Restriction Map of GOS1/YHL031C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GOS1/YHL031C on chromosome VIII from coordinates 39486 to 38815.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.26157

EMBOSS_001 AluI CviJI Ecl136II | SetI | SduI | SacI | HgiAI* | HgiJII* | | Tsp4CI* XbaI | | | MaeIII CviJI |MaeI | | |HphI Tsp45I HaeIII |Hpy178III* \ \ \\ \ \ \\ ATGAGCTCACAACCGTCTTTCGTCACCATAAGGGGCAAGGCCATTTCTCTAGAAACACAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCGAGTGTTGGCAGAAAGCAGTGGTATTCCCCGTTCCGGTAAAGAGATCTTTGTGTT / / // / / // | | |HphI Tsp45I HaeIII |XbaI | | Tsp4CI* MaeIII CviJI Hpy178III* | Ecl136II MaeI | CviJI | AluI HgiJII* HgiAI* SacI SduI SetI M S S Q P S F V T I R G K A I S L E T Q * A H N R L S S P * G A R P F L * K H K E L T T V F R H H K G Q G H F S R N T N ----:----|----:----|----:----|----:----|----:----|----:----| X L E C G D K T V M L P L A M E R S V C X S S V V T K R * W L P C P W K E L F V H A * L R R E D G Y P A L G N R * F C L PleI |MlyI || TspGWI || | TatI Hin6I HinfI || | |Csp6I FnuDII* |MaeIII || | ||RsaI |GlaI SpeI |Tsp45I || | ||ScaI ||HhaI |MaeI Hpy188I CfrI \\ \\ \ \\\ \\\ \\ \ \ ACGGAGTCACTTCTTTCCAAGTACTCCACATTCGCGCAGACAACTAGTTCAGAACAAACT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGCCTCAGTGAAGAAAGGTTCATGAGGTGTAAGCGCGTCTGTTGATCAAGTCTTGTTTGA / / // /// /// // / | | |TspGWI ||TatI ||Hin6I || Hpy188I | | PleI |Csp6I |GlaI |SpeI | | MlyI ScaI FnuDII* MaeI | Tsp45I RsaI HhaI | MaeIII HinfI T E S L L S K Y S T F A Q T T S S E Q T R S H F F P S T P H S R R Q L V Q N K L G V T S F Q V L H I R A D N * F R T N W ----:----|----:----|----:----|----:----|----:----|----:----| V S D S R E L Y E V N A C V V L E S C V F P T V E K W T S W M R A S L * N L V F R L * K K G L V G C E R L C S T * F L S TfiI HinfI BalI | DdeI CviJI | | BsmAI BsiYI* HaeIII MnlI | | | CviJI | TspDTI |BsrI MmeI MboII | | | HaeIII | | BseGI \\ \ \ \ \ \ \ \ \ \ GGCCAAGAAAAGAAGATAGACAAGCAGTTGGAGGGAATCTTAGGCCAGAGACAGGATGTA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGTTCTTTTCTTCTATCTGTTCGTCAACCTCCCTTAGAATCCGGTCTCTGTCCTACAT // / / / / / / / / / / || | MmeI MboII | | | | | | BseGI || CfrI MnlI | | | | | TspDTI |HaeIII | | | | BsiYI* |CviJI | | | BsmAI |BalI | | HaeIII BsrI | | CviJI | DdeI HinfI TfiI G Q E K K I D K Q L E G I L G Q R Q D V A K K R R * T S S W R E S * A R D R M * P R K E D R Q A V G G N L R P E T G C N ----:----|----:----|----:----|----:----|----:----|----:----| P W S F F I S L C N S P I K P W L C S T Q G L F S S L C A T P P F R L G S V P H A L F L L Y V L L Q L S D * A L S L I Y TaqI BsgI ClaI BssKI | HindIII | TfiI |EciI | | AluI | HinfI ||HpaII | | CviJI | | FokI TfiI ||ScrFI MwoI | | | SetI | | | MseI HinfI ||CauII* |AciI | | | |MnlI \ \ \ \ \ \\\ \\ \ \ \ \\ ATCGATTCATTAACACAAATCTGCGATTCTAACCCGGCAATCTCCGCCTCAAAGCTTTCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTAAGTAATTGTGTTTAGACGCTAAGATTGGGCCGTTAGAGGCGGAGTTTCGAAAGG / / // / / /// / // / / / | | |MseI | | ||| MwoI |BsgI | | HindIII | | FokI | | ||BssKI AciI | | MnlI | HinfI | | |HpaII | CviJI | TfiI | | CauII* | AluI ClaI | | ScrFI SetI TaqI | EciI HinfI TfiI I D S L T Q I C D S N P A I S A S K L S S I H * H K S A I L T R Q S P P Q S F P R F I N T N L R F * P G N L R L K A F P ----:----|----:----|----:----|----:----|----:----|----:----| I S E N V C I Q S E L G A I E A E F S E L R N M L V F R R N * G P L R R R L A K D I * * C L D A I R V R C D G G * L K G SapI Ksp632I* | FalI | FalI | |BsrI | |TspRI | || XmnI BsiYI* | || |AluI | MboI | || |CviJI AsuI* CviRI* | BglII | || || SetI AvaII |FalI | XhoII | || || | AciI DraII |FalI | | DpnI | || || | | MboII PpuMI || AciI | | |BstKTI | || || | | |FokI |BmgT120I \\ \ \ \ \\ \ \\ \\ \ \ \\ \\ CAACTGCACCGCCACAAGGAGATCTTACAAGACCACTGGAAGAGCTTCCGCAATATCAGG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGACGTGGCGGTGTTCCTCTAGAATGTTCTGGTGACCTTCTCGAAGGCGTTATAGTCC / / // // / / / // /// / // | | |BsiYI* || XhoII | | || ||CviJI MboII |SetI | | AciI || BglII | | || ||AluI AciI FokI | CviRI* || MboI | | || |XmnI FalI |DpnI | | || SetI FalI BstKTI | | |BsrI | | Ksp632I* | | SapI | FalI | FalI TspRI Q L H R H K E I L Q D H W K S F R N I R N C T A T R R S Y K T T G R A S A I S G T A P P Q G D L T R P L E E L P Q Y Q V ----:----|----:----|----:----|----:----|----:----|----:----| W S C R W L S I K C S W Q F L K R L I L G V A G G C P S R V L G S S S S G C Y * L Q V A V L L D * L V V P L A E A I D P Hin6I SetI MnlI |GlaI | BseGI |BccI ||HhaI MboII \ \ \\ \\\ \ TCCTCCATCCAGCAAGAGCGCAACAGACTAAACTTGTTATTCAGCGTGAAGAACGATATT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAGGTAGGTCGTTCTCGCGTTGTCTGATTTGAACAATAAGTCGCACTTCTTGCTATAA /// / / /// / ||BseGI | | ||Hin6I MboII |PpuMI | | |GlaI |DraII | | HhaI |AvaII | BccI |AsuI* MnlI BmgT120I S S I Q Q E R N R L N L L F S V K N D I P P S S K S A T D * T C Y S A * R T I L L H P A R A Q Q T K L V I Q R E E R Y C ----:----|----:----|----:----|----:----|----:----|----:----| D E M W C S R L L S F K N N L T F F S I T R W G A L A C C V L S T I * R S S R Y G G D L L L A V S * V Q * E A H L V I N Hin6I FnuDII* |GlaI ||HhaI ||| Cac8I ||| | AluI ||| | HgaI ||| | CviJI BseGI ||| | | SetI | TatI ||| | | SfaNI | |Csp6I ||| | | |TspGWI | ||RsaI TspEI ||| | | ||SfeI* | ||FokI Hpy188I \ \\\ \ \ \\\ \ \\\ \ GCTAATTCCACAACGGACGCGCCAGCTCCTATAGGGGATGCTGACGAGTACATTCAGAAC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTAAGGTGTTGCCTGCGCGGTCGAGGATATCCCCTACGACTGCTCATGTAAGTCTTG / /// / // // / / /// / / TspEI ||| | || || SfeI* BseGI ||| | Hpy188I ||| | || |SfaNI ||| FokI ||| | || HgaI ||TatI ||| | |TspGWI |Csp6I ||| | CviJI RsaI ||| | AluI ||| Cac8I ||| SetI ||Hin6I |GlaI FnuDII* HhaI A N S T T D A P A P I G D A D E Y I Q N L I P Q R T R Q L L * G M L T S T F R T * F H N G R A S S Y R G C * R V H S E R ----:----|----:----|----:----|----:----|----:----|----:----| A L E V V S A G A G I P S A S S Y M * F Q * N W L P R A L E * L P H Q R T C E S S I G C R V R W S R Y P I S V L V N L V Hin4I MaeII BsaXI | SetI | BsmAI | TaiI | BssKI | | SalI | CviJI | | |TaqI | EcoRII | | |AccI | |TaqII TfiI | | ||HindII | |SecI* HinfI | | ||Hpy166II | |BsiYI* | TaqI | | ||| McrI* | ||MlyI | ClaI | | ||| |Tsp4CI* | ||PleI | |MboI | | ||| || BsmAI | ||ScrFI | || DpnI | | ||| || Esp3I | ||BseBI | || |BstKTI | | ||| || |MmeI | ||BsiYI* \ \\ \\ \ \ \\\ \\ \\ \ \\\ GAAACAAGGCGAATCGATCAGTCCAACAACGTAGTCGACCGTCTCATCTCCCAAGCCTGG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGTTCCGCTTAGCTAGTCAGGTTGTTGCATCAGCTGGCAGAGTAGAGGGTTCGGACC / // / / / //// / / // /// //// | || MboI | | |||| | | || ||| |||EcoRII | |DpnI | | |||| | | || ||| |||BssKI | BstKTI | | |||| | | || ||| |||SecI* | ClaI | | |||| | | || ||| ||BsmAI | TaqI | | |||| | | || ||| |BseBI HinfI | | |||| | | || ||| |ScrFI TfiI | | |||| | | || ||| |PleI | | |||| | | || ||| MlyI | | |||| | | || ||CviJI | | |||| | | || |BsiYI* | | |||| | | || |TaqII | | |||| | | || BsiYI* | | |||| | | |Esp3I | | |||| | | |BsmAI | | |||| | | BsaXI | | |||| | Hin4I | | |||| MmeI | | |||Tsp4CI* | | ||SalI | | |McrI* | | |AccI | | |TaqI | | Hpy166II | | HindII | MaeII TaiI SetI E T R R I D Q S N N V V D R L I S Q A W K Q G E S I S P T T * S T V S S P K P G N K A N R S V Q Q R S R P S H L P S L G ----:----|----:----|----:----|----:----|----:----|----:----| S V L R I S * D L L T T S R R M E W A Q R F L A F R D T W C R L R G D * R G L R F C P S D I L G V V Y D V T E D G L G P HinfI MaeII | Tth111I BsaXI | SetI SetI | | McrI* | Hin4I | TaiI BceAI \ \ \ \ \ \ \ \ GAGACTCGGTCGCAGTTCCACTCGCAGAGCAACGTGCTGAACACGGCAAACAACAAGGTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTGAGCCAGCGTCAAGGTGAGCGTCTCGTTGCACGACTTGTGCCGTTTGTTGTTCCAC /// / / / / ||McrI* BsaXI | MaeII SetI |Tth111I Hin4I TaiI HinfI SetI E T R S Q F H S Q S N V L N T A N N K V R L G R S S T R R A T C * T R Q T T R C D S V A V P L A E Q R A E H G K Q Q G V ----:----|----:----|----:----|----:----|----:----|----:----| S V R D C N W E C L L T S F V A F L L T P S E T A T G S A S C R A S C P L C C P L S P R L E V R L A V H Q V R C V V L H BssKI SexAI MseI EcoRII | Hin4II* | ScrFI AluI | |BsiI* | BseBI CviJI | || MboII CviRI* | | SetI | SetI | || |TspDTI \ \ \ \ \ \ \ \\ \\ TTGCAAACTTTACAAAGAATACCAGGTGTCAATCAGCTTATTATGAAGATTAACACGAGA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTTTGAAATGTTTCTTATGGTCCACAGTTAGTCGAATAATACTTCTAATTGTGCTCT / / // / / / / / / | CviRI* || EcoRII | CviJI | | BsiI* BceAI || SexAI | AluI | TspDTI || BssKI SetI | MboII |BseBI Hin4II* |ScrFI MseI SetI L Q T L Q R I P G V N Q L I M K I N T R C K L Y K E Y Q V S I S L L * R L T R E A N F T K N T R C Q S A Y Y E D * H E K ----:----|----:----|----:----|----:----|----:----|----:----| N C V K C L I G P T L * S I I F I L V L T A F K V F F V L H * D A * * S S * C S Q L S * L S Y W T D I L K N H L N V R S AccI MluI CfrI |BssNAI AflIII | BalI |Hpy166II | FnuDII* | CviJI || TsoI | | MboII | HaeIII || | Tsp4CI* \ \ \ \ \ \\ \ \ AGGAAGAAAAACGCGTTTGTATTGGCCACGATAACCACCCTTTGTATACTGTTTTTGTTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTCTTTTTGCGCAAACATAACCGGTGCTATTGGTGGGAAACATATGACAAAAACAAA /// / / // / ||AflIII | CfrI || Tsp4CI* ||MluI HaeIII |AccI |MboII CviJI Hpy166II FnuDII* BalI BssNAI TsoI R K K N A F V L A T I T T L C I L F L F G R K T R L Y W P R * P P F V Y C F C F E E K R V C I G H D N H P L Y T V F V F ----:----|----:----|----:----|----:----|----:----|----:----| L F F F A N T N A V I V V R Q I S N K N F S S F R T Q I P W S L W G K Y V T K T P L F V R K Y Q G R Y G G K T Y Q K Q K FatI |CviAII || NlaIII \\ \ TTCACATGGTAA 670 ----:----|-- AAGTGTACCATT / // | |FatI | CviAII NlaIII F T W * S H G X H M V X ----:----|-- K V H Y K * M T E C P L # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 3 BspACI,SsiI AflIII 1 AluI 5 AluBI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 2 MlsI,MluNI,MscI,Msp20I BccI 1 BceAI 1 BglII 1 BmgT120I 1 BsaXI 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BsmAI 3 Alw26I,BstMAI BsrI 2 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 2 Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 2 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CviAII 1 CviJI 10 CviKI-1 CviRI* 2 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI DraII 1 EcoO109I EciI 1 Ecl136II 1 EcoICRI EcoRII 2 AjnI,Psp6I,PspGI Esp3I 1 BsmBI FalI 2 FatI 1 FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 3 HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 1 Hin4II* 1 HpyAV Hin6I 3 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 6 HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 1 Hpy188III Hpy188I 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 2 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 McrI* 2 BsiEI,BstMCI,Bsh1285I MluI 1 MlyI 2 SchI MmeI 2 MnlI 3 MseI 2 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NlaIII 1 Hin1II,Hsp92II,FaeI PleI 2 PpsI PpuMI 1 Psp5II,PspPPI RsaI 2 AfaI SacI 1 Psp124BI,SstI SalI 1 SapI 1 LguI,PciSI,BspQI ScaI 1 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 10 SexAI 1 MabI SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SpeI 1 BcuI,AhlI TaiI 2 TaqI 3 TaqII 1 TatI 2 TfiI 4 PfeI TsoI 1 Tsp45I 2 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 1 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI Tth111I 1 PflFI,PsyI,AspI XbaI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BaeI BamHI BarI BbvCI BbvI BbvII* Bce83I* BcgI BciVI BclI BdaI BetI* BfiI BglI BinI* BisI BlsI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BseMII BsePI BseRI BseSI BseYI BslFI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BstAPI BstEII BstXI BtgZI BtrI BtsI Cfr10I Cfr9I CspCI DinI DraIII DrdI DsaI* Eam1105I Eco31I Eco47III Eco57I Eco57MI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI EspI* FaqI FauI Fnu4HI FseI FspAI GsaI GsuI HaeII HgiCI* HpaI Hpy99I KasI KpnI MauBI MfeI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacII SanDI SauI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TauI TseI TspMI TstI VspI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769