpu10I 1 BsaAI 2 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 7 BstF5I,BtsCI BseMII 3 BseRI 1 BseSI 2 BaeGI,BstSLI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 6 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 3 BspHI 2 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrDI 4 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstAPI 2 BstKTI 11 BtrI 1 BmgBI,AjiI Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI Csp6I 7 CviQI,RsaNI CviAII 11 CviJI 23 CviKI-1 CviRI* 10 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 11 MalI DraII 1 EcoO109I DraIII 1 AdeI DrdI 2 AasI,DseDI DsaI* 3 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 2 Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57MI 1 EcoP15I 3 EcoRII 1 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 2 BsmBI FalI 2 FatI 11 FauI 2 SmuI FokI 7 GlaI 3 GsuI 1 BpmI HaeII 2 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 3 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 3 HpyAV Hin6I 3 HinP1I,HspAI HindII 4 HincII HindIII 1 HinfI 14 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 10 Hpy188III Hpy188I 7 MaeI 3 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 7 MboI 11 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 3 MunI MlyI 2 SchI MmeI 2 MnlI 13 MseI 16 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 6 HpyF10VI,BstMWI NcoI 2 Bsp19I NdeI 2 FauNDI NlaIII 11 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI PpiI 1 PpuMI 1 Psp5II,PspPPI PsiI 2 AanI PvuI 1 MvrI,Ple19I,BpvUI RsaI 7 AfaI SanDI 1 ScaI 1 BmcAI,AssI,ZrmI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 6 BseDI,BssECI,BsaJI SetI 27 SfaNI 6 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI SpeI 1 BcuI,AhlI SspI 6 StuI 2 Eco147I,PceI,SseBI,AatI StyI 4 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 6 TaqII 1 TatI 3 TauI 3 TfiI 12 PfeI TseI 1 ApeKI TsoI 7 Tsp45I 3 NmuCI Tsp4CI* 10 HpyCH4III,TaaI,Bst4CI TspDTI 13 TspEI 26 TasI,Tsp509I,Sse9I TspGWI 5 TspRI 3 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 5 PshBI,AseI XcmI 2 XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AgeI AhaIII* ApaI ApaLI AscI Asp718I AvrII BaeI BamHI BarI BbvCI BcgI BciVI BdaI BglI BglII BmtI BsaXI BsePI BseYI BsgI BsiI* Bsp120I BspMII* BspOI BsrBI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI BtsI Cfr10I Cfr9I ClaI CspCI DinI Ecl136II Eco57I EcoICRI EcoNI EcoRI EcoRV EgeI EheI EspI* FnuDII* FseI FspAI GsaI HgiAI* HgiJII* Hpy99I KasI KpnI Ksp632I* MauBI MluI MroNI MstI* NaeI NarI NgoMIV NheI NmeAIII NotI NruI NspBII* OliI PacI PasI PfoI PmaCI PmeI PshAI PspOMI PspXI PsrI PstI PvuII RsrII SacI SacII SalI SapI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SwaI TspMI TstI XbaI XhoI XhoII XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769