Restriction Map of GUT1/YHL032C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GUT1/YHL032C on chromosome VIII from coordinates 38508 to 36379.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.26717

EMBOSS_001 AclI MaeII MboI |MaeIII Hpy188I MnlI || SetI | DpnI |Hpy188I || TaiI | |BstKTI MboII |Ksp632I* || MmeI | || CviJI \ \\ \\ \ \ \\ \ ATGTTTCCCTCTCTCTTCCGACTTGTAGTATTCTCCAAACGTTACATATTCCGATCAAGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAAAGGGAGAGAGAAGGCTGAACATCATAAGAGGTTTGCAATGTATAAGGCTAGTTCG / // / / // / / // / / MboII || Ksp632I* | || | | || | CviJI |Hpy188I | || | | || MboI MnlI | || | | |DpnI | || | | BstKTI | || | Hpy188I | || MaeIII | |MaeII | |AclI | MmeI TaiI SetI M F P S L F R L V V F S K R Y I F R S S C F P L S S D L * Y S P N V T Y S D Q A V S L S L P T C S I L Q T L H I P I K P ----:----|----:----|----:----|----:----|----:----|----:----| X N G E R K R S T T N E L R * M N R D L X T E R E R G V Q L I R W V N C I G I L H K G R E E S K Y Y E G F T V Y E S * A Cac8I | Hin6I | |GlaI MseI | ||HhaI SpeI |BceAI | |||HaeII |MaeI |AhaIII* CviJI BstXI \ \\\\ \\ \\ \ \ CAGCGCCTTTACACTAGTTTAAAACAAGAACAGAGCCGTATGTCCAAAATAATGGAAGAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGCGGAAATGTGATCAAATTTTGTTCTTGTCTCGGCATACAGGTTTTATTACCTTCTA ///// // /// / / ||||Hin6I || ||BceAI CviJI BstXI |||GlaI || |MseI ||HhaI || AhaIII* |HaeII |SpeI Cac8I MaeI Q R L Y T S L K Q E Q S R M S K I M E D S A F T L V * N K N R A V C P K * W K I A P L H * F K T R T E P Y V Q N N G R F ----:----|----:----|----:----|----:----|----:----|----:----| W R R * V L K F C S C L R I D L I I S S G A G K C * N L V L V S G Y T W F L P L L A K V S T * F L F L A T H G F Y H F I MboII MaeIII Tsp45I SfaNI | Tth111I | SetI | |MaeII | BseGI | || SetI | | Hpy178III* | || TaiI FauI | | |MslI BslFI | || | AciI | BsrI FokI | | || MnlI \ \ \\ \ \ \ \ \ \ \ \\ \ TTACGAAGTGACTACGTCCCGCTTATCGCCAGTATTGATGTAGGAACGACCTCATCCAGA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AATGCTTCACTGATGCAGGGCGAATAGCGGTCATAACTACATCCTTGCTGGAGTAGGTCT // /// / / // / / / / //// |MboII ||| | AciI |FauI FokI | | | |||EcoT22I BslFI ||| MaeII BsrI | | | |||BsmI ||Tth111I | | | ||MnlI |TaiI | | | |Hpy178III* |SetI | | | MslI Tsp45I | | SfaNI MaeIII | BseGI SetI L R S D Y V P L I A S I D V G T T S S R Y E V T T S R L S P V L M * E R P H P D T K * L R P A Y R Q Y * C R N D L I Q M ----:----|----:----|----:----|----:----|----:----|----:----| K R L S * T G S I A L I S T P V V E D L N V F H S R G A * R W Y Q H L F S R M W * S T V V D R K D G T N I Y S R G * G S AsuI* |NlaIV |BmgT120I ||BssKI ||CviJI ||EcoRII ||HaeIII ||| ScrFI BsmI ||| BseBI CviRI* ||| | MaeII TspEI | EcoT22I ||| | | SetI Eco57I | | BccI ||| | | TaiI Eco57MI SspI \ \ \ \\\ \ \ \ \ \ TGCATTCTGTTCAACAGATGGGGCCAGGACGTTTCAAAACACCAAATTGAATATTCAACT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| ACGTAAGACAAGTTGTCTACCCCGGTCCTGCAAAGTTTTGTGGTTTAACTTATAAGTTGA / / /// / / / / / / CviRI* BccI ||| | | MaeII | | SspI ||| | EcoRII | TspEI ||| | BssKI Eco57MI ||| | TaiI Eco57I ||| | SetI ||| BseBI ||| ScrFI ||AsuI* |BmgT120I |HaeIII |CviJI NlaIV C I L F N R W G Q D V S K H Q I E Y S T A F C S T D G A R T F Q N T K L N I Q L H S V Q Q M G P G R F K T P N * I F N F ----:----|----:----|----:----|----:----|----:----|----:----| H M R N L L H P W S T E F C W I S Y E V I C E T * C I P G P R K L V G F Q I N L A N Q E V S P A L V N * F V L N F I * S SfeI* | CviJI | | MnlI CviJI | | BseYI HaeIII | | | AluI |BsmAI | | | GsaI |Eco31I | | | CviJI Hin4II* ||DdeI | | | |BsiI* | TaqI SfaNI ||SauI* | | | ||SetI \ \ \ \\\ \ \ \ \\\ TCAGCATCGAAGGGCAAGATTGGGGTGTCTGGCCTAAGGAGACCCTCTACAGCCCCAGCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCGTAGCTTCCCGTTCTAACCCCACAGACCGGATTCCTCTGGGAGATGTCGGGGTCGA / / / / / //// / / | TaqI SfaNI | Eco31I |||| | BseYI Hin4II* | SauI* |||| | CviJI | BsmAI |||| | AluI | DdeI |||| SetI HaeIII |||GsaI CviJI ||MnlI |CviJI SfeI* S A S K G K I G V S G L R R P S T A P A Q H R R A R L G C L A * G D P L Q P Q L S I E G Q D W G V W P K E T L Y S P S S ----:----|----:----|----:----|----:----|----:----|----:----| E A D F P L I P T D P R L L G E V A G A K L M S P C S Q P T Q G L S V R * L G L * C R L A L N P H R A * P S G R C G W S SgrAI FalI Cfr10I FalI BccI BsiYI* HphI Hin4II* |HpaII | AciI |SfeI* || MaeIII | NspBII* || CviRI* Hpy178III* || Tsp45I | | CviJI || | PstI \ \\ \ \ \ \ \\ \ \ CGTGAAACACCAAACGCCGGTGACATCAAAACCAGCGGAAAGCCCATCTTTTCTGCAGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GCACTTTGTGGTTTGCGGCCACTGTAGTTTTGGTCGCCTTTCGGGTAGAAAAGACGTCTT / / // / / / / / / / / / // | | || | | HphI | AciI CviJI | | | |FalI | | || | FalI NspBII* | | | |FalI | | || | FalI | | | SfeI* | | || Tsp45I | | CviRI* | | || MaeIII | BccI | | |Cfr10I | PstI | | |SgrAI Hin4II* | | HpaII | BsiYI* Hpy178III* BsiI* R E T P N A G D I K T S G K P I F S A E V K H Q T P V T S K P A E S P S F L Q K * N T K R R * H Q N Q R K A H L F C R R ----:----|----:----|----:----|----:----|----:----|----:----| R S V G F A P S M L V L P F G M K E A S E H F V L R R H C * F W R F A W R K Q L T F C W V G T V D F G A S L G D K R C F CviJI Hpy178III* |FalI | ApoI |FalI | TspEI MnlI TaqI TspEI \\ \ \ \ \ \ GGCTATGCCATTCAAGAAACCAAATTCCTAAAAATCGAGGAATTGGACTTGGACTTCCAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCGATACGGTAAGTTCTTTGGTTTAAGGATTTTTAGCTCCTTAACCTGAACCTGAAGGTA / / / / / / CviJI Hpy178III* | MnlI TaqI TspEI TspEI ApoI G Y A I Q E T K F L K I E E L D L D F H A M P F K K P N S * K S R N W T W T S I L C H S R N Q I P K N R G I G L G L P * ----:----|----:----|----:----|----:----|----:----|----:----| P * A M * S V L N R F I S S N S K S K W L S H W E L F W I G L F R P I P S P S G A I G N L F G F E * F D L F Q V Q V E M BssKI BsiYI* |HpaII |BsiYI* BseGI MaeII ||ScrFI | AciI | SetI ||CauII* | | BccI | TaiI ||| FokI | | | TspEI \ \ \\\ \ \ \ \ \ AACGAACCCACGTTGAAGTTCCCCAAACCGGGTTGGGTTGAGTGCCATCCGCAGAAATTA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTTGGGTGCAACTTCAAGGGGTTTGGCCCAACCCAACTCACGGTAGGCGTCTTTAAT / / // / / / / / / / | MaeII || | | FokI BseGI | BccI TspEI TaiI || | BssKI AciI SetI || CauII* || HpaII || ScrFI |BsiYI* BsiYI* N E P T L K F P K P G W V E C H P Q K L T N P R * S S P N R V G L S A I R R N Y R T H V E V P Q T G L G * V P S A E I T ----:----|----:----|----:----|----:----|----:----|----:----| L S G V N F N G L G P Q T S H W G C F N Y R V W T S T G W V P N P Q T G D A S I V F G R Q L E G F R T P N L A M R L F * BsrI |Hpy166II || MaeII || | SetI || | TaiI MwoI || | |Bce83I* |SfeI* || | ||Hpy99I || CviRI* || | ||| HphI SmlI MnlI || | PstI \\ \ \\\ \ \ \ \\ \ \ CTGGTGAACGTCGTCCAATGCCTTGCCTCAAGTTTGCTCTCTCTGCAGACTATCAACAGC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GACCACTTGCAGCAGGTTACGGAACGGAGTTCAAACGAGAGAGACGTCTGATAGTTGTCG / /// / / / / / / / / | ||| | HphI | | | | | SfeI* | ||| Bce83I* | | | | CviRI* | ||| MaeII | | | PstI | ||Hpy99I | | MwoI | |TaiI | MnlI | |SetI SmlI | Hpy166II BsrI L V N V V Q C L A S S L L S L Q T I N S W * T S S N A L P Q V C S L C R L S T A G E R R P M P C L K F A L S A D Y Q Q R ----:----|----:----|----:----|----:----|----:----|----:----| S T F T T W H R A E L K S E R C V I L L V P S R R G I G Q R L N A R E A S * * C Q H V D D L A K G * T Q E R Q L S D V A FatI MaeII Tsp4CI* CviRI* AflIII | BsmAI |CviAII FatI | SetI | Eco31I ||EcoT22I |CviAII | TaiI | | SetI SetI ||| NlaIII || NlaIII \ \ \ \ \ \ \\\ \ \\ \ GAACGTGTAGCAAACGGTCTCCCACCTTACAAGGTAATATGCATGGGTATAGCAAACATG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGCACATCGTTTGCCAGAGGGTGGAATGTTCCATTATACGTACCCATATCGTTTGTAC / / / / / / / / / // / // | | AflIII Tsp4CI* | | SetI | | |FatI | |FatI | MaeII | Eco31I | | CviAII | CviAII TaiI | BsmAI | CviRI* NlaIII SetI SetI | NlaIII EcoT22I E R V A N G L P P Y K V I C M G I A N M N V * Q T V S H L T R * Y A W V * Q T * T C S K R S P T L Q G N M H G Y S K H E ----:----|----:----|----:----|----:----|----:----|----:----| S R T A F P R G G * L T I H M P I A F M R V H L L R D G V K C P L I C P Y L L C F T Y C V T E W R V L Y Y A H T Y C V H AsuI* AvaII |BmgT120I ||NlaIV ||| AciI ||| | AciI MseI ||| | BisI |HpaI ||| | |BlsI |HindII BslFI ||| | ||TauI MfeI |Hpy166II | TspEI ||| | ||| FauI TspEI || Tsp4CI* \ \ \\\ \ \\\ \ \ \\ \ AGAGAAACCACAATTCTGTGGTCCCGCCGCACAGGAAAACCAATTGTTAACTACGGTATT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTTTGGTGTTAAGACACCAGGGCGGCGTGTCCTTTTGGTTAACAATTGATGCCATAA / / // //// / / // / | TspEI || |||| FauI | |MseI Tsp4CI* BslFI || |||AciI | Hpy166II || ||BisI | HindII || |BlsI | HpaI || AciI TspEI || TauI MfeI |AvaII |AsuI* BmgT120I NlaIV R E T T I L W S R R T G K P I V N Y G I E K P Q F C G P A A Q E N Q L L T T V L R N H N S V V P P H R K T N C * L R Y C ----:----|----:----|----:----|----:----|----:----|----:----| L S V V I R H D R R V P F G I T L * P I S L F W L E T T G G C L F V L Q * S R Y S F G C N Q P G A A C S F W N N V V T N MboI | DpnI | |BstKTI | || BsaBI | || | BsmAI HgaI MaeI TaqI \ \\ \ \ \ \ \ GTTTGGAACGACACCAGAACGATCAAAATCGTTAGAGACAAATGGCAAAACACTAGCGTC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CAAACCTTGCTGTGGTCTTGCTAGTTTTAGCAATCTCTGTTTACCGTTTTGTGATCGCAG // // / / // || |BsaBI BsmAI HgaI |Hpy99I || MboI MaeI |DpnI BstKTI V W N D T R T I K I V R D K W Q N T S V F G T T P E R S K S L E T N G K T L A S L E R H Q N D Q N R * R Q M A K H * R R ----:----|----:----|----:----|----:----|----:----|----:----| T Q F S V L V I L I T L S L H C F V L T Q K S R C W F S * F R * L C I A F C * R N P V V G S R D F D N S V F P L V S A D SfeI* | TseI | MwoI | CviRI* | |BisI | ||BlsI | ||PstI MaeII | |||AluI BbvII* |BsaAI | |||CviJI | BsrI || SetI | ||||DdeI | | MboII || TaiI Hpy99I | |||||SetI BbvI | | |BsrDI || | BbvI \ \ \\\\\\ \ \ \ \\ \\ \ \ GATAGGCAACTGCAGCTTAGACAGAAGACTGGATTGCCATTGCTCTCCACGTATTTCTCC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCCGTTGACGTCGAATCTGTCTTCTGACCTAACGGTAACGAGAGGTGCATAAAGAGG / // //// / / / / / // / TaqI || |||| DdeI | | BbvII* | |MaeII BbvI || |||CviJI | | MboII | BsaAI || |||TseI | | BsrDI TaiI || |||AluI | BsrI SetI || ||SfeI* BbvI || ||BisI || |BlsI || |SetI || CviRI* |PstI MwoI D R Q L Q L R Q K T G L P L L S T Y F S I G N C S L D R R L D C H C S P R I S P * A T A A * T E D W I A I A L H V F L L ----:----|----:----|----:----|----:----|----:----|----:----| S L C S C S L C F V P N G N S E V Y K E R Y A V A A * V S S Q I A M A R W T N R I P L Q L K S L L S S Q W Q E G R I E G TseI AluI CviJI Csp6I |BisI Hpy166II ||BlsI |RsaI ||SetI || StyI |||Hin6I || MnlI ||||GlaI NlaIV MnlI || SecI* |||||HhaI | TaqI | CviJI || | MnlI \\\\\\ \ \ \ \ \\ \ \ TGTTCCAAGCTGCGCTGGTTCCTCGACAATGAGCCTCTGTGTACCAAGGCGTATGAGGAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ACAAGGTTCGACGCGACCAAGGAGCTGTTACTCGGAGACACATGGTTCCGCATACTCCTC / ////// / / / / /// // | |||||| NlaIV TaqI | CviJI ||| |SecI* | |||||Hin6I MnlI ||| |StyI | ||||GlaI ||| MnlI | |||TseI ||Csp6I | |||HhaI ||MnlI | ||BisI |RsaI | |BlsI Hpy166II | CviJI | AluI SetI C S K L R W F L D N E P L C T K A Y E E V P S C A G S S T M S L C V P R R M R R F Q A A L V P R Q * A S V Y Q G V * G E ----:----|----:----|----:----|----:----|----:----|----:----| Q E L S R Q N R S L S G R H V L A Y S S R N W A A S T G R C H A E T Y W P T H P T G L Q A P E E V I L R Q T G L R I L L Tsp4CI* | TspRI | Hpy166II | | FatI | | |CviAII SetI | | || NlaIII TspEI | BseRI | | || |CviJI | MseI \ \ \ \ \\ \\ \ \ AACGACCTGATGTTCGGCACTGTGGACACATGGCTGATTTACCAATTAACTAAACAAAAG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTGGACTACAAGCCGTGACACCTGTGTACCGACTAAATGGTTAATTGATTTGTTTTC / / / / / / /// // | BseRI | | | | ||CviJI |MseI SetI | | | | |FatI TspEI | | | | CviAII | | | NlaIII | | Hpy166II | Tsp4CI* TspRI N D L M F G T V D T W L I Y Q L T K Q K T T * C S A L W T H G * F T N * L N K R R P D V R H C G H M A D L P I N * T K G ----:----|----:----|----:----|----:----|----:----|----:----| F S R I N P V T S V H S I * W N V L C F S R G S T R C Q P C M A S K G I L * V F V V Q H E A S H V C P Q N V L * S F L L Hpy188I | MaeII MseI | |MaeIII MnlI | || SetI Hpy178III* TspDTI | || TaiI | TsoI BsrI SetI |AhaIII* \ \\ \ \ \ \ \ \\ GCGTTCGTTTCTGACGTAACCAACGCTTCCAGAACTGGATTTATGAACCTCTCCACTTTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGCAAGCAAAGACTGCATTGGTTGCGAAGGTCTTGACCTAAATACTTGGAGAGGTGAAAT / / / / / / / // // | | | MaeIII | BsrI SetI || |MseI | | MaeII Hpy178III* || AhaIII* | TaiI TsoI |MnlI | SetI TspDTI Hpy188I A F V S D V T N A S R T G F M N L S T L R S F L T * P T L P E L D L * T S P L * V R F * R N Q R F Q N W I Y E P L H F K ----:----|----:----|----:----|----:----|----:----|----:----| A N T E S T V L A E L V P N I F R E V K P T R K Q R L W R K W F Q I * S G R W K R E N R V Y G V S G S S S K H V E G S * SetI |TfiI |HinfI || FatI || |CviAII Csp6I ApoI || || NspI |RsaI TspEI || || NlaIII \\ \ \\ \\ \ AAGTACGACAACGAGTTGCTGGAATTTTGGGGTATTGACAAGAACCTGATTCACATGCCC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTCATGCTGTTGCTCAACGACCTTAAAACCCCATAACTGTTCTTGGACTAAGTGTACGGG // / / / / // |Csp6I TspEI SetI | | |FatI RsaI ApoI | | CviAII | NlaIII | NspI HinfI TfiI K Y D N E L L E F W G I D K N L I H M P S T T T S C W N F G V L T R T * F T C P V R Q R V A G I L G Y * Q E P D S H A R ----:----|----:----|----:----|----:----|----:----|----:----| F Y S L S N S S N Q P I S L F R I * M G L T R C R T A P I K P Y Q C S G S E C A L V V V L Q Q F K P T N V L V Q N V H G MaeIII BsmI Tsp45I | HphI TspEI MnlI Tsp4CI* | | Hpy178III* \ \ \ \ \ \ GAAATTGTGTCCTCATCTCAATACTACGGTGACTTTGGCATTCCTGATTGGATAATGGAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTAACACAGGAGTAGAGTTATGATGCCACTGAAACCGTAAGGACTAACCTATTACCTT / / / / / / / TspEI MnlI | | | HphI Hpy178III* | | BsmI | Tsp45I | MaeIII Tsp4CI* E I V S S S Q Y Y G D F G I P D W I M E K L C P H L N T T V T L A F L I G * W K N C V L I S I L R * L W H S * L D N G K ----:----|----:----|----:----|----:----|----:----|----:----| S I T D E D * Y * P S K P M G S Q I I S R F Q T R M E I S R H S Q C E Q N S L P F N H G * R L V V T V K A N R I P Y H F Hin4I MboI |TatI BglII |Tsp4CI* XhoII AluI ||Csp6I | DpnI SetI CviJI TfiI |||RsaI | |BstKTI | Hin4I | SetI HinfI |||ScaI | ||MaeI Hpy178III* | | BspMI \ \ \ \\\\ \ \\\ \ \ \ \ AAGCTACACGATTCGCCAAAAACAGTACTGCGAGATCTAGTCAAGAGAAACCTGCCCATA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGATGTGCTAAGCGGTTTTTGTCATGACGCTCTAGATCAGTTCTCTTTGGACGGGTAT / / / / / /// // / / / // / | CviJI | | | ||TatI || | MaeI | |Hin4I BsiYI* | AluI | | | |Csp6I || XhoII | SetI SetI | | | ScaI || BglII Hpy178III* | | | RsaI || MboI | | Tsp4CI* |DpnI | Hin4I BstKTI HinfI TfiI K L H D S P K T V L R D L V K R N L P I S Y T I R Q K Q Y C E I * S R E T C P Y A T R F A K N S T A R S S Q E K P A H T ----:----|----:----|----:----|----:----|----:----|----:----| F S C S E G F V T S R S R T L L F R G M F A V R N A L F L V A L D L * S F G A W L * V I R W F C Y Q S I * D L S V Q G Y MwoI | Hin6I | |GlaI | ||HhaI | ||BseGI | ||| FatI | ||| NcoI | ||| StyI | ||| SecI* | ||| DsaI* | ||| |CviAII BssKI | ||| || NlaIII | HpaII BsiYI* MwoI | ||| || |SfaNI | ScrFI | CviJI |FokI | ||| || ||BsiYI* BbvI | CauII* \ \ \\ \ \\\ \\ \\\ \ \ \ CAGGGCTGTCTGGGCGACCAAAGCGCATCCATGGTGGGGCAACTCGCTTACAAACCCGGT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCCGACAGACCCGCTGGTTTCGCGTAGGTACCACCCCGTTGAGCGAATGTTTGGGCCA / / / // /// / // / / /// | | MwoI |MwoI ||| | || SfaNI BbvI ||BssKI | CviJI FokI ||| | |DsaI* |HpaII BspMI ||| | |SecI* CauII* ||| | |StyI ScrFI ||| | |NcoI ||| | |FatI ||| | BsiYI* ||| | CviAII ||| NlaIII ||Hin6I |GlaI BseGI HhaI Q G C L G D Q S A S M V G Q L A Y K P G R A V W A T K A H P W W G N S L T N P V G L S G R P K R I H G G A T R L Q T R C ----:----|----:----|----:----|----:----|----:----|----:----| C P Q R P S W L A D M T P C S A * L G P V P S D P R G F R M W P P A V R K C V R L A T Q A V L A C G H H P L E S V F G T Acc65I HgiCI* |Csp6I TseI ||RsaI |BisI ||NlaIV ||BlsI |||AgeI TatI AsuI* |||CviRI* |||BetI* Tsp4CI* AvaII |||| TatI |||Cfr10I Bsp1407I |NlaIV |||| |Csp6I ||||KpnI |Csp6I |BmgT120I |||| ||RsaI ||||HpaII ||RsaI || TspEI \\\\ \\\ \\\\\ \\\ \\ \ GCTGCAAAATGTACTTATGGTACCGGTTGCTTTTTACTGTACAATACGGGGACCAAAAAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGTTTTACATGAATACCATGGCCAACGAAAAATGACATGTTATGCCCCTGGTTTTTT /// /// / /// // / /// /// ||CviRI* ||TatI | ||| |Cfr10I | ||Bsp1407I ||AvaII ||TseI |Csp6I | ||| |BetI* | ||TatI ||AsuI* |BisI RsaI | ||| |AgeI | |Csp6I |BmgT120I BlsI | ||| HpaII | RsaI NlaIV | ||HgiCI* Tsp4CI* | ||Acc65I | |Csp6I | NlaIV | RsaI KpnI A A K C T Y G T G C F L L Y N T G T K K L Q N V L M V P V A F Y C T I R G P K N C K M Y L W Y R L L F T V Q Y G D Q K I ----:----|----:----|----:----|----:----|----:----|----:----| A A F H V * P V P Q K K S Y L V P V L F H Q L I Y K H Y R N S K V T C Y P S W F S C F T S I T G T A K * Q V I R P G F F FatI |CviAII || NlaIII || |Hin6I MboI || ||GlaI |BslFI || |||HhaI TspRI ||DpnI || |||| MlyI |HinfI CviRI* |||BstKTI || |||| PleI || MaeI NlaIV | Csp6I \\\\ \\ \\\\ \ \\ \ \ \ \ TTGATCTCCCAACATGGCGCACTGACGACTCTAGCATTTTGGTTCCCACATTTGCAAGAG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAGAGGGTTGTACCGCGTGACTGCTGAGATCGTAAAACCAAGGGTGTAAACGTTCTC /// // / ///// // / / / / ||| || | ||||| |PleI | MaeI NlaIV CviRI* ||| || | ||||| MlyI HinfI ||| || | ||||Hin6I ||| || | |||GlaI ||| || | ||TspRI ||| || | ||HhaI ||| || | |FatI ||| || | CviAII ||| || NlaIII ||| |BslFI ||| MboI ||DpnI |BstKTI TspEI L I S Q H G A L T T L A F W F P H L Q E * S P N M A H * R L * H F G S H I C K S D L P T W R T D D S S I L V P T F A R V ----:----|----:----|----:----|----:----|----:----|----:----| N I E W C P A S V V R A N Q N G C K C S I S R G V H R V S S E L M K T G V N A L Q D G L M A C Q R S * C K P E W M Q L L RsaI | Tsp4CI* | | CfrI | | | BalI MnlI | | | CviJI Cac8I |CviRI* | | | HaeIII TspEI | CviJI || TspGWI NlaIV Hpy99I \ \ \ \ \ \ \ \\ \ \ \ TACGGTGGCCAAAAACCAGAATTGAGCAAGCCACATTTTGCATTAGAGGGTTCCGTCGCT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCCACCGGTTTTTGGTCTTAACTCGTTCGGTGTAAAACGTAATCTCCCAAGGCAGCGA /// / / / / / / / / / ||| | CfrI | | CviJI | CviRI* | Hpy99I ||| HaeIII | Cac8I | TspGWI NlaIV ||| CviJI TspEI MnlI ||| BalI ||Tsp4CI* |Csp6I RsaI Y G G Q K P E L S K P H F A L E G S V A T V A K N Q N * A S H I L H * R V P S L R W P K T R I E Q A T F C I R G F R R C ----:----|----:----|----:----|----:----|----:----|----:----| Y P P W F G S N L L G C K A N S P E T A T R H G F V L I S C A V N Q M L P N R R V T A L F W F Q A L W M K C * L T G D S TsoI | AsuI* | AvaII | |BmgT120I MboI | || CviJI |MmeI | || | MaeII ||DpnI | || | |BsaAI |||TaqI | || | || SetI |||ClaI | || | || TaiI |||BstKTI CviJI | || | || | TspEI |||| MnlI Hpy188I \ \ \\ \ \\ \ \ \\\\ \ \ GTGGCTGGTGCTGTGGTCCAATGGCTACGTGATAATTTACGATTGATCGATAAATCAGAG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CACCGACCACGACACCAGGTTACCGATGCACTATTAAATGCTAACTAGCTATTTAGTCTC / / // / / // / / // /// / CviJI TsoI |AvaII | | |MaeII TspEI | || ||MnlI Hpy188I |AsuI* | | BsaAI | || |ClaI | | TaiI | || |TaqI | | SetI | || MboI | CviJI | |DpnI BmgT120I | BstKTI MmeI V A G A V V Q W L R D N L R L I D K S E W L V L W S N G Y V I I Y D * S I N Q R G W C C G P M A T * * F T I D R * I R G ----:----|----:----|----:----|----:----|----:----|----:----| T A P A T T W H S R S L K R N I S L D S Q P Q H Q P G I A V H Y N V I S R Y I L H S T S H D L P * T I I * S Q D I F * L TaqII BseGI Tsp4CI* |AsuI* |SfaNI |AvaII ||NlaIV |RsrII ||| Hpy178III* |Hpy188I ||| | TfiI ||BmgT120I ||| | HinfI ||| FokI ||| | | BsiYI* ||| | CviRI* ||| | | | BslFI AciI \\\ \ \ \\\ \ \ \ \ \ GATGTCGGACCGATTGCATCTACGGTTCCTGATTCTGGTGGCGTAGTTTTCGTCCCCGCA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTACAGCCTGGCTAACGTAGATGCCAAGGACTAAGACCACCGCATCAAAAGCAGGGGCGT / / // // // / /// / / / | | |RsrII |FokI || | ||| HinfI BslFI AciI | | |AvaII | || | ||| TfiI | | |AsuI* | || | ||BsiYI* | | | | || | |Hpy178III* | | | | || | SfaNI | | | | || NlaIV | | | | |Tsp4CI* | | | | TaqII | | | CviRI* | | BmgT120I | Hpy188I BseGI D V G P I A S T V P D S G G V V F V P A M S D R L H L R F L I L V A * F S S P H C R T D C I Y G S * F W W R S F R P R I ----:----|----:----|----:----|----:----|----:----|----:----| S T P G I A D V T G S E P P T T K T G A P H R V S Q M * P E Q N Q H R L K R G R I D S R N C R R N R I R T A Y N E D G C SfaNI | AsuI* | AvaII | DraII | PpuMI | SanDI | |NlaIV MslI CviJI | |BmgT120I BslFI | BstXI FauI HaeIII | ||NlaIV | CviJI | | BsiYI* \ \ \ \\\ \ \ \ \ \ TTTAGTGGCCTATTCGCTCCCTATTGGGACCCAGATGCCAGAGCCACCATAATGGGGATG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| AAATCACCGGATAAGCGAGGGATAACCCTGGGTCTACGGTCTCGGTGGTATTACCCCTAC / / /// // / // / | HaeIII ||SanDI || | |BsiYI* BseGI | CviJI ||PpuMI || | MslI FauI ||DraII || BstXI ||AvaII |BslFI ||AsuI* CviJI |BmgT120I |NlaIV NlaIV SfaNI F S G L F A P Y W D P D A R A T I M G M L V A Y S L P I G T Q M P E P P * W G C * W P I R S L L G P R C Q S H H N G D V ----:----|----:----|----:----|----:----|----:----|----:----| N L P R N A G * Q S G S A L A V M I P I M * H G I R E R N P G L H W L W W L P S K T A * E S G I P V W I G S G G Y H P H TseI AluI MwoI CviJI |BisI ||BlsI BseGI ||SetI | TspEI ||XcmI | |BsmAI BbvI |||Hin4II* | || FokI |BceAI ||||SecI* | || BtgZI || MnlI ||||DsaI* SetI \ \\ \ \\ \ \\\\\ \ TCTCAATTCACTACTGCCTCCCACATCGCCAGAGCTGCCGTGGAAGGTGTTTGCTTTCAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGTTAAGTGATGACGGAGGGTGTAGCGGTCTCGACGGCACCTTCCACAAACGAAAGTT // / /// // //// / / || BtgZI ||MnlI || |||TseI | SetI || FokI |BbvI || ||| DsaI* |BsmAI BceAI || ||| SecI* TspEI || ||Hin4II* || ||BisI || |XcmI || |BlsI || CviJI || AluI |SetI MwoI S Q F T T A S H I A R A A V E G V C F Q L N S L L P P T S P E L P W K V F A F K S I H Y C L P H R Q S C R G R C L L S S ----:----|----:----|----:----|----:----|----:----|----:----| D * N V V A E W M A L A A T S P T Q K * T E I * * Q R G C R W L Q R P L H K S E R L E S S G G V D G S S G H F T N A K L BssKI CviJI EcoRII BsrDI |SecI* | Hpy188I ||ScrFI | | MluI ||BseBI | | AflIII SetI ||| CviJI | | | FnuDII* NlaIV ||| | Hin4II* | | | | Hin4II* | HphI ||| | | Hpy178III* | | | | | HgaI | | BsiYI* \\\ \ \ \ \ \ \ \ \ \ \ \ \ GCCAGGGCTATCTTGAAGGCAATGAGTTCTGACGCGTTTGGTGAAGGTTCCAAAGACAGG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTCCCGATAGAACTTCCGTTACTCAAGACTGCGCAAACCACTTCCAAGGTTTCTGTCC / / /// / / / / / // / / / | | ||| | | | | Hin4II* || | | BsiYI* | | ||| | | | | AflIII || | HphI | | ||| | | | | MluI || NlaIV | | ||| | | | FnuDII* |HgaI | | ||| | | Hpy188I SetI | | ||| | BsrDI | | ||| Hpy178III* | | ||Hin4II* | | |CviJI | | EcoRII | | BssKI | | SecI* | BseBI | ScrFI CviJI A R A I L K A M S S D A F G E G S K D R P G L S * R Q * V L T R L V K V P K T G Q G Y L E G N E F * R V W * R F Q R Q G ----:----|----:----|----:----|----:----|----:----|----:----| A L A I K F A I L E S A N P S P E L S L L W P * R S P L S N Q R T Q H L N W L C G P S D Q L C H T R V R K T F T G F V P Hpy188I | AcyI | MaeII | |ZraI | |MaeIII | |Tsp45I | ||Hpy99I | |||SetI BslFI | |||TaiI |ApoI | |||AatII MmeI MnlI |TspEI | |||| NdeI | TspDTI BccI \ \\ \ \\\\ \ \ \ \ GACTTTTTAGAGGAAATTTCCGACGTCACATATGAAAAGTCGCCCCTGTCGGTTCTGGCA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAAAATCTCCTTTAAAGGCTGCAGTGTATACTTTTCAGCGGGGACAGCCAAGACCGT / // / / // / / / / / / MnlI || | | || | NdeI | TspDTI | BccI || | | || Tsp45I MmeI TspRI || | | || MaeIII || | | |MaeII || | | |AcyI || | | ZraI || | AatII || | TaiI || | SetI || Hpy188I || Hpy99I |TspEI |ApoI BslFI D F L E E I S D V T Y E K S P L S V L A T F * R K F P T S H M K S R P C R F W Q L F R G N F R R H I * K V A P V G S G S ----:----|----:----|----:----|----:----|----:----|----:----| S K K S S I E S T V Y S F D G R D T R A P S K L P F K R R * M H F T A G T P E P V K * L F N G V D C I F L R G Q R N Q C FatI |CviAII || CviRI* || NlaIII || | ApoI || | TspEI || | | TspDTI || | | | BslFI || | | | | CviJI || | | | | | EcoRV || | | | | | | DdeI || | | | | | | | AsuI* FauI || | | | | | | | AvaII | BtsI TaqI || | | | | | | | DraII | TspRI FokI || | | | | | | | PpuMI | | AciI |BseGI || | | | | | | | |BmgT120I | | |BseGI || SetI || | | | | | | | ||SetI | | || MnlI || | FokI || | | | | | | | ||NlaIV \ \ \\ \ \\ \ \ \\ \ \ \ \ \ \ \ \\\ GTGGATGGCGGGATGTCGAGGTCTAATGAAGTCATGCAAATTCAAGCCGATATCTTAGGT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTACCGCCCTACAGCTCCAGATTACTTCAGTACGTTTAAGTTCGGCTATAGAATCCA / / / / / / / / // / / / / / // / | | AciI | | FokI | | || | | | | | || BmgT120I | | MnlI | TaqI | | || | | | | | || NlaIV | BseGI | SetI | | || | | | | | |DdeI BtsI BseGI | | || | | | | | SetI FauI | | || | | | | EcoRV | | || | | | BslFI | | || | | CviJI | | || | TspEI | | || | ApoI | | || TspDTI | | |CviRI* | | |FatI | | CviAII | NlaIII FokI V D G G M S R S N E V M Q I Q A D I L G W M A G C R G L M K S C K F K P I S * V G W R D V E V * * S H A N S S R Y L R S ----:----|----:----|----:----|----:----|----:----|----:----| T S P P I D L D L S T M C I * A S I K P L P H R S T S T * H L * A F E L R Y R L H I A P H R P R I F D H L N L G I D * T Hin4II* BsiYI* | Hpy188I | MwoI | | SetI | MmeI | | | BsmAI | | TseI | | | Eco31I | | |BisI | | | Hpy188I | | ||BlsI | | | | AciI | | |||CviJI | | | | NspBII* | | ||||BsrDI | | | | | Csp6I | | ||||| AjuI | | | | | |RsaI | | ||||| MwoI | | | | | || AciI | | ||||| BstAPI \ \ \ \ \ \\ \ \ \ \\\\\ \ CCCTGTGTCAAAGTCAGAAGGTCTCCGACAGCGGAATGTACCGCATTGGGGGCAGCCATT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GGGACACAGTTTCAGTCTTCCAGAGGCTGTCGCCTTACATGGCGTAACCCCCGTCGGTAA / / / / / // / // // // /// / PpuMI | | SetI | || AciI || || |MmeI ||| MwoI DraII | Hpy188I | |NspBII* || || MwoI ||BstAPI AvaII Hin4II* | Eco31I || |BsiYI* ||CviJI AsuI* | BsmAI || AciI ||MwoI Hpy188I |Csp6I ||TseI RsaI |BsrDI |BisI BlsI AjuI P C V K V R R S P T A E C T A L G A A I P V S K S E G L R Q R N V P H W G Q P L L C Q S Q K V S D S G M Y R I G G S H C ----:----|----:----|----:----|----:----|----:----|----:----| G Q T L T L L D G V A S H V A N P A A M D R H * L * F T E S L P I Y R M P P L W G T D F D S P R R C R F T G C Q P C G N BseGI Hpy166II TseI | AjuI MwoI | | Hin6I AsuI* CviRI* | | |GlaI AvaII |BisI BglI | | |FokI DraII ||BlsI MwoI | | ||HhaI PpuMI |||BbvI | BbvI | | |||HaeII |BmgT120I |||CviJI | CviJI | | |||| Hin4II* || SetI \\\\ \ \ \ \ \\\\ \ \\ \ GCAGCCAATATGGCTTTCAAGGATGTGAACGAGCGCCCATTATGGAAGGACCTACACGAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCGGTTATACCGAAAGTTCCTACACTTGCTCGCGGGTAATACCTTCCTGGATGTGCTA //// // / / / / //// / /// |||| |BbvI | BbvI | | |||| Hin4II* ||PpuMI |||| MwoI CviJI | | |||| FokI ||DraII |||| BglI | | |||Hin6I ||AvaII |||CviJI | | ||GlaI ||AsuI* |||TseI | | |HhaI |BmgT120I ||BisI | | HaeII SetI |BlsI | Hpy166II CviRI* BseGI AjuI A A N M A F K D V N E R P L W K D L H D Q P I W L S R M * T S A H Y G R T Y T M S Q Y G F Q G C E R A P I M E G P T R C ----:----|----:----|----:----|----:----|----:----|----:----| A A L I A K L S T F S R G N H F S R C S Q L W Y P K * P H S R A G M I S P G V R C G I H S E L I H V L A W * P L V * V I FokI CviJI MseI HphI |MnlI | BseGI \ \ \\ \ \ GTTAAGAAATGGGTCTTTTACAATGGAATGGAGAAAAACGAACAAATATCACCAGAGGCT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTCTTTACCCAGAAAATGTTACCTTACCTCTTTTTGCTTGTTTATAGTGGTCTCCGA / / / / / MseI HphI | FokI CviJI MnlI BseGI V K K W V F Y N G M E K N E Q I S P E A L R N G S F T M E W R K T N K Y H Q R L * E M G L L Q W N G E K R T N I T R G S ----:----|----:----|----:----|----:----|----:----|----:----| T L F H T K * L P I S F F S C I D G S A H * S I P R K C H F P S F R V F I V L P N L F P D K V I S H L F V F L Y * W L S Hpy188I | SfaNI SmlI | |TfiI AflII | |HinfI |MseI | || Hpy188I |SetI | || | Hpy99I MmeI \\ \ \\ \ \ \ CATCCAAACCTTAAGATATTCAGAAGTGAATCCGACGATGCTGAAAGGAGAAAGCATTGG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| GTAGGTTTGGAATTCTATAAGTCTTCACTTAGGCTGCTACGACTTTCCTCTTTCGTAACC / // / // / SetI |AflII Hpy188I |Hpy188I MmeI |SmlI |Hpy99I MseI HinfI SfaNI TfiI H P N L K I F R S E S D D A E R R K H W I Q T L R Y S E V N P T M L K G E S I G S K P * D I Q K * I R R C * K E K A L E ----:----|----:----|----:----|----:----|----:----|----:----| * G F R L I N L L S D S S A S L L F C Q E D L G * S I * F H I R R H Q F S F A N M W V K L Y E S T F G V I S F P S L M P SecI* DsaI* | BinI* PflMI | | MboI BsiYI* | | XhoII |SetI | | | DpnI |Hin4II* SetI BceAI | | | |BstKTI || CviJI Hin4II* |Hpy166II \ \ \ \ \\ \\ \ \ \\ AAGTATTGGGAAGTTGCCGTGGAAAGATCCAAAGGTTGGCTGAAGGACATAGAAGGTGAA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTCATAACCCTTCAACGGCACCTTTCTAGGTTTCCAACCGACTTCCTGTATCTTCCACTT / / // / / / / / / // BceAI | || | | | CviJI Hin4II* SetI |Eco57MI | || | | Hin4II* |Eco57I | || | BsiYI* Hpy166II | || | PflMI | || | SetI | || XhoII | || MboI | |DpnI | BstKTI DsaI* SecI* BinI* K Y W E V A V E R S K G W L K D I E G E S I G K L P W K D P K V G * R T * K V N V L G S C R G K I Q R L A E G H R R * T ----:----|----:----|----:----|----:----|----:----|----:----| F Y Q S T A T S L D L P Q S F S M S P S S T N P L Q R P F I W L N A S P C L L H L I P F N G H F S G F T P Q L V Y F T F Eco57I Eco57MI | HphI | |XmnI | || SetI | || |XbaI | || ||MaeI | || ||Hpy178III* \ \\ \\\ CACGAACAGGTTCTAGAAAACTTCCAATAA 2110 2120 2130 ----:----|----:----|----:----| GTGCTTGTCCAAGATCTTTTGAAGGTTATT /// // ||XmnI |XbaI |SetI Hpy178III* HphI MaeI H E Q V L E N F Q * T N R F * K T S N X R T G S R K L P I X ----:----|----:----|----:----| C S C T R S F K W Y V R V P E L F S G I V F L N * F V E L L # Enzymes that cut Frequency Isoschizomers AatII 1 Acc65I 1 Asp718I AciI 9 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 2 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AjuI 1 AluI 5 AluBI ApoI 4 AcsI,XapI AsuI* 8 Cfr13I,PspPI,Sau96I,AspS9I AvaII 7 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 6 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 4 Bce83I* 1 BpuEI BceAI 3 BetI* 1 BsaWI BglI 1 BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 7 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 7 BmgT120I 8 BsaAI 2 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 9 BstF5I,BtsCI BseRI 1 BseYI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 10 Bsc4I,BseLI,BslI,AfiI BslFI 7 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspMI 1 BfuAI,Acc36I,BveI BsrDI 3 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstAPI 1 BstKTI 6 BstXI 2 BtgZI 1 BtsI 1 Cac8I 2 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 8 CviQI,RsaNI CviAII 7 CviJI 29 CviKI-1 CviRI* 11 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 6 MalI DraII 3 EcoO109I DsaI* 3 BtgI,BstDSI Eco31I 3 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 2 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 2 Mph1103I,NsiI,Zsp2I FalI 2 FatI 7 FauI 4 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 9 GlaI 5 GsaI 1 HaeII 2 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 5 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 9 HpyAV Hin6I 5 HinP1I,HspAI HindII 1 HincII HinfI 5 HpaI 1 KspAI HpaII 4 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 11 Hpy99I 5 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 10 HpyCH4IV MaeIII 6 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MfeI 1 MunI MluI 1 MlyI 1 SchI MmeI 5 MnlI 16 MseI 6 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 9 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 1 FauNDI NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 12 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 1 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 1 PpsI PpuMI 3 Psp5II,PspPPI PstI 3 RsaI 8 AfaI RsrII 1 CspI,Rsr2I,CpoI SanDI 1 SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 1 BmcAI,AssI,ZrmI ScrFI 4 BmrFI,MspR9I,Bme1390I SecI* 5 BseDI,BssECI,BsaJI SetI 32 SfaNI 6 LweI SfeI* 4 BstSFI,SfcI,BfmI SgrAI 1 SmlI 2 SmoI SpeI 1 BcuI,AhlI SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 10 TaqI 6 TaqII 1 TatI 3 TauI 1 TfiI 4 PfeI TseI 6 ApeKI TsoI 2 Tsp45I 4 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 15 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI Tth111I 1 PflFI,PsyI,AspI XbaI 1 XcmI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI AccI AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvrII BaeI BamHI BarI BbvCI BcgI BciVI BclI BdaI BfiI BmeT110I BmtI BplI Bpu10I BsaXI BseMII BsePI BseSI BsgI Bsp120I BspCNI BspHI BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstEII BstZ17I BtrI Cfr9I CspCI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRI EgeI EheI Esp3I EspI* FseI FspAI GsuI HgiAI* HgiJII* HindIII KasI MauBI McrI* MroNI MstI* NaeI NarI NgoMIV NheI NmeAIII NotI NruI OliI PacI PasI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII SacI SacII SalI SapI SduI SexAI SfiI SfoI SgfI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI TstI VspI XhoI XmaCI XmaI XmaIII* # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769