Restriction Map of IRE1/YHR079C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

IRE1/YHR079C on chromosome VIII from coordinates 261591 to 258244.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 FatI AflIII BspLU11I* AccI |CviAII |Hpy166II || NspI TspRI || TaqI || NlaIII |FokI BseGI || AsuII || | MboII BtsI || TspDTI |TspDTI \\ \ \\ \ \ \ \\ \ \\ ATGCGTCTACTTCGAAGAAACATGTTAGTATTGACACTGCTCGTTTGTGTGTTTTCATCC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGCAGATGAAGCTTCTTTGTACAATCATAACTGTGACGAGCAAACACACAAAAGTAGG // / / /// / / / // |AccI AsuII | ||MboII TspRI | FokI |TspDTI | TaqI | || BtsI TspDTI BseGI Hpy166II | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI M R L L R R N M L V L T L L V C V F S S C V Y F E E T C * Y * H C S F V C F H P A S T S K K H V S I D T A R L C V F I H ----:----|----:----|----:----|----:----|----:----|----:----| X R R S R L F M N T N V S S T Q T N E D X A D V E F F C T L I S V A R K H T K M H T * K S S V H * Y Q C Q E N T H K * G BsmAI Esp3I | SmlI | |SetI | || BsiYI* | || |AciI FatI | || ||BisI BccI | || |||BlsI |CviAII | || ||||TauI || NlaIII Bce83I* | || ||||MnlI \\ \ \ \ \\ \\\\\ ATCATTTCATGCTCAATCCCATTGTCGTCTCGCACCTCAAGGCGGCAGATAGTGGAAGAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTAAAGTACGAGTTAGGGTAACAGCAGAGCGTGGAGTTCCGCCGTCTATCACCTTCTA // // / / / / / /// || |FatI Bce83I* | | | | ||MnlI || CviAII | | | | ||BisI |BccI | | | | ||AciI NlaIII | | | | |BlsI | | | | TauI | | | SmlI | | BsiYI* | Esp3I | BsmAI SetI I I S C S I P L S S R T S R R Q I V E D S F H A Q S H C R L A P Q G G R * W K M H F M L N P I V V S H L K A A D S G R * ----:----|----:----|----:----|----:----|----:----|----:----| M M E H E I G N D D R V E L R C I T S S W * K M S L G M T T E C R L A A S L P L D N * A * D W Q R R A G * P P L Y H F I TspDTI | MnlI | | AluI | | CviJI | | | SetI MboII | | | |TspEI \ \ \ \ \\ GAAGTTGCCTCCACTAAAAAGCTCAATTTCAACTATGGTGTGGATAAAAATATAAACTCG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCAACGGAGGTGATTTTTCGAGTTAAAGTTGATACCACACCTATTTTTATATTTGAGC / / / / / / MboII | | | CviJI TspEI | | | AluI | | SetI | MnlI TspDTI E V A S T K K L N F N Y G V D K N I N S K L P P L K S S I S T M V W I K I * T R S C L H * K A Q F Q L W C G * K Y K L A ----:----|----:----|----:----|----:----|----:----|----:----| S T A E V L F S L K L * P T S L F I F E H L Q R W * F A * N * S H H P Y F Y L S F N G G S F L E I E V I T H I F I Y V R Eco57I Eco57MI | DdeI | | AluI | | CviJI | | | SetI | | | EcoP15I TspRI | | | | TspDTI | SetI | | | | | BspCNI Hin4II* | |Hpy166II | | | | | |BseMII \ \ \\ \ \ \ \ \ \\ CCCATTCCTGCTCCAAGAACCACTGAAGGTTTACCAAATATGAAACTCAGCTCATATCCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTAAGGACGAGGTTCTTGGTGACTTCCAAATGGTTTATACTTTGAGTCGAGTATAGGT / / / / /// // // Hin4II* SetI Hpy166II | ||| || |BseMII TspRI | ||| || BspCNI | ||| |EcoP15I | ||| TspDTI | ||CviJI | ||AluI | |DdeI | SetI Eco57MI Eco57I P I P A P R T T E G L P N M K L S S Y P P F L L Q E P L K V Y Q I * N S A H I Q H S C S K N H * R F T K Y E T Q L I S N ----:----|----:----|----:----|----:----|----:----|----:----| G M G A G L V V S P K G F I F S L E Y G A W E Q E L F W Q L N V L Y S V * S M D G N R S W S G S F T * W I H F E A * I W MaeII TaqI | SetI | MaeII | TaiI | |BtrI | | TseI | ||Hpy99I | | CviJI | |||SetI | | |BisI MmeI | |||TaiI BbvI | | ||BlsI \ \ \\\\ \ \ \ \\\ ACTCCTAACTTATTGAATACTGCTGATAATCGACGTGCTAACAAAAAAGGACGTAGGGCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGGATTGAATAACTTATGACGACTATTAGCTGCACGATTGTTTTTTCCTGCATCCCGA / / / // // / /// MmeI | | |MaeII || | ||BisI | | BtrI || | |BlsI | TaqI || | CviJI | TaiI || MaeII | SetI |TaiI Hpy99I |SetI BbvI T P N L L N T A D N R R A N K K G R R A L L T Y * I L L I I D V L T K K D V G L S * L I E Y C * * S T C * Q K R T * G C ----:----|----:----|----:----|----:----|----:----|----:----| V G L K N F V A S L R R A L L F P R L A L E * S I S Y Q Q Y D V H * C F L V Y P S R V * Q I S S I I S T S V F F S T P S Csp6I Hpy166II TfiI BseMII TspEI |RsaI HinfI |BspCNI DdeI Hpy188I \ \\ \ \\ \ \ GCCAATTCTATAAGTGTACCCTATTTGGAGAATCGTTCCTTGAACGAACTGAGTTTATCA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTAAGATATTCACATGGGATAAACCTCTTAGCAAGGAACTTGCTTGACTCAAATAGT / / /// / // / / TseI TspEI ||Csp6I | |BspCNI DdeI Hpy188I |RsaI | BseMII Hpy166II HinfI TfiI A N S I S V P Y L E N R S L N E L S L S P I L * V Y P I W R I V P * T N * V Y Q Q F Y K C T L F G E S F L E R T E F I R ----:----|----:----|----:----|----:----|----:----|----:----| A L E I L T G * K S F R E K F S S L K D Q W N * L H V R N P S D N R S R V S N I G I R Y T Y G I Q L I T G Q V F Q T * * TseI |BisI ||BlsI |||CviJI |||| MnlI |||| | MaeII |||| | | Hpy99I |||| | | |SetI |||| | | |TaiI |||| | | || BbvI |||| | | || TspDTI |||| | | || | Hpy166II |||| | | || | | FatI |||| | | || | | |CviAII |||| | | || | | || NlaIII |||| | | || | | || |SfeI* \\\\ \ \ \\ \ \ \\ \\ GATATACTAATCGCAGCCGACGTTGAGGGTGGACTTCATGCTGTAGATAGAAGAAATGGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTATATGATTAGCGTCGGCTGCAACTCCCACCTGAAGTACGACATCTATCTTCTTTACCA //// / // / / / // / |||| | || | | | |FatI SfeI* |||| | || | | | CviAII |||| | || | | NlaIII |||| | || | Hpy166II |||| | || BbvI |||| | |TspDTI |||| | MaeII |||| TaiI |||| SetI |||Hpy99I |||MnlI ||CviJI ||TseI |BisI BlsI D I L I A A D V E G G L H A V D R R N G I Y * S Q P T L R V D F M L * I E E M V Y T N R S R R * G W T S C C R * K K W S ----:----|----:----|----:----|----:----|----:----|----:----| S I S I A A S T S P P S * A T S L L F P L Y V L R L R R Q P H V E H Q L Y F F H I Y * D C G V N L T S K M S Y I S S I T ApoI SetI MboII TspEI | Hpy188I MnlI | NdeI TaqI | XmnI | | MnlI | SetI \ \ \ \ \ \ \ \ \ \ CATATCATATGGTCAATCGAACCAGAAAATTTTCAACCTCTGATAGAAATACAAGAACCT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTATAGTATACCAGTTAGCTTGGTCTTTTAAAAGTTGGAGACTATCTTTATGTTCTTGGA / / / / / / / / // MboII NdeI TaqI | | SetI | MnlI |SetI | TspEI Hpy188I MnlI | ApoI XmnI H I I W S I E P E N F Q P L I E I Q E P I S Y G Q S N Q K I F N L * * K Y K N L Y H M V N R T R K F S T S D R N T R T F ----:----|----:----|----:----|----:----|----:----|----:----| * I M H D I S G S F K * G R I S I C S G D Y * I T L R V L F N E V E S L F V L V M D Y P * D F W F I K L R Q Y F Y L F R AclI SetI MaeII SetI |Hin4II* | SetI |BccI TaqI || NdeI | TaiI TspDTI || PsrI HphI \ \\ \ \ \ \ \\ \ \ TCGAGGTTAGAAACATATGAAACGTTGATTATAGAACCTTTCGGTGATGGGAACATTTAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTCCAATCTTTGTATACTTTGCAACTAATATCTTGGAAAGCCACTACCCTTGTAAATG / / / / / / / / / / | Hin4II* | | MaeII | | | BccI HphI TaqI | | AclI | | PsrI SetI | TaiI | SetI | SetI TspDTI NdeI S R L E T Y E T L I I E P F G D G N I Y R G * K H M K R * L * N L S V M G T F T E V R N I * N V D Y R T F R * W E H L L ----:----|----:----|----:----|----:----|----:----|----:----| E L N S V Y S V N I I S G K P S P F M * K S T L F M H F T S * L V K R H H S C K R P * F C I F R Q N Y F R E T I P V N V PsrI | BsiYI* | | BccI BsgI MseI | | MaeIII |BbvI \ \ \ \ \\ TACTTTAACGCCCATCAAGGGTTACAAAAACTGCCTTTATCCATACGACAACTTGTATCA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAAATTGCGGGTAGTTCCCAATGTTTTTGACGGAAATAGGTATGCTGTTGAACATAGT / / / / / / / | | BsiYI* | MaeIII BsgI BbvI | PsrI BccI MseI Y F N A H Q G L Q K L P L S I R Q L V S T L T P I K G Y K N C L Y P Y D N L Y Q L * R P S R V T K T A F I H T T T C I N ----:----|----:----|----:----|----:----|----:----|----:----| * K L A W * P N C F S G K D M R C S T D S S * R G D L T V F V A K I W V V V Q I V K V G M L P * L F Q R * G Y S L K Y * AciI | TseI | NspBII* | |BisI | ||BlsI HinfI | ||CspCI MlyI | Hpy178III* | |||CviRI* PleI | | CspCI | |||| FauI TsoI SspI |MseI | | | TspEI \ \\\\ \ \ \ \\ \ \ \ \ ACTTCCCCGCTGCACTTGAAAACAAATATTGTGGTTAATGACTCTGGAAAAATTGTTGAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGGGGCGACGTGAACTTTTGTTTATAACACCAATTACTGAGACCTTTTTAACAACTT //// / / / // / // / / |||| | TsoI SspI || MseI || | TspEI |||| FauI |PleI || Hpy178III* |||CviRI* MlyI |CspCI |||TseI HinfI ||BisI |BlsI NspBII* CspCI AciI T S P L H L K T N I V V N D S G K I V E L P R C T * K Q I L W L M T L E K L L K F P A A L E N K Y C G * * L W K N C * R ----:----|----:----|----:----|----:----|----:----|----:----| V E G S C K F V F I T T L S E P F I T S L K G A A S S F L Y Q P * H S Q F F Q Q S G R Q V Q F C I N H N I V R S F N N F MboII |AccI |SetI ||Hpy166II ||| TspDTI ||| | MboI ||| | | DpnI ||| | | BsrI FatI ||| | | TspRI AflIII ||| | | |TaqI BspLU11I* ||| | | |ClaI AccI |CviAII ||| | | |BstKTI |BssNAI || NspI ||| | | || BinI* |Hpy166II || NlaIII \\\ \ \ \\ \ \\ \\ \ GATGAAAAGGTCTACACTGGATCGATGAGAACTATAATGTATACTATAAACATGTTGAAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTTTCCAGATGTGACCTAGCTACTCTTGATATTACATATGATATTTGTACAACTTA / / // / /// // / // / // | | || | ||| || BinI* |AccI | |BspLU11I* | | || | ||| |ClaI Hpy166II | |AflIII | | || | ||| |TaqI BssNAI | |FatI | | || | ||| MboI | CviAII | | || | ||DpnI NlaIII | | || | |BstKTI NspI | | || | BsrI | | || TspDTI | | |AccI | | Hpy166II | | TspRI | MboII SetI D E K V Y T G S M R T I M Y T I N M L N M K R S T L D R * E L * C I L * T C * M * K G L H W I D E N Y N V Y Y K H V E W ----:----|----:----|----:----|----:----|----:----|----:----| S S F T * V P D I L V I I Y V I F M N F L H F P R C Q I S S F * L T Y * L C T S I F L D V S S R H S S Y H I S Y V H Q I AsuI* AvaII Hpy188I |BmgT120I ||BssKI ||SexAI ||EcoRII ||| ScrFI Hpy178III* ||| BseBI TstI | NlaIV PflMI TspEI HphI ||| |SetI BsaXI | |CviJI BsiYI* \ \ \\\ \\ \ \ \\ \ GGTGAAATTATATCAGCGTTCGGACCTGGTTCAAAAAACGGGTATTTCGGGAGCCAGAGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTTTAATATAGTCGCAAGCCTGGACCAAGTTTTTTGCCCATAAAGCCCTCGGTCTCA / / / /// / / / / / // / | HphI | ||| | EcoRII | BsaXI | || BsiYI* TspEI | ||| | SexAI TstI | || PflMI | ||| | BssKI | |CviJI | ||| BseBI | NlaIV | ||| ScrFI Hpy178III* | ||AvaII | ||AsuI* | |BmgT120I | SetI Hpy188I G E I I S A F G P G S K N G Y F G S Q S V K L Y Q R S D L V Q K T G I S G A R V * N Y I S V R T W F K K R V F R E P E C ----:----|----:----|----:----|----:----|----:----|----:----| P S I I D A N P G P E F F P Y K P L W L H H F * I L T R V Q N L F R T N R S G S T F N Y * R E S R T * F V P I E P A L T HphI | BseMII | |BspCNI | || MnlI | || | BsaXI | || | | DdeI | || | | TstI | || | | SauI* | || | | |SetI BseRI | || | | ||Eco57I | MboII | || | | ||Eco57MI | |Hpy178III* \ \\ \ \ \\\ \ \\ GTGGATTGCTCACCTGAGGAGAAGATAAAACTTCAGGAATGTGAAAATATGATTGTAATA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTAACGAGTGGACTCCTCTTCTATTTTGAAGTCCTTACACTTTTATACTAACATTAT / // // / / / / / / | || || | | SauI* | | Hpy178III* | || || | | DdeI | MboII | || || | Eco57MI BseRI | || || | Eco57I | || || SetI | || |BsaXI | || |TstI | || MnlI | |BspCNI | BseMII HphI V D C S P E E K I K L Q E C E N M I V I W I A H L R R R * N F R N V K I * L * * G L L T * G E D K T S G M * K Y D C N R ----:----|----:----|----:----|----:----|----:----|----:----| T S Q E G S S F I F S * S H S F I I T I H P N S V Q P S S L V E P I H F Y S Q L H I A * R L L L Y F K L F T F I H N Y Y AluI BseYI CviJI | SetI | | GsaI Cac8I | | |ApoI | AluI | | |TspEI BccI | CviJI MaeIII | | |EcoRI |MslI | | SetI Tsp45I \ \ \\ \\ \ \ \ \ GGCAAAACTATTTTTGAGCTGGGAATTCACTCTTATGATGGAGCAAGCTACAATGTCACT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTTTTGATAAAAACTCGACCCTTAAGTGAGAATACTACCTCGTTCGATGTTACAGTGA / / / / / / / / | | | | MslI | CviJI Tsp45I | | | | BccI | AluI MaeIII | | | EcoRI Cac8I | | | TspEI SetI | | | ApoI | | BseYI | CviJI | AluI | GsaI SetI G K T I F E L G I H S Y D G A S Y N V T A K L F L S W E F T L M M E Q A T M S L Q N Y F * A G N S L L * W S K L Q C H L ----:----|----:----|----:----|----:----|----:----|----:----| P L V I K S S P I * E * S P A L * L T V L C F * K Q A P F E S K H H L L S C H * A F S N K L Q S N V R I I S C A V I D S MaeI FatI | Hin6I |CviAII | |GlaI || NlaIII | |Eco47III || |TseI BbvI | ||HhaI || ||BisI | Eco57I | |||HaeII || |||BlsI | Eco57MI | |||| Hpy188I TstI \\ \\\\ \ \ \ \\\\ \ \ TACTCTACATGGCAGCAAAATGTTTTAGATGTTCCCCTAGCGCTTCAGAATACATTTTCA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAGATGTACCGTCGTTTTACAAAATCTACAAGGGGATCGCGAAGTCTTATGTAAAAGT / // /// / / //// / / | || ||TseI | BbvI |||| | TstI | || |BisI Eco57MI |||| Hpy188I | || BlsI Eco57I |||Hin6I | |FatI ||Eco47III | CviAII ||GlaI NlaIII |HhaI HaeII MaeI Y S T W Q Q N V L D V P L A L Q N T F S T L H G S K M F * M F P * R F R I H F Q L Y M A A K C F R C S P S A S E Y I F K ----:----|----:----|----:----|----:----|----:----|----:----| * E V H C C F T K S T G R A S * F V N E K S * M A A F H K L H E G L A E S Y M K V R C P L L I N * I N G * R K L I C K * FatI |CviAII || NspI || NlaIII || | CviRI* || | | TspGWI || | | | Hin6I BsrDI || | | | |GlaI | NheI || | | | ||HhaI | |MaeI || | | | ||BceAI | ||Cac8I || | | | |||HaeII | ||| BmtI || | | | |||| TstI | ||| | Cac8I \\ \ \ \ \\\\ \ \ \\\ \ \ AAGGACGGCATGTGCATAGCGCCTTTCCGTGATAAATCATTGCTAGCAAGCGATTTAGAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTGCCGTACACGTATCGCGGAAAGGCACTATTTAGTAACGATCGTTCGCTAAATCTA / // / ////// / / /// / | || | |||||BceAI BsrDI | ||| Cac8I | || | ||||TstI | ||NheI | || | |||Hin6I | |MaeI | || | ||GlaI | Cac8I | || | |HhaI BmtI | || | HaeII | || CviRI* | || TspGWI | |FatI | CviAII NlaIII NspI K D G M C I A P F R D K S L L A S D L D R T A C A * R L S V I N H C * Q A I * I G R H V H S A F P * * I I A S K R F R F ----:----|----:----|----:----|----:----|----:----|----:----| F S P M H M A G K R S L D N S A L S K S L P R C T C L A K G H Y I M A L L R N L L V A H A Y R R E T I F * Q * C A I * I Hpy188I | BssKI | SecI* | | HpaII TspEI | | ScrFI MmeI | BccI | | CauII* | CviJI | | MaeI | | | TspEI | | TaqI \ \ \ \ \ \ \ \ \ \ TTTAGAATTGCTAGATGGGTTTCTCCGACATTCCCCGGAATTATTGTTGGGCTTTTCGAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AAATCTTAACGATCTACCCAAAGAGGCTGTAAGGGGCCTTAATAACAACCCGAAAAGCTA / / / /// / / / / | MaeI Hpy188I ||| | | CviJI TaqI TspEI ||| | MmeI BccI ||| TspEI ||BssKI |SecI* |HpaII CauII* ScrFI F R I A R W V S P T F P G I I V G L F D L E L L D G F L R H S P E L L L G F S M * N C * M G F S D I P R N Y C W A F R C ----:----|----:----|----:----|----:----|----:----|----:----| K L I A L H T E G V N G P I I T P S K S N * F Q * I P K E S M G R F * Q Q A K R K S N S S P N R R C E G S N N N P K E I Acc65I HgiCI* |Csp6I MseI ||RsaI |SfaNI ||BsrI || BssKI MseI ||NlaIV || EcoRII | MboI ||TspDTI || | ScrFI | | DpnI ||| AciI || | BseBI | | |BstKTI ||| KpnI || | | MboI | | || AciI FokI ||| | BseGI || | | BclI \ \ \\ \ \ \\\ \ \ \\ \ \ \ GTGTTTAATGATCTCCGCACCAATGAAAATATACTGGTACCGCATCCCTTTAATCCTGGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CACAAATTACTAGAGGCGTGGTTACTTTTATATGACCATGGCGTAGGGAAATTAGGACCA / // / / / / /// / / / / / | || | AciI | | ||| AciI | | | EcoRII | || MboI | | ||HgiCI* | | | BssKI | |DpnI | | ||Acc65I | | BseBI | BstKTI | | ||BseGI | | ScrFI MseI | | |Csp6I | SfaNI | | NlaIV MseI | | RsaI | TspDTI | BsrI | KpnI FokI V F N D L R T N E N I L V P H P F N P G C L M I S A P M K I Y W Y R I P L I L V V * * S P H Q * K Y T G T A S L * S W * ----:----|----:----|----:----|----:----|----:----|----:----| T N L S R R V L S F I S T G C G K L G P H T * H D G C W H F Y V P V A D R * D Q H K I I E A G I F I Y Q Y R M G K I R T DpnI Hpy166II |FatI | MboI |BspHI | | DpnI |BstKTI | | |BstKTI SetI ||CviAII | | || Hpy188I | BssKI ||Hpy178III* TaqI | | || | BinI* | EcoRII ||| NlaIII | MaeIII | | || | | TaqI | | ScrFI ||| | HphI | |TspDTI | | || | | AsuII | | BseBI \\\ \ \ \ \\ \ \ \\ \ \ \ \ \ \ GATCATGAAAGTATATCGAGTAACAAAGTTTACTTGGATCAGACTTCGAACCTCTCCTGG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGTACTTTCATATAGCTCATTGTTTCAAATGAACCTAGTCTGAAGCTTGGAGAGGACC //// // / / / / // / / // / / |||| || HphI | | | || | | |SetI | EcoRII |||| |BspHI | | | || | | AsuII | BssKI |||| |FatI | | | || | | TaqI | MnlI |||| Hpy178III* | | | || | BinI* BseBI |||| CviAII | | | || Hpy188I ScrFI |||BclI | | | || MboI |||MboI | | | |DpnI ||NlaIII | | | BstKTI |DpnI | | Hpy166II BstKTI | MaeIII TspDTI TaqI D H E S I S S N K V Y L D Q T S N L S W I M K V Y R V T K F T W I R L R T S P G S * K Y I E * Q S L L G S D F E P L L V ----:----|----:----|----:----|----:----|----:----|----:----| S * S L I D L L L T * K S * V E F R E Q H D H F Y I S Y C L K S P D S K S G R R I M F T Y R T V F N V Q I L S R V E G P AluI BccI CviJI Hpy188I | TaqI | FalI MnlI |ApoI | | TfiI | FalI Hpy178III* | CviRI* MaeI |TspEI | | HinfI | SetI | MmeI \ \ \ \\ \ \ \ \ \ \ \ TTTGCATTATCTAGTCAGAATTTTCCATCTTTAGTCGAATCAGCTCCCATATCAAGATAC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGTAATAGATCAGTCTTAAAAGGTAGAAATCAGCTTAGTCGAGGGTATAGTTCTATG / / / / / / // / / / CviRI* | | TspEI | | || CviJI | Hpy178III* | | ApoI | | || AluI MmeI | Hpy188I | | |SetI MaeI | | HinfI | | TfiI | | FalI | | FalI | TaqI BccI F A L S S Q N F P S L V E S A P I S R Y L H Y L V R I F H L * S N Q L P Y Q D T C I I * S E F S I F S R I S S H I K I R ----:----|----:----|----:----|----:----|----:----|----:----| N A N D L * F K G D K T S D A G M D L Y T Q M I * D S N E M K L R I L E W I L I K C * R T L I K W R * D F * S G Y * S V BsrI | MaeIII | Tsp45I | | MnlI | | |TspRI | | ||Tsp4CI* | | ||| FalI | | ||| FalI | | ||| MboII MboII | | ||| BbvII* | Hpy178III* | | ||| |BsiYI* TspEI BsmAI | | TaqII \ \ \\\ \\ \ \ \ \ \ GCTTCCAGTGACCGTTGGAGGGTGTCTTCAATTTTTGAAGATGAGACTTTATTCAAGAAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGGTCACTGGCAACCTCCCACAGAAGTTAAAAACTTCTACTCTGAAATAAGTTCTTG / / / // / / / / / TspRI | | || BbvII* TspEI BsmAI MboII Hpy178III* BsrI | | |MboII TaqII | | BsiYI* | Tsp4CI* | Tsp45I | MaeIII | FalI | FalI MnlI A S S D R W R V S S I F E D E T L F K N L P V T V G G C L Q F L K M R L Y S R T F Q * P L E G V F N F * R * D F I Q E R ----:----|----:----|----:----|----:----|----:----|----:----| A E L S R Q L T D E I K S S S V K N L F R K W H G N S P T K L K Q L H S K I * S S G T V T P P H R * N K F I L S * E L V MboI BclI | DpnI TspDTI | |BstKTI |FatI Hpy188I | || SetI ||CviAII | BdaI | || MslI BdaI ||| NlaIII | BdaI HphI | || TspDTI BdaI \\\ \ \ \ \ \ \\ \ \ GCAATCATGGGTGTTCATCAGATATATAATAATGAATATGATCACCTTTATGAAAACTAT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTAGTACCCACAAGTAGTCTATATATTATTACTTATACTAGTGGAAATACTTTTGATA / / // // / // / / / / | | |FatI |BdaI HphI || | | MslI BdaI | | CviAII |BdaI || | TspDTI BdaI | NlaIII Hpy188I || BclI TspDTI || MboI || SetI |DpnI BstKTI A I M G V H Q I Y N N E Y D H L Y E N Y Q S W V F I R Y I I M N M I T F M K T M N H G C S S D I * * * I * S P L * K L * ----:----|----:----|----:----|----:----|----:----|----:----| A I M P T * * I Y L L S Y S * R * S F * R L * P H E D S I Y Y H I H D G K H F S C D H T N M L Y I I I F I I V K I F V I SetI | Hpy188I | | TspGWI | | | MnlI | | | | TfiI TspDTI TspDTI | | | | HinfI \ \ \ \ \ \ \ GAAAAAACGAATAGTTTGGACACTACGCACAAATATCCACCTCTGATGATTGATTCGTCC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTTGCTTATCAAACCTGTGATGCGTGTTTATAGGTGGAGACTACTAACTAAGCAGG / / / / / / / TspDTI TspDTI SetI | | MnlI HinfI | TspGWI TfiI Hpy188I E K T N S L D T T H K Y P P L M I D S S K K R I V W T L R T N I H L * * L I R P K N E * F G H Y A Q I S T S D D * F V R ----:----|----:----|----:----|----:----|----:----|----:----| S F V F L K S V V C L Y G G R I I S E D H F F S Y N P C * A C I D V E S S Q N T F F R I T Q V S R V F I W R Q H N I R G TspDTI |HphI || FatI || AflIII || BspLU11I* || |CviAII || || MaeIII ApoI || || Tsp45I TspEI || || |NspI BsaBI Hpy188I EcoRI || || |NlaIII \ \ \ \\ \\ \\ GTTGATACAACCGATTTACATCAGAATAACGAGATGAATTCACTAAAGGAATACATGTCA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTATGTTGGCTAAATGTAGTCTTATTGCTCTACTTAAGTGATTTCCTTATGTACAGT / / / / / / // | Hpy188I EcoRI | | | |BspLU11I* BsaBI TspEI | | | |AflIII ApoI | | | |FatI | | | CviAII | | NlaIII | | NspI | HphI TspDTI V D T T D L H Q N N E M N S L K E Y M S L I Q P I Y I R I T R * I H * R N T C H * Y N R F T S E * R D E F T K G I H V T ----:----|----:----|----:----|----:----|----:----|----:----| T S V V S K C * F L S I F E S F S Y M D R Q Y L R N V D S Y R S S N V L P I C T N I C G I * M L I V L H I * * L F V H * MnlI | SmlI | |SetI Hin4I TaqI | |BbvII* | Bce83I* |Hpy178III* | || MboII | | BsiI* || TspEI Hin4I \ \\ \ \ \ \ \\ \ \ CCAGAAGACCTTGAGGCATATAGAAAAAAGATACACGAGCAAATATCGAGAGAATTAGAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTTCTGGAACTCCGTATATCTTTTTTCTATGTGCTCGTTTATAGCTCTCTTAATCTA / / / // / / / // // | | SetI |BbvII* Hin4I Bce83I* BsiI* || |TspEI | MnlI |MboII || Hin4I Tsp45I SmlI |Hpy178III* MaeIII TaqI P E D L E A Y R K K I H E Q I S R E L D Q K T L R H I E K R Y T S K Y R E N * M R R P * G I * K K D T R A N I E R I R * ----:----|----:----|----:----|----:----|----:----|----:----| G S S R S A Y L F F I C S C I D L S N S V L L G Q P M Y F F S V R A F I S L I L W F V K L C I S F L Y V L L Y R S F * I Eco57I Eco57MI ApoI | TaqI TspEI | | TspEI | TspDTI MaeI | | | BsmAI \ \ \ \ \ \ \ GAAAAGAACCAAAATTCTTTGCTACTGAAGTTTGGAAGTCTAGTATATCGAATTATAGAG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCTTGGTTTTAAGAAACGATGACTTCAAACCTTCAGATCATATAGCTTAATATCTC / / / / / / / | TspEI | | | | BsmAI | ApoI | | | TspEI TspDTI | | TaqI | Eco57MI | Eco57I MaeI E K N Q N S L L L K F G S L V Y R I I E K R T K I L C Y * S L E V * Y I E L * R K E P K F F A T E V W K S S I S N Y R D ----:----|----:----|----:----|----:----|----:----|----:----| S F F W F E K S S F N P L R T Y R I I S H F S G F N K A V S T Q F D L I D F * L F L V L I R Q * Q L K S T * Y I S N Y L GsuI TfiI ApoI BsrI Eco57MI CviRI* HinfI TspEI \ \ \ \ \ ACTGGAGTATTTCTGTTGTTATTTCTCATTTTTTGTGCAATACTACAAAGATTCAAAATT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TGACCTCATAAAGACAACAATAAAGAGTAAAAAACACGTTATGATGTTTCTAAGTTTTAA / / / / / BsrI Eco57MI CviRI* HinfI TspEI GsuI TfiI ApoI T G V F L L L F L I F C A I L Q R F K I L E Y F C C Y F S F F V Q Y Y K D S K F W S I S V V I S H F L C N T T K I Q N F ----:----|----:----|----:----|----:----|----:----|----:----| V P T N R N N N R M K Q A I S C L N L I S Q L I E T T I E * K K H L V V F I * F S S Y K Q Q * K E N K T C Y * L S E F N AciI BisI |BlsI ||TauI TspEI Hin4I \\\ \ \ TTGCCGCCACTATATGTATTATTATCCAAAATTGGATTTATGCCTGAAAAGGAAATCCCC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AACGGCGGTGATATACATAATAATAGGTTTTAACCTAAATACGGACTTTTCCTTTAGGGG //// / / |||AciI TspEI Hin4I ||BisI |BlsI TauI L P P L Y V L L S K I G F M P E K E I P C R H Y M Y Y Y P K L D L C L K R K S P A A T I C I I I Q N W I Y A * K G N P H ----:----|----:----|----:----|----:----|----:----|----:----| K G G S Y T N N D L I P N I G S F S I G K A A V I H I I I W F Q I * A Q F P F G Q R W * I Y * * G F N S K H R F L F D G HinfI | TaqI Ksp632I* Hin4I | |BslFI TspEI | MnlI Hin4I | || PleI | MboII | Hpy188I | CviJI | || |MlyI | TspDTI Hin4I | | MaeIII | | TaqI \ \\ \\ \ \ \ \ \ \ \ \ \ ATAGTTGAGTCGAAATCGCTAAATTGTCCCTCTTCATCGGAAAATGTAACCAAGCCATTC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TATCAACTCAGCTTTAGCGATTTAACAGGGAGAAGTAGCCTTTTACATTGGTTCGGTAAG / / // // / // / / / | | |PleI || Hin4I || | | CviJI | | |MlyI || TspEI || | MaeIII | | BslFI |MboII || Hin4I | TaqI TspDTI || Hin4I HinfI |Ksp632I* Hpy188I MnlI I V E S K S L N C P S S S E N V T K P F * L S R N R * I V P L H R K M * P S H S S * V E I A K L S L F I G K C N Q A I R ----:----|----:----|----:----|----:----|----:----|----:----| M T S D F D S F Q G E E D S F T V L G N W L Q T S I A L N D R K M P F H L W A M Y N L R F R * I T G R * R F I Y G L W E TspDTI | Hin4I SetI | Hin4I | BccI TsoI | |Hin4II* | | Hpy166II \ \ \\ \ \ \ GATATGAAATCAGGGAAGCAAGTTGTTTTTGAAGGTGCTGTGAACGATGGAAGTCTAAAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CTATACTTTAGTCCCTTCGTTCAACAAAAACTTCCACGACACTTGCTACCTTCAGATTTT / / / / / // TsoI | | Hin4II* SetI |Hpy166II TaqI | Hin4I BccI | Hin4I TspDTI D M K S G K Q V V F E G A V N D G S L K I * N Q G S K L F L K V L * T M E V * N Y E I R E A S C F * R C C E R W K S K I ----:----|----:----|----:----|----:----|----:----|----:----| S I F D P F C T T K S P A T F S P L R F R Y S I L S A L Q K Q L H Q S R H F D L I H F * P L L N N K F T S H V I S T * F MboII |TspDTI || MaeI Hpy188I Hin4I || | TspDTI Hin4I | SfaNI Hin4I || | | MseI Hin4I \ \ \ \\ \ \ \ \ TCTGAAAAAGATAACGATGATGCTGATGAAGATGATGAAAAATCACTAGATTTAACCACA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTTTTTCTATTGCTACTACGACTACTTCTACTACTTTTTAGTGATCTAAATTGGTGT / / / / / / / Hpy188I SfaNI Hin4I TspDTI | | MseI Hin4I MboII | Hin4I | Hin4I TspDTI MaeI S E K D N D D A D E D D E K S L D L T T L K K I T M M L M K M M K N H * I * P Q * K R * R * C * * R * * K I T R F N H R ----:----|----:----|----:----|----:----|----:----|----:----| D S F S L S S A S S S S S F D S S K V V I Q F L Y R H H Q H L H H F I V L N L W R F F I V I I S I F I I F F * * I * G C MboII AloI | MboII | MwoI Ksp632I* | |MnlI | |AsuI* |MnlI | || SetI | ||BmgT120I ||AloI | || |MnlI | |||CviJI ||| TsoI | || |TaqI | |||BseRI ||| | MnlI | || ||Hpy178III* | |||HaeIII BsrDI \\\ \ \ \ \\ \\\ \ \\\\ \ GAAAAGAAGAAGAGGAAAAGAGGTTCGAGAGGAGGCAAAAAGGGCCGAAAATCACGCATT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCTTCTTCTCCTTTTCTCCAAGCTCTCCTCCGTTTTTCCCGGCTTTTAGTGCGTAA / / / / / // / // / / / // / | | | MnlI | || | || AloI | | |AsuI* BsrDI | | Ksp632I* | || | || | | BmgT120I | | TsoI | || | || | | HaeIII | MnlI | || | || | | CviJI AloI | || | || | BseRI | || | || MwoI | || | |Hpy178III* | || | TaqI | || MnlI | |MnlI | MboII | SetI MboII E K K K R K R G S R G G K K G R K S R I K R R R G K E V R E E A K R A E N H A L K E E E E K R F E R R Q K G P K I T H C ----:----|----:----|----:----|----:----|----:----|----:----| S F F F L F L P E L P P L F P R F D R M L F S S S S F L N S L L C F P G F I V C F L L L P F S T R S S A F L A S F * A N Hpy188I MseI | ApoI |AhaIII* | TspEI || ApoI | |BciVI CviRI* || TspEI | || TspDTI \ \\ \ \ \\ \ GCAAATATACCAAACTTTGAGCAATCTTTAAAAAATTTGGTAGTATCCGAAAAAATTTTA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTATATGGTTTGAAACTCGTTAGAAATTTTTTAAACCATCATAGGCTTTTTTAAAAT / // / / / / / CviRI* |MseI TspEI | | | SetI AhaIII* ApoI | | TspDTI | | TspEI | | ApoI | BciVI Hpy188I A N I P N F E Q S L K N L V V S E K I L Q I Y Q T L S N L * K I W * Y P K K F * K Y T K L * A I F K K F G S I R K N F R ----:----|----:----|----:----|----:----|----:----|----:----| A F I G F K S C D K F F K T T D S F I K Q L Y V L S Q A I K L F N P L I R F F K C I Y W V K L L R * F I Q Y Y G F F N * MaeIII | SetI SetI | | Tsp4CI* BbvII* | | | Hpy178III* | AciI | | | | Tsp4CI* | |MboII \ \ \ \ \ \ \\ GGTTACGGTTCATCAGGAACAGTAGTTTTTCAGGGAAGTTTTCAAGGAAGACCTGTTGCG 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CCAATGCCAAGTAGTCCTTGTCATCAAAAAGTCCCTTCAAAAGTTCCTTCTGGACAACGC / / / / / / Tsp4CI* | Tsp4CI* SetI | AciI MaeIII Hpy178III* BbvII* MboII G Y G S S G T V V F Q G S F Q G R P V A V T V H Q E Q * F F R E V F K E D L L R L R F I R N S S F S G K F S R K T C C G ----:----|----:----|----:----|----:----|----:----|----:----| P * P E D P V T T K * P L K * P L G T A L N R N M L F L L K E P F N E L F V Q Q T V T * * S C Y N K L S T K L S S R N R AluI CviJI MseI MaeIII | SetI |TspEI Tsp45I | |MseI \\ \ \ \\ GTAAAGAGAATGTTAATTGATTTTTGTGACATAGCTTTAATGGAAATAAAACTTTTGACT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CATTTCTCTTACAATTAACTAAAAACACTGTATCGAAATTACCTTTATTTTGAAAACTGA / / / / / / | TspEI | | | MseI MseI | | CviJI | | AluI | SetI Tsp45I MaeIII V K R M L I D F C D I A L M E I K L L T * R E C * L I F V T * L * W K * N F * L K E N V N * F L * H S F N G N K T F D * ----:----|----:----|----:----|----:----|----:----|----:----| T F L I N I S K Q S M A K I S I F S K V P L S F T L Q N K H C L K L P F L V K S Y L S H * N I K T V Y S * H F Y F K Q S MaeII MboI BtgZI BclI |BaeI | DpnI || SetI Tsp4CI* HphI | |BstKTI || TaiI | Hpy188I BaeI \ \ \\ \\ \ \ \ \ GAAAGCGATGATCACCCTAACGTCATACGATACTACTGTTCAGAAACAACAGACAGATTT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTCGCTACTAGTGGGATTGCAGTATGCTATGATGACAAGTCTTTGTTGTCTGTCTAAA / // / / / / / / / / HphI || | | | | BtgZI | Hpy188I BaeI || | | | MaeII Tsp4CI* || | | TaiI || | | SetI || | BaeI || BclI || MboI |DpnI BstKTI E S D D H P N V I R Y Y C S E T T D R F K A M I T L T S Y D T T V Q K Q Q T D F K R * S P * R H T I L L F R N N R Q I F ----:----|----:----|----:----|----:----|----:----|----:----| S L S S * G L T M R Y * Q E S V V S L N Q F R H D G * R * V I S S N L F L L C I F A I I V R V D Y S V V T * F C C V S K AluI CviJI Ecl136II | SetI SetI | SduI | Hpy178III* | SacI | | Hin4II* | HgiAI* | | | HinfI | HgiJII* | | | | DdeI | | CviRI* | | | | | PleI | | |TspEI | | | | | |MlyI \ \ \\ \ \ \ \ \ \\ TTGTATATTGCTTTAGAGCTCTGCAATTTGAACCTTCAAGATTTGGTGGAGTCTAAGAAT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AACATATAACGAAATCTCGAGACGTTAAACTTGGAAGTTCTAAACCACCTCAGATTCTTA / / / / / / / / / / | | | | SetI | Hin4II* | | PleI | | | TspEI Hpy178III* | | MlyI | | CviRI* | DdeI | Ecl136II HinfI | CviJI | AluI HgiJII* HgiAI* SacI SduI SetI L Y I A L E L C N L N L Q D L V E S K N C I L L * S S A I * T F K I W W S L R M V Y C F R A L Q F E P S R F G G V * E C ----:----|----:----|----:----|----:----|----:----|----:----| K Y I A K S S Q L K F R * S K T S D L F K T Y Q K L A R C N S G E L N P P T * S Q I N S * L E A I Q V K L I Q H L R L I SetI | TspEI BsmAI Hpy188I | | TspDTI TspEI | HgaI \ \ \ \ \ \ \ GTATCAGATGAAAACCTGAAATTACAGAAAGAGTATAATCCAATTTCGTTATTGAGACAA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CATAGTCTACTTTTGGACTTTAATGTCTTTCTCATATTAGGTTAAAGCAATAACTCTGTT / / / / / / / Hpy188I SetI | TspEI TspEI BsmAI HgaI TspDTI V S D E N L K L Q K E Y N P I S L L R Q Y Q M K T * N Y R K S I I Q F R Y * D K I R * K P E I T E R V * S N F V I E T N ----:----|----:----|----:----|----:----|----:----|----:----| T D S S F R F N C F S Y L G I E N N L C H I L H F G S I V S L T Y D L K T I S V Y * I F V Q F * L F L I I W N R * Q S L TaqI |Hpy178III* || BccI BssKI || | MseI |SecI* Hin4I || | |AhaIII* |HpaII Hin4I || | || CviJI ||ScrFI | MseI || | || | Hin4I ||CauII* | |AhaIII* || | || | Hin4I \\\ \ \\ \\ \ \\ \ \ ATAGCGTCCGGGGTAGCACATTTACATTCTTTAAAGATTATCCATCGAGATTTAAAGCCT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TATCGCAGGCCCCATCGTGTAAATGTAAGAAATTTCTAATAGGTAGCTCTAAATTTCGGA / / / // // / // / | BssKI Hin4I |MseI || | || CviJI | SecI* Hin4I AhaIII* || | |Hin4I CauII* || | |Hin4I HpaII || | |MseI ScrFI || | AhaIII* || BccI |Hpy178III* TaqI I A S G V A H L H S L K I I H R D L K P * R P G * H I Y I L * R L S I E I * S L S V R G S T F T F F K D Y P S R F K A S ----:----|----:----|----:----|----:----|----:----|----:----| I A D P T A C K C E K F I I W R S K F G F L T R P L V N V N K L S * G D L N L A Y R G P Y C M * M R * L N D M S I * L R SetI |Hpy166II || MboI SspI || | DpnI | MnlI TaqI || | |BstKTI MboII \ \ \ \\ \ \\ \ CAAAATATTCTCGTTTCTACTTCGAGTAGGTTTACTGCCGATCAGCAAACAGGAGCAGAA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTATAAGAGCAAAGATGAAGCTCATCCAAATGACGGCTAGTCGTTTGTCCTCGTCTT // / / / // / / |MnlI | SetI | || MboI MboII SspI TaqI | |DpnI | BstKTI Hpy166II Q N I L V S T S S R F T A D Q Q T G A E K I F S F L L R V G L L P I S K Q E Q K K Y S R F Y F E * V Y C R S A N R S R K ----:----|----:----|----:----|----:----|----:----|----:----| * F I R T E V E L L N V A S * C V P A S E F Y E R K * K S Y T * Q R D A F L L L L I N E N R S R T P K S G I L L C S C F CviRI* | MlyI | PleI | | MaeI XmnI | | | HinfI | TaqI | | | | MboII | AsuII EcoRV | | | | PshAI | | ApoI | Hpy188I | | | | TspDTI | | TspEI | | PshAI | | | | BbvII* \ \ \ \ \ \ \ \ \ \ \ AATCTTCGAATTTTGATATCAGACTTTGGTCTTTGCAAAAAACTAGACTCTGGTCAGTCT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGAAGCTTAAAACTATAGTCTGAAACCAGAAACGTTTTTTGATCTGAGACCAGTCAGA / / / / / / / // / /// / XmnI | | | | PshAI | || | ||| BbvII* | | | Hpy188I | || | ||PshAI | | EcoRV | || | |HinfI | TspEI | || | |MboII | ApoI | || | TspDTI AsuII | || MaeI TaqI | |PleI | MlyI CviRI* N L R I L I S D F G L C K K L D S G Q S I F E F * Y Q T L V F A K N * T L V S L S S N F D I R L W S L Q K T R L W S V F ----:----|----:----|----:----|----:----|----:----|----:----| F R R I K I D S K P R Q L F S S E P * D F D E F K S I L S Q D K C F V L S Q D T I K S N Q Y * V K T K A F F * V R T L R BbvI | AsuI* | DraII | Bsp120I | |AsuI* | |DraII | |BmgT120I | ||CviJI | ||NlaIV | ||HaeIII | ||BmgT120I | |||NlaIV | ||||ApaI | ||||SduI | ||||BseSI | ||||HgiJII* | ||||| TseI | ||||| AluI | ||||| CviJI | ||||| |BisI ApoI Hin4II* | ||||| ||BlsI TspEI MmeI | MnlI | ||||| ||SetI \ \ \ \ \ \\\\\ \\\ TCATTTAGAACAAATTTGAATAACCCTTCTGGCACAAGTGGTTGGAGGGCCCCAGAGCTG 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAAATCTTGTTTAAACTTATTGGGAAGACCGTGTTCACCAACCTCCCGGGGTCTCGAC / / / / ///// / //// | MmeI | MnlI ||||| | |||TseI TspEI Hin4II* ||||| | ||BisI ApoI ||||| | |BlsI ||||| | CviJI ||||| | AluI ||||| SetI ||||Bsp120I ||||DraII ||||AsuI* |||BmgT120I |||DraII |||AsuI* |||NlaIV ||BmgT120I ||HaeIII ||NlaIV ||CviJI |BbvI HgiJII* BseSI SduI ApaI S F R T N L N N P S G T S G W R A P E L H L E Q I * I T L L A Q V V G G P Q S C I * N K F E * P F W H K W L E G P R A A ----:----|----:----|----:----|----:----|----:----|----:----| E N L V F K F L G E P V L P Q L A G S S K M * F L N S Y G K Q C L H N S P G L A * K S C I Q I V R R A C T T P P G W L Q TspEI BtsI MaeI TfiI |MboII TspRI |Ksp632I* HinfI || CviRI* | TaqI MboII ||TspGWI TspDTI \ \\ \ \ \ \ \\\ \ CTTGAAGAATCAAACAATTTGCAGTGCCAAGTCGAAACGGAACACTCTTCTAGTAGGCAT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTTCTTAGTTTGTTAAACGTCACGGTTCAGCTTTGCCTTGTGAGAAGATCATCCGTA / / / / / / / / / / / | | | | BtsI | MboII | | | TspDTI | | | CviRI* TaqI | | Ksp632I* | | TspEI | MaeI | | TspRI TspGWI | MboII HinfI TfiI L E E S N N L Q C Q V E T E H S S S R H L K N Q T I C S A K S K R N T L L V G I * R I K Q F A V P S R N G T L F * * A Y ----:----|----:----|----:----|----:----|----:----|----:----| S S S D F L K C H W T S V S C E E L L C A Q L I L C N A T G L R F P V S K * Y A K F F * V I Q L A L D F R F V R R T P M Hpy188I |TfiI |HinfI || TspGWI || | BinI* || | | HphI || | | MboI MboI || | | | DpnI BglII || | | | |BstKTI XhoII || | | | || MnlI | DpnI || | | | || Hpy166II BsiYI* | BseRI Tsp4CI* || | | | || | MnlI | CviJI | |BstKTI \ \\ \ \ \ \\ \ \ \ \ \ \\ ACAGTAGTTTCATCTGATTCTTTTTATGATCCGTTCACCAAGAGGAGGCTAACAAGATCT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCATCAAAGTAGACTAAGAAAAATACTAGGCAAGTGGTTCTCCTCCGATTGTTCTAGA / / // / / // / // / / / /// / Tsp4CI* | || | | || | || | BsiYI* CviJI ||| XhoII | || | | || | || MnlI ||| BglII | || | | || | |Hpy166II ||| MboI | || | | || | MnlI ||DpnI | || | | || MboI |BstKTI | || | | |DpnI BseRI | || | | BstKTI | || | HphI | || BinI* | |HinfI | |TfiI | TspGWI Hpy188I T V V S S D S F Y D P F T K R R L T R S Q * F H L I L F M I R S P R G G * Q D L S S F I * F F L * S V H Q E E A N K I Y ----:----|----:----|----:----|----:----|----:----|----:----| V T T E D S E K * S G N V L L L S V L D Y L L K M Q N K K H D T * W S S A L L I C Y N * R I R K I I R E G L P P * C S R BseGI FokI FokI BseGI \ \ \ \ ATTGATATTTTTTCTATGGGATGTGTATTCTATTATATCCTATCCAAAGGGAAGCATCCA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTATAAAAAAGATACCCTACACATAAGATAATATAGGATAGGTTTCCCTTCGTAGGT / / / / BseGI FokI FokI BseGI I D I F S M G C V F Y Y I L S K G K H P L I F F L W D V Y S I I S Y P K G S I H * Y F F Y G M C I L L Y P I Q R E A S I ----:----|----:----|----:----|----:----|----:----|----:----| I S I K E I P H T N * * I R D L P F C G * Q Y K K * P I H I R N Y G I W L S A D N I N K R H S T Y E I I D * G F P L M W MaeII |PmaCI |BsaAI || SetI SfaNI SspI || TaiI MnlI SspI Hpy178III* \ \ \\ \ \ \ \ TTTGGAGATAAATATTCACGTGAAAGCAATATCATAAGAGGAATATTCAGTCTTGATGAA 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCTCTATTTATAAGTGCACTTTCGTTATAGTATTCTCCTTATAAGTCAGAACTACTT / / / // / / / SfaNI | | |MaeII MnlI SspI Hpy178III* | | BsaAI | | PmaCI | TaiI | SetI SspI F G D K Y S R E S N I I R G I F S L D E L E I N I H V K A I S * E E Y S V L M K W R * I F T * K Q Y H K R N I Q S * * N ----:----|----:----|----:----|----:----|----:----|----:----| N P S L Y E R S L L I M L P I N L R S S M Q L Y I N V H F C Y * L L F I * D Q H K S I F I * T F A I D Y S S Y E T K I F AccI |Hpy166II ||TspDTI |||FatI ||||CviAII |||||BinI* |||||| NlaIII |||||| TspDTI |||||| | MboI |||||| | XhoII |||||| | | DpnI |||||| | | |BstKTI |||||| | | || MseI |||||| | | || |TspEI |||||| | | || || CviRI* |||||| | | || || | Hin4I |||||| | | || || | | AluI |||||| | | || || | | CviJI |||||| | | || || | | |SfeI* |||||| | | || || | | ||SetI |||||| | | || || | | ||| MboI |||||| | | || || | | ||| BglII |||||| | | || || | | ||| XhoII |||||| | | || || | | ||| | DpnI |||||| | | || || | | ||| | |BstKTI |||||| | | || || | | ||| | || MboI |||||| | | || || | | ||| | || Hpy188I |||||| | | || || | | ||| | || | DpnI |||||| | | || || | | ||| | || | |BstKTI \\\\\\ \ \ \\ \\ \ \ \\\ \ \\ \ \\ ATGAAATGTCTACATGATAGATCCTTAATTGCAGAAGCTACAGATCTGATCTCCCAAATG 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTACAGATGTACTATCTAGGAATTAACGTCTTCGATGTCTAGACTAGAGGGTTTAC //// /// // / / /// / / /// / // / / |||| ||| || | | ||| | | ||| | || MboI TspGWI |||| ||| || | | ||| | | ||| | |DpnI |||| ||| || | | ||| | | ||| | BstKTI |||| ||| || | | ||| | | ||| Hpy188I |||| ||| || | | ||| | | ||| XhoII |||| ||| || | | ||| | | ||| BglII |||| ||| || | | ||| | | ||| MboI |||| ||| || | | ||| | | ||DpnI |||| ||| || | | ||| | | |BstKTI |||| ||| || | | ||| | | SfeI* |||| ||| || | | ||| | CviJI |||| ||| || | | ||| | AluI |||| ||| || | | ||| SetI |||| ||| || | | ||CviRI* |||| ||| || | | |TspEI |||| ||| || | | Hin4I |||| ||| || | MseI |||| ||| || XhoII |||| ||| || MboI |||| ||| |DpnI |||| ||| BstKTI |||| ||FatI |||| |CviAII |||| |BinI* |||| TspDTI |||NlaIII ||AccI |Hpy166II TspDTI M K C L H D R S L I A E A T D L I S Q M * N V Y M I D P * L Q K L Q I * S P K * E M S T * * I L N C R S Y R S D L P N D ----:----|----:----|----:----|----:----|----:----|----:----| I F H R C S L D K I A S A V S R I E W I F S I D V H Y I R L Q L L * L D S R G F H F T * M I S G * N C F S C I Q D G L H TspGWI |MboI |BclI ||BinI* |||DpnI ||||Hin4I ||||BstKTI |||||Hpy178III* ||||||BsaBI |||||||MboI |||||||| DpnI |||||||| |BstKTI TspGWI BseGI |||||||| || MseI SetI FokI | DdeI |TspDTI SfaNI \\\\\\\\ \\ \ \ \ \ \ \\ \ ATTGATCACGATCCGTTAAAAAGACCTACTGCTATGAAAGTTCTAAGGCATCCGTTGTTT 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTAGTGCTAGGCAATTTTTCTGGATGACGATACTTTCAAGATTCCGTAGGCAACAAA / // ///// / / / / // | || ||||| MboI MseI SetI TspGWI |TspDTI | || ||||DpnI FokI BseGI | || |||BstKTI DdeI | || ||Hpy178III* | || |BsaBI | || BclI | || MboI | |BinI* | |DpnI | BstKTI Hin4I I D H D P L K R P T A M K V L R H P L F L I T I R * K D L L L * K F * G I R C F * S R S V K K T Y C Y E S S K A S V V L ----:----|----:----|----:----|----:----|----:----|----:----| I S * S G N F L G V A I F T R L C G N N S Q D R D T L F V * Q * S L E L A D T T N I V I R * F S R S S H F N * P M R Q K CfrI | BalI | CviJI MseI CviJI BsmAI | HaeIII TaqI TspEI |AhaIII* | TspEI Eco31I \ \ \ \ \\ \ \ \ TGGCCAAAGTCGAAAAAATTGGAGTTCCTTTTAAAAGTTAGTGATAGGCTTGAAATTGAA 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| ACCGGTTTCAGCTTTTTTAACCTCAAGGAAAATTTTCAATCACTATCCGAACTTTAACTT / / / / / // / / | | CfrI TaqI TspEI |MseI CviJI TspEI | HaeIII AhaIII* | CviJI | BalI SfaNI W P K S K K L E F L L K V S D R L E I E G Q S R K N W S S F * K L V I G L K L K A K V E K I G V P F K S * * * A * N * K ----:----|----:----|----:----|----:----|----:----|----:----| Q G F D F F N S N R K F T L S L S S I S K A L T S F I P T G K L L * H Y A Q F Q P W L R F F Q L E K * F N T I P K F N F AcyI | Cfr10I MnlI | |HpaII |SduI | || TspDTI |BseSI ApoI | || | HgaI || MseI TspEI | || | | Hpy188I BfiI \\ \ \ \ \\ \ \ \ \ AACAGAGACCCTCCAAGTGCCCTGTTAATGAAATTTGACGCCGGTTCTGACTTTGTAATA 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTCTCTGGGAGGTTCACGGGACAATTACTTTAAACTGCGGCCAAGACTGAAACATTAT / / / / / // // / / / / Eco31I | MnlI MseI | || || | | BfiI TspRI BsmAI BseSI | || || | HgaI BsrI SduI | || || Hpy188I | || |Cfr10I | || HpaII | |TspDTI | AcyI TspEI ApoI N R D P P S A L L M K F D A G S D F V I T E T L Q V P C * * N L T P V L T L * Y Q R P S K C P V N E I * R R F * L C N T ----:----|----:----|----:----|----:----|----:----|----:----| F L S G G L A R N I F N S A P E S K T I F C L G E L H G T L S I Q R R N Q S Q L V S V R W T G Q * H F K V G T R V K Y Y FatI Csp6I |CviAII |RsaI BsrI TspRI Tsp4CI* TspDTI || NlaIII SetI |SetI \ \ \ \ \\ \ \ \\ CCCAGTGGAGATTGGACTGTCAAGTTTGATAAAACATTCATGGACAACCTTGAAAGGTAC 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTCACCTCTAACCTGACAGTTCAAACTATTTTGTAAGTACCTGTTGGAACTTTCCATG / / / // / / /// Tsp4CI* TspDTI | || SetI | ||TspDTI | |FatI | |Csp6I | CviAII | RsaI NlaIII SetI P S G D W T V K F D K T F M D N L E R Y P V E I G L S S L I K H S W T T L K G T Q W R L D C Q V * * N I H G Q P * K V Q ----:----|----:----|----:----|----:----|----:----|----:----| G L P S Q V T L N S L V N M S L R S L Y V W H L N S Q * T Q Y F M * P C G Q F T G T S I P S D L K I F C E H V V K F P V MboI XhoII | DpnI | |BstKTI SduI | || MseI HgiAI* TspDTI MseI | || |BinI* |DdeI \ \ \ \\ \\ \\ AGAAAATACCATTCATCAAAGTTAATGGATCTATTAAGAGCACTTAGGAATAAATATCAT 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTTATGGTAAGTAGTTTCAATTACCTAGATAATTCTCGTGAATCCTTATTTATAGTA / // / / / / | || | | HgiAI* DdeI | || | | SduI | || | BinI* | || | MseI | || XhoII | || MboI | |DpnI | BstKTI MseI R K Y H S S K L M D L L R A L R N K Y H E N T I H Q S * W I Y * E H L G I N I I K I P F I K V N G S I K S T * E * I S S ----:----|----:----|----:----|----:----|----:----|----:----| L F Y W E D F N I S R N L A S L F L Y * C F I G N M L T L P D I L L V * S Y I D S F V M * * L * H I * * S C K P I F I M Eco57I Eco57MI | AsuI* | |NlaIV | |BmgT120I | ||CviJI | ||Cfr10I | ||HaeIII | |||HpaII | |||| Acc65I | |||| HgiCI* | |||| |BccI | |||| |Csp6I | |||| ||RsaI | |||| ||NlaIV SetI MboII | |||| ||| KpnI \ \ \ \\\\ \\\ \ CATTTTATGGATTTACCTGAAGATATAGCAGAACTAATGGGGCCGGTACCCGATGGATTT 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAAATACCTAAATGGACTTCTATATCGTCTTGATTACCCCGGCCATGGGCTACCTAAA / / / /// ///// SetI MboII | ||| ||||HgiCI* | ||| ||||Acc65I | ||| |||Csp6I | ||| ||NlaIV | ||| ||RsaI | ||| ||BccI | ||| |Cfr10I | ||| HpaII | ||| KpnI | ||AsuI* | |BmgT120I | |HaeIII | |CviJI | NlaIV Eco57MI Eco57I H F M D L P E D I A E L M G P V P D G F I L W I Y L K I * Q N * W G R Y P M D F F Y G F T * R Y S R T N G A G T R W I L ----:----|----:----|----:----|----:----|----:----|----:----| * K I S K G S S I A S S I P G T G S P N D N * P N V Q L Y L L V L P A P V R H I M K H I * R F I Y C F * H P R Y G I S K SetI | MseI HphI | VspI SetI \ \ \ \ TACGATTACTTCACCAAGCGTTTTCCAAACCTATTAATAGGTGTTTATATGATTGTCAAG 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTAATGAAGTGGTTCGCAAAAGGTTTGGATAATTATCCACAAATATACTAACAGTTC / / / / HphI SetI | SetI VspI MseI Y D Y F T K R F P N L L I G V Y M I V K T I T S P S V F Q T Y * * V F I * L S R R L L H Q A F S K P I N R C L Y D C Q G ----:----|----:----|----:----|----:----|----:----|----:----| * S * K V L R K G F R N I P T * I I T L K R N S * W A N E L G I L L H K Y S Q * V I V E G L T K W V * * Y T N I H N D L ApoI TspEI | MseI | | MaeIII MaeII | | Tsp45I |BsaAI | | | MboI || SetI | | | | DpnI || TaiI | | | | |BstKTI || |ApoI | | | | || ApoI || |TspEI | | | | || TspEI || ||TspDTI \ \ \ \ \\ \ \\ \\\ GAAAATTTAAGTGACGATCAAATTTTACGTGAATTTTTGTATTCATAA 3310 3320 3330 3340 ----:----|----:----|----:----|----:----|----:--- CTTTTAAATTCACTGCTAGTTTAAAATGCACTTAAAAACATAAGTATT / / /// / / / /// / | MseI ||| MboI | | ||| TspEI TspEI ||DpnI | | ||| ApoI ApoI |BstKTI | | ||TspDTI Tsp45I | | |MaeII MaeIII | | BsaAI | TaiI | SetI TspEI ApoI E N L S D D Q I L R E F L Y S * K I * V T I K F Y V N F C I H X K F K * R S N F T * I F V F I X ----:----|----:----|----:----|----:----|----:--- S F K L S S * I K R S N K Y E Y P F N L H R D F K V H I K T N M F I * T V I L N * T F K Q I * L # Enzymes that cut Frequency Isoschizomers Acc65I 2 Asp718I AccI 4 FblI,XmiI AciI 6 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 3 AhaIII* 4 DraI AloI 1 AluI 9 AluBI ApaI 1 ApoI 14 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AsuII 3 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 4 BpiI,BpuAI,BstV2I,BbsI BccI 9 Bce83I* 2 BpuEI BceAI 1 BciVI 1 BfuI BclI 4 FbaI,Ksp22I BdaI 2 BfiI 1 BmrI,BmuI BglII 2 BinI* 6 AlwI,BspPI,AclWI BisI 7 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 7 BmgT120I 5 BmtI 1 BspOI BsaAI 2 BstBAI,Ppu21I BsaBI 2 Bse8I,BseJI BsaXI 1 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 5 BstF5I,BtsCI BseMII 3 BseRI 3 BseSI 2 BaeGI,BstSLI BseYI 1 BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI Bsp120I 1 PspOMI BspCNI 3 BspHI 1 CciI,PagI,RcaI BspLU11I* 3 PscI,PciI BsrDI 2 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 16 BtgZI 1 BtrI 1 BmgBI,AjiI BtsI 2 Cac8I 3 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CspCI 1 CviAII 11 CviJI 21 CviKI-1 CviRI* 9 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 16 MalI DraII 2 EcoO109I Ecl136II 1 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 5 AcuI Eco57MI 6 EcoP15I 1 EcoRI 2 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FalI 2 FatI 11 FauI 1 SmuI FokI 5 GlaI 2 GsaI 1 GsuI 1 BpmI HaeII 2 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 9 Hin4II* 5 HpyAV Hin6I 2 HinP1I,HspAI HinfI 10 HpaII 4 HapII,BsiSI,MspI HphI 9 AsuHPI Hpy166II 11 Hpy8I Hpy178III* 13 Hpy188III Hpy188I 19 Hpy99I 2 KpnI 2 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 8 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 9 MboI 16 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 18 MlyI 4 SchI MmeI 4 MnlI 21 MseI 18 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NdeI 2 FauNDI NheI 1 AsuNHI NlaIII 11 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 4 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 4 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PshAI 2 BstPAI,BoxI PsrI 1 RsaI 4 AfaI SacI 1 Psp124BI,SstI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 42 SexAI 1 MabI SfaNI 4 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 2 SmoI SspI 4 TaiI 7 TaqI 19 TaqII 1 TauI 2 TfiI 6 PfeI TseI 5 ApeKI TsoI 3 Tsp45I 5 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 30 TspEI 33 TasI,Tsp509I,Sse9I TspGWI 6 TspRI 6 TscAI TstI 2 VspI 1 PshBI,AseI XhoII 4 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AflII AgeI AjuI AlfI AlwNI ApaLI AscI AvaI AvrII BamHI BarI BbvCI BcgI BetI* BglI BmeT110I BplI Bpu10I BsePI BsmI Bsp1407I BspMI BspMII* BsrBI BstAPI BstEII BstXI Cfr9I DinI DraIII DrdI DsaI* Eam1105I EciI EcoNI EcoT22I EgeI EheI EspI* FnuDII* FseI FspAI HindII HindIII HpaI KasI MauBI McrI* MfeI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NmeAIII NotI NruI NsiI OliI PacI PasI PfoI PmeI PpiI PpuMI PsiI PspXI PstI PvuI PvuII RsrII SacII SalI SanDI SapI ScaI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TatI TspMI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769