Restriction Map of YHR056W-A



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YHR056W-A on chromosome VIII from coordinates 217406 to 217840.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.26656

TspDTI | Tsp4CI* | |Csp6I MnlI | ||RsaI | Hpy188I BseRI \ \\\ \ \ \ ATGAACATTACTACTAACGGTACTACTATTCTGACGAGGAGCAGTATTATTATTGGTGTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTGTAATGATGATTGCCATGATGATAAGACTGCTCCTCGTCATAATAATAACCACAA / / // / / / | | |Csp6I | Hpy188I BseRI | | RsaI MnlI | Tsp4CI* TspDTI M N I T T N G T T I L T R S S I I I G V * T L L L T V L L F * R G A V L L L V L E H Y Y * R Y Y Y S D E E Q Y Y Y W C Y ----:----|----:----|----:----|----:----|----:----|----:----| X F M V V L P V V I R V L L L I I I P T X S C * * * R Y * * E S S S C Y * * Q H H V N S S V T S S N Q R P A T N N N T N NheI AluI CviJI |MaeI ||SetI ||Cac8I ||| AciI ||| BmtI ||| |BisI ||| ||BlsI ||| ||BtgZI ||| |||TauI ||| |||CviJI ||| |||HaeIII ||| ||||StyI ||| ||||SecI* ||| ||||| AsuI* ||| ||||| AvaII ||| ||||| |BmgT120I ||| ||||| || BtsI ||| ||||| || Hpy166II ||| ||||| || | CviRI* SfaNI BsiYI* ||| ||||| || | | TspRI |MnlI |BciVI \\\ \\\\\ \\ \ \ \ \\ \\ ATTATTCTGGTAGCTAGCGGCCTTGGTCCACTGCATCGCAGTATCCACAGAGGGGTTGAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TAATAAGACCATCGATCGCCGGAACCAGGTGACGTAGCGTCATAGGTGTCTCCCCAACTT / / ////// / //// / / / / / | | |||||| | |||| CviRI* | | | BciVI | | |||||| | |||Hpy166II | | BsiYI* | | |||||| | |||AvaII | SfaNI | | |||||| | |||AsuI* MnlI | | |||||| | ||BmgT120I | | |||||| | |TspRI | | |||||| | |BtsI | | |||||| | SecI* | | |||||| | StyI | | |||||| BtgZI | | |||||HaeIII | | |||||CviJI | | ||||BisI | | ||||AciI | | |||BlsI | | ||NheI | | ||TauI | | |MaeI | | Cac8I | CviJI | AluI | BmtI SetI I I L V A S G L G P L H R S I H R G V E L F W * L A A L V H C I A V S T E G L N Y S G S * R P W S T A S Q Y P Q R G * T ----:----|----:----|----:----|----:----|----:----|----:----| I I R T A L P R P G S C R L I W L P T S * * E P L * R G Q D V A D C Y G C L P Q N N Q Y S A A K T W Q M A T D V S P N F TaqI | MaeII | |MnlI | ||Hpy99I | |||SetI | |||TaiI | |||| CviRI* TfiI BsmI | |||| | BciVI Hpy188I HinfI MaeII \ \ \\\\ \ \ \ \ \ CGAGAAGTTGAATGCCTCTATCGACGTTTGCATAATCGGATACTGCGTTTGAATCATTAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GCTCTTCAACTTACGGAGATAGCTGCAAACGTATTAGCCTATGACGCAAACTTAGTAATG / / // / // / / / BsmI | || | |BciVI Hpy188I | TaiI | || | CviRI* | SetI | || MaeII HinfI | |MnlI TfiI | TaqI | TaiI | SetI Hpy99I R E V E C L Y R R L H N R I L R L N H Y E K L N A S I D V C I I G Y C V * I I T R S * M P L S T F A * S D T A F E S L R ----:----|----:----|----:----|----:----|----:----|----:----| R S T S H R * R R K C L R I S R K F * * V L L Q I G R D V N A Y D S V A N S D N S F N F A E I S T Q M I P Y Q T Q I M V BceAI | NlaIV | | StyI | | SecI* | | | SetI | | | |CfrI | | | || BalI | | | || CviJI | | | || HaeIII | | | || |BsrDI SetI MmeI | | | || || FokI TaiI Hpy188I Tsp4CI* | | | || || | MslI \ \ \ \ \ \ \\ \\ \ \ GTTTTTCTGATTTACACCGTTTCCCTGACTAAAATGGTTGGAACCTTGGCCATTGCCGTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAAAGACTAAATGTGGCAAAGGGACTGATTTTACCAACCTTGGAACCGGTAACGGCAC / / // / // / / / MaeII Hpy188I |Tsp4CI* NlaIV || | | FokI MmeI BceAI || | MslI SetI || CfrI |HaeIII |CviJI |BalI SecI* BsrDI StyI V F L I Y T V S L T K M V G T L A I A V F F * F T P F P * L K W L E P W P L P C F S D L H R F P D * N G W N L G H C R A ----:----|----:----|----:----|----:----|----:----|----:----| T K R I * V T E R V L I T P V K A M A T R K E S K C R K G S * F P Q F R P W Q R N K Q N V G N G Q S F H N S G Q G N G H BssKI SexAI EcoRII Hpy166II |BccI | BseGI ||ScrFI | | PfoI ||BseBI | | BssKI ||| AsuI* | | | HpaII ||| AvaII | | | ScrFI HgaI ||| |BmgT120I | | | CauII* | SduI ||| || Hpy178III* | | | | MnlI | BseSI ||| ||SetI | BccI \ \ \ \ \ \ \ \\\ \\\ \ \ CGTGGACATCCCGGACGCAGAGGGCACAGCGACCATCTTACCAGGTCCATCTGGATAAAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GCACCTGTAGGGCCTGCGTCTCCCGTGTCGCTGGTAGAATGGTCCAGGTAGACCTATTTT / /// / / // /// / / | ||BssKI BseSI HgaI || ||AvaII | BccI | ||PfoI SduI || ||AsuI* Hpy178III* | |HpaII || |BmgT120I | CauII* || EcoRII | ScrFI || SexAI | MnlI || BssKI Hpy166II |BseBI BseGI |ScrFI BccI SetI R G H P G R R G H S D H L T R S I W I K V D I P D A E G T A T I L P G P S G * K W T S R T Q R A Q R P S Y Q V H L D K N ----:----|----:----|----:----|----:----|----:----|----:----| R P C G P R L P C L S W R V L D M Q I F A H V D R V C L A C R G D * W T W R S L T S M G S A S P V A V M K G P G D P Y F Tsp4CI* | HpaII TspEI | | CviJI | HgaI BsiYI* MboI \ \ \ \ \ \ \ ACAGTCCGGCTTGTTATACTTGACGCAATTCCCACATATCGGTTTTGCCCTGTCGCACCC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCAGGCCGAACAATATGAACTGCGTTAAGGGTGTATAGCCAAAACGGGACAGCGTGGG / // / // / | |CviJI | |HgaI MboII | HpaII | BsiYI* Tsp4CI* TspEI T V R L V I L D A I P T Y R F C P V A P Q S G L L Y L T Q F P H I G F A L S H P S P A C Y T * R N S H I S V L P C R T R ----:----|----:----|----:----|----:----|----:----|----:----| V T R S T I S S A I G V Y R N Q G T A G F L G A Q * V Q R L E W M D T K G Q R V C D P K N Y K V C N G C I P K A R D C G TaqII | Ksp632I* | | CviRI* | | | BsiYI* | | | | MwoI | | | | BstAPI | | | | | CviRI* | | | | | | Cac8I | | | | | | | Cac8I | | | | | | | | AciI | | | | | | | | |BisI MslI MboII | | | | | | | | ||BlsI |FatI |DpnI | | | | | | | | |||TauI |CviRI* ||BstKTI | | | | | | | | |||CviJI MnlI ||CviAII \\\ \ \ \ \ \ \ \ \ \\\\ \ \\\ GATCTTTCTCTTCCTGCATTGGGTGCAAGCAGGCGGCTTCCTCACTTTTCTCACTTGCAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGAAAGAGAAGGACGTAACCCACGTTCGTCCGCCGAAGGAGTGAAAAGAGTGAACGTA // / / // / / / / //// / // / || | TaqII || | | | | |||CviJI MnlI || CviAII || MboI || | | | | ||BisI |CviRI* |DpnI || | | | | ||AciI |NlaIII BstKTI || | | | | |BlsI |NspI || | | | | TauI MslI || | | | Cac8I || | | Cac8I || | CviRI* || BstAPI || MwoI |Ksp632I* BsiYI* CviRI* D L S L P A L G A S R R L P H F S H L H I F L F L H W V Q A G G F L T F L T C M S F S S C I G C K Q A A S S L F S L A C ----:----|----:----|----:----|----:----|----:----|----:----| S R E R G A N P A L L R S G * K E * K C R D K E E Q M P H L C A A E E S K E S A I K R K R C Q T C A P P K R V K R V Q M NspI NlaIII | FatI | BspHI | |CviAII | |Hpy178III* | || NlaIII | || |BccI | || ||MseI \ \\ \\\ GTCCATCATGATTAA 430 ----:----|----: CAGGTAGTACTAATT / / // / / FatI | || | MseI | || BccI | |BspHI | |FatI | Hpy178III* | CviAII NlaIII V H H D * S I M I X P S * L X ----:----|----: T W * S * H G D H N D M M I L # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AluI 1 AluBI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BccI 3 BceAI 1 BciVI 2 BfuI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 2 BmtI 1 BspOI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BsmI 1 BsaMI,Mva1269I,PctI BspHI 1 CciI,PagI,RcaI BsrDI 1 BseMI,Bse3DI BssKI 2 BstSCI,StyD4I BstAPI 1 BstKTI 1 BtgZI 1 BtsI 1 Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI Csp6I 1 CviQI,RsaNI CviAII 2 CviJI 5 CviKI-1 CviRI* 5 HpyCH4V DpnI 1 MalI EcoRII 1 AjnI,Psp6I,PspGI FatI 2 FokI 1 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HinfI 1 HpaII 2 HapII,BsiSI,MspI Hpy166II 2 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 3 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 1 MmeI 1 MnlI 5 MseI 1 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NheI 1 AsuNHI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PfoI 1 RsaI 1 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 5 SexAI 1 MabI SfaNI 1 LweI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 1 TaqII 1 TauI 2 TfiI 1 PfeI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 1 TasI,Tsp509I,Sse9I TspRI 1 TscAI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BaeI BamHI BarI BbvCI BbvI BbvII* Bce83I* BcgI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BplI Bpu10I BsaAI BsaBI BsaXI BseMII BsePI BseYI BsgI BsiI* BslFI BsmAI BsmFI Bsp120I Bsp1407I BspCNI BspLU11I* BspMI BspMII* BsrBI BsrI BssNAI Bst1107I BstEII BstXI BstZ17I BtrI Cfr10I Cfr9I ClaI CspCI DdeI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgiAI* HgiCI* HgiJII* HhaI Hin4I Hin4II* Hin6I HindII HindIII HinP1I HpaI HphI HspAI KasI KpnI MaeIII MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TatI TseI TsoI Tsp45I TspGWI TspMI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769