Restriction Map of YGRCTy2-1



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YGRCTy2-1 on chromosome VII from coordinates 574700 to 568740.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.28537

EMBOSS_001 MaeII |MaeIII || SetI || TaiI SpeI || | SpeI |MaeI || | |MaeI \\ \\ \ \\ TGTTGGAATAAAAATCAACTATCATCTACTAACTAGTATTTACGTTACTAGTATATTATC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| ACAACCTTATTTTTAGTTGATAGTAGATGATTGATCATAAATGCAATGATCATATAATAG // / / / // |SpeI | | | |SpeI MaeI | | | MaeI | | MaeIII | MaeII TaiI SetI C W N K N Q L S S T N * Y L R Y * Y I I V G I K I N Y H L L T S I Y V T S I L S L E * K S T I I Y * L V F T L L V Y Y H ----:----|----:----|----:----|----:----|----:----|----:----| X Q F L F * S D D V L * Y K R * * Y I I X N S Y F D V I M * * S T N V N S T Y * T P I F I L * * R S V L I * T V L I N D MboII TspDTI AluI Tsp4CI* | HgaI | TspEI CviJI \ \ \ \ \ \ ATATACGGTGTTAGAAGATGACGCAAATGATGAAAAATAGTCATCTAAATTAGTGGAAGC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TATATGCCACAATCTTCTACTGCGTTTACTACTTTTTATCAGTAGATTTAATCACCTTCG / / / / / / / Tsp4CI* MboII HgaI TspDTI TspEI | CviJI | AluI SetI I Y G V R R * R K * * K I V I * I S G S Y T V L E D D A N D E K * S S K L V E A I R C * K M T Q M M K N S H L N * W K L ----:----|----:----|----:----|----:----|----:----|----:----| M Y P T L L H R L H H F I T M * I L P L * I R H * F I V C I I F F L * R F * H F Y V T N S S S A F S S F Y D D L N T S A MboI | DpnI | |BstKTI | || BinI* | || | SspI SetI | || | | MseI TspDTI \ \ \\ \ \ \ \ TGAAACGCAAGGATTGATAATGTAATAGGATCAATGAATATTAACATATAAAATGATGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ACTTTGCGTTCCTAACTATTACATTATCCTAGTTACTTATAATTGTATATTTTACTACTA // / / / / / || MboI | | | TspDTI |DpnI | | MseI BstKTI | SspI BinI* * N A R I D N V I G S M N I N I * N D D E T Q G L I M * * D Q * I L T Y K M M I K R K D * * C N R I N E Y * H I K * * * ----:----|----:----|----:----|----:----|----:----|----:----| Q F A L I S L T I P D I F I L M Y F S S S F R L S Q Y H L L I L S Y * C I F H H S V C P N I I Y Y S * H I N V Y L I I I MnlI | AvaI | XhoI | SmlI TspEI | AbsI | CviRI* BsiYI* | PspXI | | TfiI | TfiI | |TaqI SspI TspEI | | HinfI | HinfI | |BmeT110I \ \ \ \ \ \ \ \ \\ AATAATATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTTATGGATTCCTAAATCCTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTATAAATATCTTAACACATCTTAACGTCTAAGGGAAAATACCTAAGGATTTAGGAG / / // / / / / SspI TspEI || | BsiYI* | MnlI || HinfI HinfI || TfiI TfiI |CviRI* TspEI N N I Y R I V * N C R F P F M D S * I L I I F I E L C R I A D S L L W I P K S S * Y L * N C V E L Q I P F Y G F L N P R ----:----|----:----|----:----|----:----|----:----|----:----| L L I * L I T Y F Q L N G K I S E * I R Y Y Y K Y F Q T S N C I G K * P N R F G I I N I S N H L I A S E R K H I G L D E MaeI SetI TfiI MnlI | BseRI | SspI PsiI HinfI \ \ \ \ \ \ \ GAGGAGAACTTCTAGTATATCTACATACCTAATATTATCGCCTTATAAAAAATGGAATCC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTCTTGAAGATCATATAGATGTATGGATTATAATAGCGGAATATTTTTTACCTTAGG // / / / / / / || MnlI BseRI SetI SspI PsiI HinfI |PspXI MaeI TfiI |AbsI |SmlI |XhoI |AvaI BmeT110I TaqI E E N F * Y I Y I P N I I A L * K M E S R R T S S I S T Y L I L S P Y K K W N P G E L L V Y L H T * Y Y R L I K N G I P ----:----|----:----|----:----|----:----|----:----|----:----| S S F K * Y I * M G L I I A K Y F I S D R P S S R T Y R C V * Y * R R I F F P I L L V E L I D V Y R I N D G * L F H F G FatI |CviAII ||Ksp632I* ||| NlaIII ||| | Hin6I ||| | |GlaI MboII ||| | ||HhaI MaeIII TspEI TspDTI ||| | |||HaeII |BslFI DdeI \ \ \\\ \ \\\\ \\ \ CAACAATTACATCAAAATCCACATTCTCTTCATGGTAGCGCCTATGCTTCGGTTACTTCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTTAATGTAGTTTTAGGTGTAAGAGAAGTACCATCGCGGATACGAAGCCAATGAAGA / // / /// //// / TspEI |MboII | ||| |||Hin6I MaeIII TspDTI | ||| ||GlaI BslFI | ||| |HhaI | ||| HaeII | ||Ksp632I* | |FatI | CviAII NlaIII Q Q L H Q N P H S L H G S A Y A S V T S N N Y I K I H I L F M V A P M L R L L L T I T S K S T F S S W * R L C F G Y F * ----:----|----:----|----:----|----:----|----:----|----:----| W C N C * F G C E R * P L A * A E T V E G V I V D F D V N E E H Y R R H K P * K L L * M L I W M R K M T A G I S R N S R TspGWI | BceAI | BinI* | | Hpy178III* MwoI | | | MboI | AluI BetI* | | | XhoII | CviJI |HpaII | | | | DpnI | | SetI || ApoI | | | | |BstKTI CviJI | | | TspEI || TspEI \ \ \ \ \\ \ \ \ \ \ \\ \ AAGGAAGTCCCATAAAATCAAGATCCGTTAGCCGTTTCAGCTTCCAATTTACCGGAATTT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTTCAGGGTATTTTAGTTCTAGGCAATCGGCAAAGTCGAAGGTTAAATGGCCTTAAA / / // /// / / / / / / // / DdeI | || ||| XhoII | | | CviJI | || TspEI | || ||| MboI | | | AluI | || ApoI | || ||DpnI | | SetI | |BetI* | || |BstKTI | MwoI | HpaII | || | CviJI TspEI | || Hpy178III* | |BceAI | BinI* TspGWI K E V P * N Q D P L A V S A S N L P E F R K S H K I K I R * P F Q L P I Y R N L G S P I K S R S V S R F S F Q F T G I * ----:----|----:----|----:----|----:----|----:----|----:----| L S T G Y F * S G N A T E A E L K G S N * P L G M F D L D T L R K L K W N V P I L F D W L I L I R * G N * S G I * R F K BssKI AluI EcoRII CviJI |SecI* PvuII MseI ||ScrFI NspBII* TfiI SetI ||BseBI | SetI HinfI DdeI |TspEI BsmAI |||SetI | | BslFI \ \ \\ \ \\\\ \ \ \ GATAGAGATTCCACTAAGGTTAATTCTCAACAAGAGACAACACCTGGGACATCAGCTGTT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCTCTAAGGTGATTCCAATTAAGAGTTGTTCTCTGTTGTGGACCCTGTAGTCGACAA / // / / / / / / / / HinfI |DdeI | TspEI BsmAI | | | | NspBII* TfiI SetI MseI | | | | PvuII | | | | CviJI | | | | AluI | | | SetI | | EcoRII | | BssKI | | SecI* | BseBI | ScrFI SetI D R D S T K V N S Q Q E T T P G T S A V I E I P L R L I L N K R Q H L G H Q L F * R F H * G * F S T R D N T W D I S C S ----:----|----:----|----:----|----:----|----:----|----:----| S L S E V L T L E * C S V V G P V D A T Q Y L N W * P * N E V L S L V Q S M L Q I S I G S L N I R L L L C C R P C * S N MslI BseRI |FatI ||CviAII |||BccI SetI |||| NlaIII | MnlI |||| |Eco57I | | BspMI PflMI |||| |Eco57MI | | |Csp6I BsiYI* Hpy178III* |||| || BsmAI | | ||RsaI SetI |MnlI \ \\\\ \\ \ \ \ \\\ \ \\ CCAGAGAACCATCATCATGTCTCTCCTCAACCTGCTTCAGTACCACCTCCACAGAATGGA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTCTTGGTAGTAGTACAGAGAGGAGTTGGACGAAGTCATGGTGGAGGTGTCTTACCT // / // // // / //// / / |BslFI | || |FatI |SetI MnlI |||SetI | MnlI | | || Eco57MI BsmAI ||BspMI BsiYI* | | || CviAII |Csp6I PflMI | | || Eco57I RsaI | | || BccI | | |NlaIII | | MslI | BseRI Hpy178III* P E N H H H V S P Q P A S V P P P Q N G Q R T I I M S L L N L L Q Y H L H R M D R E P S S C L S S T C F S T T S T E W T ----:----|----:----|----:----|----:----|----:----|----:----| G S F W * * T E G * G A E T G G G C F P E L S G D D H R E E V Q K L V V E V S H W L V M M M D R R L R S * Y W R W L I S BsiYI* AluI | MnlI CviJI | |BsrI Tsp4CI* FatI | SetI | || SduI |Csp6I |CviAII | | CviJI | || BseSI ||RsaI || NlaIII BceAI | | HaeIII | || | BfiI \\\ \\ \ \ \ \ \ \ \\ \ \ CAGTACCAACAGCACGGCATGATGACCCCAAACAAAGCTATGGCCTCTAACTGGGCACAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTCATGGTTGTCGTGCCGTACTACTGGGGTTTGTTTCGATACCGGAGATTGACCCGTGTA / // / // / / / / / / / | |Csp6I | |FatI | | CviJI | | BseSI BfiI | RsaI | CviAII | | AluI | | MnlI Tsp4CI* NlaIII | SetI | | BsrI BceAI | | SduI | BsiYI* HaeIII CviJI Q Y Q Q H G M M T P N K A M A S N W A H S T N S T A * * P Q T K L W P L T G H I V P T A R H D D P K Q S Y G L * L G T L ----:----|----:----|----:----|----:----|----:----|----:----| C Y W C C P M I V G F L A I A E L Q A C V T G V A R C S S G L C L * P R * S P V L V L L V A H H G W V F S H G R V P C M BccI | MaeII | AflIII | |BtrI MaeII | || SetI |MaeIII | || TaiI |Tsp45I | || | Hpy166II || SetI AarI | || | | HphI || TaiI SetI BspMI BetI* \ \\ \ \ \ \\ \ \ \ \ TACCAACAACCATCTATGATGACGTGTTCACATTATCAAACGTCACCTGCGTATTATCAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ATGGTTGTTGGTAGATACTACTGCACAAGTGTAATAGTTTGCAGTGGACGCATAATAGTT / / // / / / / / / / / | | || | | HphI | | | Tsp45I BspMI | | || | Hpy166II | | | MaeIII AarI | | || AflIII | | SetI | | |MaeII | MaeII | | BtrI TaiI | TaiI SetI | SetI BccI Y Q Q P S M M T C S H Y Q T S P A Y Y Q T N N H L * * R V H I I K R H L R I I N P T T I Y D D V F T L S N V T C V L S T ----:----|----:----|----:----|----:----|----:----|----:----| * W C G D I I V H E C * * V D G A Y * * N G V V M * S S T N V N D F T V Q T N D V L L W R H H R T * M I L R * R R I I L DdeI | TatI HpaII | |HphI BinI* | AsuI* | |Csp6I | MboI | AvaII | |TspRI | SetI | |BmgT120I Tsp4CI* | ||RsaI | | DpnI | ||NlaIV | BseMII | ||ScaI | | |MnlI | ||TspGWI TstI | |BspCNI | |||TstI | | |BstKTI \ \\\ \ \ \\ \ \\\\ \ \ \\ CCGGACCCACACTATCCGTTGCCACAGTATATCCCACCACTGAGTACTTCCTCACCTGAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCTGGGTGTGATAGGCAACGGTGTCATATAGGGTGGTGACTCATGAAGGAGTGGACTA //// / / // / / / /// / // |||| TstI | || TspRI | | ||TatI | |MnlI |||AvaII | |BspCNI | | |Csp6I | |DpnI |||AsuI* | BseMII | | ScaI | BstKTI ||BmgT120I Tsp4CI* | | RsaI BinI* ||NlaIV | DdeI SetI |BetI* | HphI TspGWI TstI HpaII P D P H Y P L P Q Y I P P L S T S S P D R T H T I R C H S I S H H * V L P H L I G P T L S V A T V Y P T T E Y F L T * S ----:----|----:----|----:----|----:----|----:----|----:----| G S G C * G N G C Y I G G S L V E E G S V P G V S D T A V T Y G V V S Y K R V Q R V W V I R Q W L I D W W Q T S G * R I SmlI MseI |SetI |AhaIII* || AluI || BdaI || CviJI || BdaI || |DdeI BdaI TaqI || | Bce83I* || ||SetI BdaI ClaI || | | Hpy188I || ||| MnlI | SetI \ \\ \ \ \ \\ \\\ \ \ \ CCAATCGATTTAAAAAATCAACACTCTGAAATACCTCAAGCTAAGACAAAGGTGGGAAAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTAGCTAAATTTTTTAGTTGTGAGACTTTATGGAGTTCGATTCTGTTTCCACCCTTTA / / // / / / / /// // // MboI | || | Bce83I* | SetI ||| || |SetI | || BdaI Hpy188I ||| || BdaI | || BdaI ||| || BdaI | |MseI ||| |DdeI | AhaIII* ||| MnlI ClaI ||CviJI TaqI ||AluI |SmlI SetI P I D L K N Q H S E I P Q A K T K V G N Q S I * K I N T L K Y L K L R Q R W E I N R F K K S T L * N T S S * D K G G K * ----:----|----:----|----:----|----:----|----:----|----:----| G I S K F F * C E S I G * A L V F T P F D L R N L F D V S Q F V E L * S L P P F W D I * F I L V R F Y R L S L C L H S I MboII | FatI | |CviAII | || NlaIII MaeII | || | MseI | SetI | || | | ApoI | TaiI MseI Hpy188I | || | | TspEI \ \ \ \ \ \\ \ \ \ AACGTCTTACCACCACACACTTTAACATCAGAAGAAAACTTTTCTACATGGGTTAAATTT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCAGAATGGTGGTGTGTGAAATTGTAGTCTTCTTTTGAAAAGATGTACCCAATTTAAA / / / / / / // / / | MaeII MseI Hpy188I | | |FatI | TspEI TaiI | | | | ApoI SetI | | | MseI | | CviAII | NlaIII MboII N V L P P H T L T S E E N F S T W V K F T S Y H H T L * H Q K K T F L H G L N F R L T T T H F N I R R K L F Y M G * I L ----:----|----:----|----:----|----:----|----:----|----:----| L T K G G C V K V D S S F K E V H T L N Y R R V V V C K L M L L F S K * M P * I V D * W W V S * C * F F V K R C P N F K BssKI EcoRII MboII |SecI* | MaeIII ||ScrFI Hpy188I | Tsp45I HphI ||BseBI \ \ \ \ \\\ TACATCAGATTTTTGAAGAACTCTAATCTCGGTGACATCATTCCAAATGACCAGGGTGAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTAGTCTAAAAACTTCTTGAGATTAGAGCCACTGTAGTAAGGTTTACTGGTCCCACTT / / / / / / Hpy188I MboII | HphI | EcoRII Tsp45I | BssKI MaeIII | SecI* BseBI ScrFI Y I R F L K N S N L G D I I P N D Q G E T S D F * R T L I S V T S F Q M T R V K H Q I F E E L * S R * H H S K * P G * N ----:----|----:----|----:----|----:----|----:----|----:----| * M L N K F F E L R P S M M G F S W P S K C * I K S S S * D R H C * E L H G P H V D S K Q L V R I E T V D N W I V L T F FatI |CviAII || NspI || NlaIII || | MboII Hin4II* HphI || | |TspDTI SetI |TspDTI \ \\ \ \\ \ \\ ATCAAAAGACAAATGACTTATGAAGAACATGCGTATATATACAATACCTTCCAAGCATTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTTTCTGTTTACTGAATACTTCTTGTACGCATATATATGTTATGGAAGGTTCGTAAA / / // / / / HphI | || TspDTI SetI Hin4II* | || MboII TspDTI | |FatI | CviAII NlaIII NspI I K R Q M T Y E E H A Y I Y N T F Q A F S K D K * L M K N M R I Y T I P S K H L Q K T N D L * R T C V Y I Q Y L P S I C ----:----|----:----|----:----|----:----|----:----|----:----| I L L C I V * S S C A Y I Y L V K W A N F * F V F S K H L V H T Y I C Y R G L M D F S L H S I F F M R I Y V I G E L C K TspEI | FokI FatI | |MseI |CviAII ApoI | |VspI || NlaIII TspEI | ||TspEI BseGI \\ \ \ \ \\\ \ GCCCCATTTCATTTATTGCCAACATGGGTAAAACAAATTTTAGAAATTAATTATGCTGAC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGGGGTAAAGTAAATAACGGTTGTACCCATTTTGTTTAAAATCTTTAATTAATACGACTG / // / /// / / | |FatI TspEI ||| | BseGI | CviAII ApoI ||| TspEI NlaIII ||FokI |VspI |MseI TspEI A P F H L L P T W V K Q I L E I N Y A D P H F I Y C Q H G * N K F * K L I M L T P I S F I A N M G K T N F R N * L C * H ----:----|----:----|----:----|----:----|----:----|----:----| A G N * K N G V H T F C I K S I L * A S Q G M E N I A L M P L V F K L F * N H Q G W K M * Q W C P Y F L N * F N I I S V Hpy178III* | TspEI Tsp4CI* CviRI* | | MseI \ \ \ \ \ ATCCTTACAGTCCTTTGTAAAAGTGTGTCCAAAATGCAAACTAACAATCAAGAATTAAAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGAATGTCAGGAAACATTTTCACACAGGTTTTACGTTTGATTGTTAGTTCTTAATTTC / / / // Tsp4CI* CviRI* | |MseI | TspEI Hpy178III* I L T V L C K S V S K M Q T N N Q E L K S L Q S F V K V C P K C K L T I K N * R P Y S P L * K C V Q N A N * Q S R I K G ----:----|----:----|----:----|----:----|----:----|----:----| M R V T R Q L L T D L I C V L L * S N F C G * L G K Y F H T W F A F * C D L I L D K C D K T F T H G F H L S V I L F * L AluI CviJI | SetI Hpy99I | | EcoP15I | TatI | | | SmlI | |Csp6I | | | |SetI | ||RsaI | | | || Csp6I | ||| Bce83I* | | | || |RsaI | ||| | TspGWI TspEI \ \ \ \\ \\ \ \\\ \ \ \ GATTGGATAGCTCTTGCCAACCTTGAGTACGACGGAAGTACATCTGCTGATACATTTGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTAACCTATCGAGAACGGTTGGAACTCATGCTGCCTTCATGTAGACGACTATGTAAACTT / / // / // /// / | CviJI |SetI | |Hpy99I ||| TspGWI | AluI EcoP15I | |Csp6I ||Bce83I* SetI | RsaI ||TatI SmlI |Csp6I RsaI D W I A L A N L E Y D G S T S A D T F E I G * L L P T L S T T E V H L L I H L K L D S S C Q P * V R R K Y I C * Y I * N ----:----|----:----|----:----|----:----|----:----|----:----| S Q I A R A L R S Y S P L V D A S V N S P N S L E Q W G Q T R R F Y M Q Q Y M Q I P Y S K G V K L V V S T C R S I C K F Tsp4CI* | Csp6I | |RsaI | || MboI | || | DpnI | || | |MnlI | || | |BstKTI | || | || Hpy188I | || | || | CviJI \ \\ \ \\ \ \ ATTACAGTCAGTACGATCATTCAGAGGCTAAAAGAAAACAATATCAATGTTAGCGACAGA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGTCAGTCATGCTAGTAAGTCTCCGATTTTCTTTTGTTATAGTTACAATCGCTGTCT / / // // / / / | | || || | | CviJI | | || || | Hpy188I | | || || MboI | | || |DpnI | | || |MnlI | | || BstKTI | | |Csp6I | | RsaI | Tsp4CI* TspEI I T V S T I I Q R L K E N N I N V S D R L Q S V R S F R G * K K T I S M L A T D Y S Q Y D H S E A K R K Q Y Q C * R Q I ----:----|----:----|----:----|----:----|----:----|----:----| I V T L V I M * L S F S F L I L T L S L F * L * Y S * E S A L L F C Y * H * R C N C D T R D N L P * F F V I D I N A V S HphI | SetI SetI | |MaeII CviJI | BetI* | ||BsaAI HaeIII | |HpaII | ||SnaBI | HindII | || MaeIII | ||| SetI | Hpy166II MseI | || Tsp45I | ||| TaiI \ \ \ \ \\ \ \ \\\ \ TTGGCCTGTCAACTAATACTTAAAGGTCTATCCGGTGACTTCAAATACCTACGTAATCAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGGACAGTTGATTATGAATTTCCAGATAGGCCACTGAAGTTTATGGATGCATTAGTT / / // // / // / // | Hpy166II |SetI || | || | |MaeII | HindII MseI || | || | SnaBI HaeIII || | || | BsaAI CviJI || | || TaiI || | || SetI || | |SetI || | HphI || Tsp45I || MaeIII |BetI* HpaII L A C Q L I L K G L S G D F K Y L R N Q W P V N * Y L K V Y P V T S N T Y V I N G L S T N T * R S I R * L Q I P T * S I ----:----|----:----|----:----|----:----|----:----|----:----| N A Q * S I S L P R D P S K L Y R R L * I P R D V L V * L D I R H S * I G V Y D Q G T L * Y K F T * G T V E F V * T I L ApoI TspEI FatI | TspEI Csp6I |CviAII TspEI | | MseI |RsaI || NlaIII | TspDTI | | VspI \\ \\ \ \ \ \ \ \ TATCGTACCAAAACGAACATGAAACTTTCCCAATTATTCGCTGAAATTCAATTAATATAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGCATGGTTTTGCTTGTACTTTGAAAGGGTTAATAAGCGACTTTAAGTTAATTATATA // / // / / / // |Csp6I | |FatI | TspEI | |VspI RsaI | CviAII TspDTI | |MseI NlaIII | TspEI TspEI ApoI Y R T K T N M K L S Q L F A E I Q L I Y I V P K R T * N F P N Y S L K F N * Y M S Y Q N E H E T F P I I R * N S I N I * ----:----|----:----|----:----|----:----|----:----|----:----| Y R V L V F M F S E W N N A S I * N I Y I D Y W F S C S V K G I I R Q F E I L I I T G F R V H F K G L * E S F N L * Y I FatI BspHI |CviAII |Hpy178III* || TfiI || BslFI || HinfI TspDTI || NlaIII |Tsp4CI* \\ \ \\ GACGAAAATAAAATCATGAATCTAAATAAACCGTCCCAATACAAACAACACAGCGAATAC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTTTTATTTTAGTACTTAGATTTATTTGGCAGGGTTATGTTTGTTGTGTCGCTTATG / // // / / | || |BslFI | Tsp4CI* | || HinfI TspDTI | || TfiI | |BspHI | |FatI | Hpy178III* | CviAII NlaIII D E N K I M N L N K P S Q Y K Q H S E Y T K I K S * I * I N R P N T N N T A N T R K * N H E S K * T V P I Q T T Q R I Q ----:----|----:----|----:----|----:----|----:----|----:----| S S F L I M F R F L G D W Y L C C L S Y H R F Y F * S D L Y V T G I C V V C R I V F I F D H I * I F R G L V F L V A F V MaeIII | SetI TspEI \ \ \ AAAAATGTTTCTCGCACATCTCCAAACACGACTAACACAAAGGTTACAACTCGTAATTAT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTACAAAGAGCGTGTAGAGGTTTGTGCTGATTGTGTTTCCAATGTTGAGCATTAATA / / / SetI MaeIII TspEI K N V S R T S P N T T N T K V T T R N Y K M F L A H L Q T R L T Q R L Q L V I I K C F S H I S K H D * H K G Y N S * L S ----:----|----:----|----:----|----:----|----:----|----:----| L F T E R V D G F V V L V F T V V R L * C F H K E C M E L C S * C L P * L E Y N F I N R A C R W V R S V C L N C S T I I TseI |BisI ||BlsI ||| MwoI ||| | AluI ||| | CviJI ||| | | SetI Bce83I* ||| | | |BbvI SspI | MaeI \\\ \ \ \\ \ \ \ CATAGAACAAATAGTTCAAAACCAAGAGCAGCAAAAGCTCACAATATTGCTACATCTAGT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GTATCTTGTTTATCAAGTTTTGGTTCTCGTCGTTTTCGAGTGTTATAACGATGTAGATCA /// / / // / / ||| | CviJI || Bce83I* MaeI ||| | AluI |SspI ||| SetI BbvI ||MwoI ||TseI |BisI BlsI H R T N S S K P R A A K A H N I A T S S I E Q I V Q N Q E Q Q K L T I L L H L V * N K * F K T K S S K S S Q Y C Y I * * ----:----|----:----|----:----|----:----|----:----|----:----| * L V F L E F G L A A F A * L I A V D L D Y F L Y N L V L L L L L E C Y Q * M * M S C I T * F W S C C F S V I N S C R T Hpy166II | MboI | BclI | | DpnI | | |HphI | | |BstKTI ApoI | | || MseI TfiI SmlI TspEI | | || VspI HinfI Tsp4CI* AflII | SmlI | | || MslI |TspDTI | TspDTI |MseI \ \ \ \ \\ \ \\ \ \ \\ AAATTCTCAAGGGTGAACAATGATCACATTAATGAATCAACCGTTTCATCACAATACTTA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAGAGTTCCCACTTGTTACTAGTGTAATTACTTAGTTGGCAAAGTAGTGTTATGAAT / / / // / / / / / / / / | SmlI | || | | | | | | TspDTI MseI TspEI | || | | | | | Tsp4CI* ApoI | || | | | | HinfI | || | | | | TfiI | || | | | TspDTI | || | | VspI | || | | MseI | || | MslI | || BclI | || MboI | |HphI | |DpnI | BstKTI Hpy166II K F S R V N N D H I N E S T V S S Q Y L N S Q G * T M I T L M N Q P F H H N T * I L K G E Q * S H * * I N R F I T I L K ----:----|----:----|----:----|----:----|----:----|----:----| L N E L T F L S * M L S D V T E D C Y K Y I R L P S C H D C * H I L R K M V I S F E * P H V I I V N I F * G N * * L V * Hpy99I TfiI | DdeI CviJI HinfI | |BtgZI HaeIII | DdeI MlyI | || DdeI | Cac8I | | CviJI PleI \ \\ \ \ \ \ \ \ \ AGCGATGACGACGAACTTAGTCTTAGGCCAGCAACAGAAAGAATCTAAGCCAACACACAC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TCGCTACTGCTGCTTGAATCAGAATCCGGTCGTTGTCTTTCTTAGATTCGGTTGTGTGTG / / / / / / / / // // AflII Hpy99I | | | | Cac8I | |CviJI |PleI SmlI | | | HaeIII | DdeI MlyI | | | CviJI HinfI | | DdeI TfiI | BtgZI DdeI S D D D E L S L R P A T E R I * A N T H A M T T N L V L G Q Q Q K E S K P T H T R * R R T * S * A S N R K N L S Q H T Q ----:----|----:----|----:----|----:----|----:----|----:----| L S S S S S L R L G A V S L I * A L V C L R H R R V * D * A L L L F F R L W C V A I V V F K T K P W C C F S D L G V C V TfiI MboI HinfI BclI Hin4II* SetI | Hpy178III* | DpnI | | AluI HinfI | |BstKTI | | CviJI | TaqI HphI | || SetI | | | SetI \ \ \ \ \\ \ \ \ \ \ AATAGACTCGAATGACGAACTACCTGATCACCTTCTTATTGATTCAGGAGCTTCGCAAAC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCTGAGCTTACTGCTTGATGGACTAGTGGAAGAATAACTAAGTCCTCGAAGCGTTTG / / / / // / / / // / | TaqI | SetI || BclI | | || CviJI HinfI HphI || MboI | | || AluI || SetI | | |SetI |DpnI | | Hpy178III* BstKTI | HinfI | TfiI Hin4II* N R L E * R T T * S P S Y * F R S F A N I D S N D E L P D H L L I D S G A S Q T * T R M T N Y L I T F L L I Q E L R K R ----:----|----:----|----:----|----:----|----:----|----:----| L L S S H R V V Q D G E * Q N L L K A F C Y V R I V F * R I V K K N I * S S R L I S E F S S S G S * R R I S E P A E C V MboI Hpy188I FatI | DpnI |CviAII Hpy188I | |BstKTI || CviRI* | SfaNI | || CviJI || NlaIII TspEI | TaqII TaqI \ \\ \ \\ \ \ \ \ \ GCTTGTCAGATCAGCCCATTATTTACACCATGCAACACCCAATTCTGAAATAAACATAGT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CGAACAGTCTAGTCGGGTAATAAATGTGGTACGTTGTGGGTTAAGACTTTATTTGTATCA / // / / / // // / / | || | CviJI | |CviRI* || TaqII SfaNI | || MboI | |FatI |Hpy188I | |DpnI | CviAII TspEI | BstKTI NlaIII Hpy188I A C Q I S P L F T P C N T Q F * N K H S L V R S A H Y L H H A T P N S E I N I V L S D Q P I I Y T M Q H P I L K * T * S ----:----|----:----|----:----|----:----|----:----|----:----| A Q * I L G N N V G H L V W N Q F L C L R K D S * G M I * V M C C G I R F Y V Y S T L D A W * K C W A V G L E S I F M T MboII Hpy188I \ \ CGATGCTCAAAAACAAGACATTCCTATAAATGCCATTGGTAATCTTCACTTCAACTTTCA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GCTACGAGTTTTTGTTCTGTAAGGATATTTACGGTAACCATTAGAAGTGAAGTTGAAAGT / / / TaqI MboII Hpy188I R C S K T R H S Y K C H W * S S L Q L S D A Q K Q D I P I N A I G N L H F N F Q M L K N K T F L * M P L V I F T S T F R ----:----|----:----|----:----|----:----|----:----|----:----| R H E F V L C E * L H W Q Y D E S * S E D I S L F L V N R Y I G N T I K V E V K S A * F C S M G I F A M P L R * K L K * CviJI | MboI | | DpnI HgiCI* | | |BstKTI | NlaIV BceAI | | || MseI \ \ \ \ \ \\ \ GAACGGCACCAAAACATCAATAAAAGCACTACACACACCAAACATAGCCTATGATCTATT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGCCGTGGTTTTGTAGTTATTTTCGTGATGTGTGTGGTTTGTATCGGATACTAGATAA / / / / // / | HgiCI* BceAI CviJI || MboI NlaIV |DpnI BstKTI E R H Q N I N K S T T H T K H S L * S I N G T K T S I K A L H T P N I A Y D L L T A P K H Q * K H Y T H Q T * P M I Y * ----:----|----:----|----:----|----:----|----:----|----:----| S R C W F M L L L V V C V L C L R H D I L V A G F C * Y F C * V C W V Y G I I * F P V L V D I F A S C V G F M A * S R N AluI CviJI | SetI | Cac8I TsoI | | CviJI SspI Cac8I \ \ \ \ \ \ AAGTTTGAGTGAGCTGGCTAATCAAAATATTACTGCCTGCTTTACCAGAAACACTTTAGA 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAAACTCACTCGACCGATTAGTTTTATAATGACGGACGAAATGGTCTTTGTGAAATCT / / / / / / / / | TsoI | | | CviJI SspI Cac8I MseI | | Cac8I | CviJI | AluI SetI K F E * A G * S K Y Y C L L Y Q K H F R S L S E L A N Q N I T A C F T R N T L E V * V S W L I K I L L P A L P E T L * K ----:----|----:----|----:----|----:----|----:----|----:----| L N S H A P * D F Y * Q R S * W F C K L * T Q T L Q S I L I N S G A K G S V S * L K L S S A L * F I V A Q K V L F V K S BccI MboI | DpnI | |BstKTI | || Hpy188I | || | Csp6I | || | |RsaI | || | |BseGI | || | || TatI | || | || Tsp4CI* | || | || |Csp6I | || | || ||RsaI | || | || ||ScaI | || | || ||| MaeI BsmAI | || | || ||| FokI |FatI | || | || ||| | AluI ||CviAII | || | || ||| | CviJI ||| NlaIII | || | || ||| | | SetI ||| | TsoI BsrI \ \\ \ \\ \\\ \ \ \ \\\ \ \ \ AAGATCGGATGGTACAGTACTAGCTCCCATAGTCAAACATGGAGACTTTTACTGGTTATC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTAGCCTACCATGTCATGATCGAGGGTATCAGTTTGTACCTCTGAAAATGACCAATAG // / / /// /////// / // / || | | ||| ||||||FokI | |FatI BsrI || | | ||| |||||CviJI | |TsoI || | | ||| |||||AluI | CviAII || | | ||| ||||MaeI | BsmAI || | | ||| |||SetI NlaIII || | | ||| ||TatI || | | ||| |Csp6I || | | ||| ScaI || | | ||| RsaI || | | ||Tsp4CI* || | | |Csp6I || | | RsaI || | BseGI || Hpy188I || MboI |DpnI BstKTI BccI K I G W Y S T S S H S Q T W R L L L V I R S D G T V L A P I V K H G D F Y W L S D R M V Q Y * L P * S N M E T F T G Y L ----:----|----:----|----:----|----:----|----:----|----:----| F I P H Y L V L E W L * V H L S K S T I F S R I T C Y * S G Y D F M S V K V P * L D S P V T S A G M T L C P S K * Q N D MaeII Hin4II* | SetI | AluI | TaiI SetI | CviJI | |HindII TspEI | | SetI | |Hpy166II \ \ \ \ \ \\ TAAAAAATACCTAATTCCTTCGCACATTTCAAAGCTAACAATAAACAACGTCAACAAAAG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| ATTTTTTATGGATTAAGGAAGCGTGTAAAGTTTCGATTGTTATTTGTTGCAGTTGTTTTC / / / / / / / / SetI TspEI | | CviJI | | Hpy166II | | AluI | | HindII | SetI | MaeII Hin4II* TaiI SetI * K I P N S F A H F K A N N K Q R Q Q K K K Y L I P S H I S K L T I N N V N K S K N T * F L R T F Q S * Q * T T S T K A ----:----|----:----|----:----|----:----|----:----|----:----| * F I G L E K A C K L A L L L C R * C F R F F V * N R R V N * L * C Y V V D V F L F Y R I G E C M E F S V I F L T L L L BsmI | FatI | |CviAII | || NspI TspGWI MseI TaqI | || NlaIII \ \ \ \ \\ \ CAAAAGCGTAAATAAATATCCATATCCGTTAATACATCGAATGCTTGGACATGCTAACTT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCGCATTTATTTATAGGTATAGGCAATTATGTAGCTTACGAACCTGTACGATTGAA / / / / / // TspGWI MseI | BsmI | |FatI TaqI | CviAII NlaIII NspI Q K R K * I S I S V N T S N A W T C * L K S V N K Y P Y P L I H R M L G H A N F K A * I N I H I R * Y I E C L D M L T S ----:----|----:----|----:----|----:----|----:----|----:----| C F R L Y I D M D T L V D F A Q V H * S A F A Y I F I W I R * Y M S H K S M S V L L T F L Y G Y G N I C R I S P C A L K CviRI* SmlI | BsmI AflII | MaeIII TfiI |MseI | | MboII HinfI Hpy188I Hpy188I |BsmAI | | | Hin4II* | Hpy188I \ \ \\ \ \ \ \ \ \ CCGAAGTATTCAGAAGTCTCTTAAGAAGAATGCAGTTACATATTTGAAGGAATCGGATAT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTTCATAAGTCTTCAGAGAATTCTTCTTACGTCAATGTATAAACTTCCTTAGCCTATA / / /// / / / // Hpy188I Hpy188I ||BsmAI | | Hin4II* |Hpy188I |AflII | | MaeIII HinfI |SmlI | MboII TfiI MseI CviRI* BsmI P K Y S E V S * E E C S Y I F E G I G Y R S I Q K S L K K N A V T Y L K E S D I E V F R S L L R R M Q L H I * R N R I L ----:----|----:----|----:----|----:----|----:----|----:----| G F Y E S T E * S S H L * M N S P I P Y E S T N L L R K L L I C N C I Q L F R I R L I * F D R L F F A T V Y K F S D S I NheI |MaeI ||Cac8I Hpy178III* ||| BmtI MslI | Tsp4CI* \\\ \ \ \ \ TGAATGGTCTAACGCTAGCACATATCAATGTCCTGACTGTCTAATCGGCAAAAGCACGAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| ACTTACCAGATTGCGATCGTGTATAGTTACAGGACTGACAGATTAGCCGTTTTCGTGCTT / /// / / / | ||NheI MslI | Tsp4CI* | |MaeI Hpy178III* | Cac8I BmtI * M V * R * H I S M S * L S N R Q K H E E W S N A S T Y Q C P D C L I G K S T K N G L T L A H I N V L T V * S A K A R N ----:----|----:----|----:----|----:----|----:----|----:----| Q I T * R * C M D I D Q S D L R C F C S N F P R V S A C I L T R V T * D A F A R S H D L A L V Y * H G S Q R I P L L V F MslI |FatI |AflIII |BspLU11I* ||CviAII ||| NspI ||| NlaIII ||| | BaeI ||| | | MboI ||| | | | DpnI ||| | | | |BstKTI ||| | | | ||Hpy178III* ||| | | | ||| Csp6I ||| | | | ||| |RsaI ||| | | | ||| || BdaI ||| | | | ||| || BdaI ||| | | | ||| || | TfiI ||| | | | ||| || | HinfI TatI ||| | | | ||| || | | NdeI |Csp6I ||| | | | ||| || | | | BaeI ||RsaI ||| | | | ||| BinI* || | | | | CviJI ||ScaI \\\ \ \ \ \\\ \ \\ \ \ \ \ \ \\\ ACATAGACATGTCAAAGGATCACGACTAAAGTACCAAGAATCATATGAGCCTTTTCAGTA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TGTATCTGTACAGTTTCCTAGTGCTGATTTCATGGTTCTTAGTATACTCGGAAAAGTCAT // /// // / / / // // / / // || ||| || | | BinI* |Csp6I || | CviJI |Csp6I || ||| || | | |BdaI || NdeI ScaI || ||| || | | |BdaI |BaeI RsaI || ||| || | | RsaI HinfI || ||| || | Hpy178III* TfiI || ||| || MboI || ||| |DpnI || ||| BstKTI || ||BspLU11I* || ||AflIII || ||FatI || |CviAII || BaeI |NlaIII |NspI MslI T * T C Q R I T T K V P R I I * A F S V H R H V K G S R L K Y Q E S Y E P F Q Y I D M S K D H D * S T K N H M S L F S T ----:----|----:----|----:----|----:----|----:----|----:----| V Y V H * L I V V L T G L I M H A K E T F M S M D F S * S * L V L F * I L R K L C L C T L P D R S F Y W S D Y S G K * Y AsuI* ApaLI AvaII | CviRI* |BmgT120I | Hpy166II || TatI | | SduI CviRI* || Bsp1407I | | BseSI | BdaI || |Csp6I FalI | | HgiAI* | BdaI || ||RsaI FalI | | | SetI Hin4II* \ \ \\ \\\ \ \ \ \ \ \ CTTGCACACCGATATATTTGGTCCTGTACATCACTTACCGAAAAGTGCACCTTCTTACTT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGTGTGGCTATATAAACCAGGACATGTAGTGAATGGCTTTTCACGTGGAAGAATGAA / / / // /// / /// / | | BdaI || ||Bsp1407I | ||ApaLI Hin4II* | | BdaI || ||TatI | |SetI | CviRI* || ||FalI | Hpy166II TatI || ||FalI | CviRI* || |Csp6I HgiAI* || RsaI BseSI |AvaII SduI |AsuI* BmgT120I L A H R Y I W S C T S L T E K C T F L L L H T D I F G P V H H L P K S A P S Y F C T P I Y L V L Y I T Y R K V H L L T L ----:----|----:----|----:----|----:----|----:----|----:----| S A C R Y I Q D Q V D S V S F H V K K S V Q V G I Y K T R Y M V * R F T C R R V K C V S I N P G T C * K G F L A G E * K McrI* FalI TaqII Csp6I |Tsp4CI* FalI | TfiI Hpy166II || Hpy178III* | Hpy166II | HinfI |RsaI || |Hpy99I \ \ \ \ \\ \\ \\ TATATCGTTTACAGATGAGAAAACCAGATTCCAATGGGTGTACCCATTACACGACCGTCG 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| ATATAGCAAATGTCTACTCTTTTGGTCTAAGGTTACCCACATGGGTAATGTGCTGGCAGC / / / / /// / / FalI Hpy166II TaqII HinfI ||Csp6I | Tsp4CI* FalI TfiI |RsaI | Hpy99I Hpy166II McrI* Y I V Y R * E N Q I P M G V P I T R P S I S F T D E K T R F Q W V Y P L H D R R Y R L Q M R K P D S N G C T H Y T T V V ----:----|----:----|----:----|----:----|----:----|----:----| * I T * L H S F W I G I P T G M V R G D K Y R K C I L F G S E L P H V W * V V T I D N V S S F V L N W H T Y G N C S R R TfiI TaqI XmnI HinfI MboII MnlI ClaI MseI TspEI \ \ \ \ \ \ TGAAGAATCTATCCTCAATGTTTTTACATCGATATTAGCATTTATTAAGAACCAATTCAA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| ACTTCTTAGATAGGAGTTACAAAAATGTAGCTATAATCGTAAATAATTCTTGGTTAAGTT / / / / / / / / | | MboII MnlI ClaI MseI | TspEI | HinfI TaqI XmnI | TfiI Hpy178III* * R I Y P Q C F Y I D I S I Y * E P I Q E E S I L N V F T S I L A F I K N Q F N K N L S S M F L H R Y * H L L R T N S M ----:----|----:----|----:----|----:----|----:----|----:----| H L I * G * H K * M S I L M * * S G I * T F F R D E I N K C R Y * C K N L V L E S S D I R L T K V D I N A N I L F W N L BccI |Hin4I || Hpy178III* || | MboI || | |XcmI || | ||DpnI || | |||BstKTI || | |||| CviJI || | |||| BinI* || | |||| |NlaIV || | |||| || Hpy188I || | |||| || | TatI || | |||| || | |Csp6I || | |||| || | ||RsaI || | |||| || | |||Hpy166II Cac8I || | |||| || | |||| MboII | FnuDII* || | |||| || | |||| TspDTI | | MaeI || | |||| || | |||| | Hin4I Ksp632I* \ \ \ \\ \ \\\\ \\ \ \\\\ \ \ \ TGCTCGCGTTCTAGTTATCCAGATGGATCGTGGCTCCGAGTACACTAACAAAACTCTTCA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| ACGAGCGCAAGATCAATAGGTCTACCTAGCACCGAGGCTCATGTGATTGTTTTGAGAAGT / / // / / /// / // / ////// | | || | | ||| | || | |||||MboII | | || | | ||| | || | ||||TspDTI | | || | | ||| | || | |||Hin4I | | || | | ||| | || | ||TatI | | || | | ||| | || | |Hpy166II | | || | | ||| | || | |Csp6I | | || | | ||| | || | RsaI | | || | | ||| | || Hpy188I | | || | | ||| | |BinI* | | || | | ||| | |NlaIV | | || | | ||| | CviJI | | || | | ||| MboI | | || | | ||DpnI | | || | | |BstKTI | | || | | XcmI | | || | Hpy178III* | | || BccI | | |MaeI | | Hin4I | FnuDII* Cac8I C S R S S Y P D G S W L R V H * Q N S S A R V L V I Q M D R G S E Y T N K T L H L A F * L S R W I V A P S T L T K L F I ----:----|----:----|----:----|----:----|----:----|----:----| H E R E L * G S P D H S R T C * C F E E I S A N * N D L H I T A G L V S V F S K A R T R T I W I S R P E S Y V L L V R * FatI CviRI* TfiI |CviAII HinfI ||Cac8I | XbaI ||| SphI | |MaeI ||| NspI SecI* | |Hpy178III* MnlI SetI ||| NlaIII DsaI* | || BceAI \ \ \\\ \ \ \ \\ \ TAAGTTCTTTACGAACAGAGGTATTACTGCATGCTATACAACCACGGCAGATTCTAGAGC 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| ATTCAAGAAATGCTTGTCTCCATAATGACGTACGATATGTTGGTGCCGTCTAAGATCTCG / / / / /// / / // | MnlI SetI | ||FatI DsaI* | |HgiAI* Ksp632I* | |CviAII SecI* | |XbaI | Cac8I | |SduI CviRI* | Hpy178III* NlaIII | MaeI NspI HinfI SphI TfiI * V L Y E Q R Y Y C M L Y N H G R F * S K F F T N R G I T A C Y T T T A D S R A S S L R T E V L L H A I Q P R Q I L E H ----:----|----:----|----:----|----:----|----:----|----:----| Y T R * S C L Y * Q M S Y L W P L N * L M L E K R V S T N S C A I C G R C I R S L N K V F L P I V A H * V V V A S E L A SduI HgiAI* | DraIII Csp6I TspDTI TspRI | Tsp4CI* MseI |RsaI MseI | BtsI |BsrDI \ \ \ \\ \ \ \ \\ ACACGGTGTCGCTGAACGATTAAATCGTACTTTATTAAACGATTGTCGCACACTGCTTCA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGCCACAGCGACTTGCTAATTTAGCATGAAATAATTTGCTAACAGCGTGTGACGAAGT / / / // / / / / | Tsp4CI* MseI |Csp6I MseI | TspRI BsrDI DraIII RsaI | BtsI BceAI TspDTI T R C R * T I K S Y F I K R L S H T A S H G V A E R L N R T L L N D C R T L L H T V S L N D * I V L Y * T I V A H C F I ----:----|----:----|----:----|----:----|----:----|----:----| V R H R Q V I L D Y K I L R N D C V A E C V T D S F S * I T S * * V I T A C Q K C P T A S R N F R V K N F S Q R V S S * TaqI AccI | ApoI BtsI | TspEI MslI TspRI | | BspCNI TspDTI CviRI* |Hpy166II XcmI DdeI | | |BseMII | Hpy188I \ \\ \ \ \ \ \\ \ \ TTGCAGTGGTCTACCAAATCATCTATGGTTCTCAGCAGTCGAATTTTCTACTATAATCAG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTCACCAGATGGTTTAGTAGATACCAAGAGTCGTCAGCTTAAAAGATGATATTAGTC / / / // / / /// / / / | | | |AccI XcmI DdeI ||| TspEI | Hpy188I | | | Hpy166II ||| ApoI TspDTI | | BtsI ||BseMII | CviRI* |BspCNI | MslI TaqI TspRI L Q W S T K S S M V L S S R I F Y Y N Q C S G L P N H L W F S A V E F S T I I R A V V Y Q I I Y G S Q Q S N F L L * S E ----:----|----:----|----:----|----:----|----:----|----:----| N C H D V L D D I T R L L R I K * * L * M A T T * W I M * P E * C D F K R S Y D Q L P R G F * R H N E A T S N E V I I L CviRI* | BspMI | | FatI | | |CviAII | | || NspI | | || CviRI* | | || NlaIII | | || |BcgI | | || || SetI ApoI | | || || |MwoI TspEI | | || || || AluI | EcoP15I BcgI | | || || || CviJI | | HphI |BsmAI | | || || || | SetI \ \ \ \\ \ \ \\ \\ \\ \ \ AAATTCATTAGTCTCACCAAAAAAACGATAAATCTGCAAGACAACATGCAGGTTTAGCTG 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAGTAATCAGAGTGGTTTTTTTGCTATTTAGACGTTCTGTTGTACGTCCAAATCGAC / / / / // /// / / / EcoP15I BcgI BsmAI CviRI* || ||| | | CviJI TspEI || ||| | | AluI ApoI || ||| | SetI HphI || ||| MwoI || ||SetI || |CviRI* || |FatI || CviAII || BcgI |NlaIII |NspI BspMI K F I S L T K K T I N L Q D N M Q V * L N S L V S P K K R * I C K T T C R F S W I H * S H Q K N D K S A R Q H A G L A G ----:----|----:----|----:----|----:----|----:----|----:----| F N M L R V L F V I F R C S L M C T * S S I * * D * W F F S L D A L C C A P K A F E N T E G F F R Y I Q L V V H L N L Q HindII Hpy166II | AgeI MseI | BetI* |HpaI MlyI | Cfr10I |HindII PleI BsrI TaqII SetI | |HpaII |Hpy166II | Hpy178III* \ \ \ \ \\ \\ \ \ GACTGGACATTACTACTATACTACCTTTCGGTCAACCGGTTATAGTTAACAACCATAATC 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CTGACCTGTAATGATGATATGATGGAAAGCCAGTTGGCCAATATCAATTGTTGGTATTAG / / / / // // // BsrI TaqII SetI | |Cfr10I |MseI |PleI | |BetI* Hpy166II MlyI | |AgeI HindII | HpaII HpaI Hpy166II HindII D W T L L L Y Y L S V N R L * L T T I I T G H Y Y Y T T F R S T G Y S * Q P * S L D I T T I L P F G Q P V I V N N H N P ----:----|----:----|----:----|----:----|----:----|----:----| S Q V N S S Y * R E T L R N Y N V V M I P S S M V V I S G K P * G T I T L L W L V P C * * * V V K R D V P * L * C G Y D BsmI | MnlI | |BssKI | |EcoRII | || FokI | || ScrFI BseGI | || BseBI | MaeIII FokI BseGI | || | MaeIII | Tsp45I | HinfI | MslI | || | | SetI | | Hpy178III* | | TaqI | BsiI* | || | | | TspGWI | | | TsoI \ \ \ \ \ \ \\ \ \ \ \ \ \ \ \ CCGACTCGAAAATACATCCTCGTGGCATTCCAGGTTACGCCTTACATCCGTCACGAAACT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTGAGCTTTTATGTAGGAGCACCGTAAGGTCCAATGCGGAATGTAGGCAGTGCTTTGA / // / / / / / // // / / // | || | BseGI | | | || || | BseGI |Hpy178III* | || TaqI | | | || || MaeIII |Tsp45I | |HinfI | | | || |TspGWI |MaeIII | FokI | | | || |FokI TsoI Hpy178III* | | | || EcoRII | | | || BssKI | | | |BseBI | | | |ScrFI | | | SetI | | MnlI | BsiI* | BsmI MslI P T R K Y I L V A F Q V T P Y I R H E T R L E N T S S W H S R L R L T S V T K L D S K I H P R G I P G Y A L H P S R N S ----:----|----:----|----:----|----:----|----:----|----:----| G V R F Y M R T A N W T V G * M R * S V G S E F I C G R P M G P * A K C G D R F R S S F V D E H C E L N R R V D T V F S CviJI MseI TspEI | MboII | BccI Tsp4CI* | MaeII \ \ \ \ \ \ \ CTTATGGCTATATTATCTATCTTCCATCATTAAAAAAGACAGTAGATACTACCAATTACG 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| GAATACCGATATAATAGATAGAAGGTAGTAATTTTTTCTGTCATCTATGATGGTTAATGC / / // / / / | MboII |BccI Tsp4CI* | MaeII CviJI MseI TspEI TaiI SetI L M A I L S I F H H * K R Q * I L P I T L W L Y Y L S S I I K K D S R Y Y Q L R Y G Y I I Y L P S L K K T V D T T N Y V ----:----|----:----|----:----|----:----|----:----|----:----| R I A I N D I K W * * F L C Y I S G I V E * P * I I * R G D N F F V T S V V L * K H S Y * R D E M M L F S L L Y * W N R TspEI | AsuI* | AvaII SetI | |BmgT120I TaiI | || BsrI TaqI \ \ \\ \ \ TTATATTACAAAACAAGCAAACGAAATTGGACCAGTTCGACTACGATACACTCACTTTTG 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| AATATAATGTTTTGTTCGTTTGCTTTAACCTGGTCAAGCTGATGCTATGTGAGTGAAAAC / /// / | ||AvaII TaqI | ||AsuI* | |BmgT120I | BsrI TspEI L Y Y K T S K R N W T S S T T I H S L L Y I T K Q A N E I G P V R L R Y T H F * I L Q N K Q T K L D Q F D Y D T L T F D ----:----|----:----|----:----|----:----|----:----|----:----| N Y * L V L L R F Q V L E V V I C E S K T I N C F L C V F N S W N S * S V S V K * I V F C A F S I P G T R S R Y V * K Q BsaBI |MboI || DpnI || |BstKTI || || BsaBI MseI CviJI TsoI \\ \\ \ \ \ \ ATGATGATCTCAATCGTTTAACAGCCCATAACCAATCTTTTATTGAACAAAATGAAACAG 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| TACTACTAGAGTTAGCAAATTGTCGGGTATTGGTTAGAAAATAACTTGTTTTACTTTGTC / // // / / / | || |BsaBI | CviJI TsoI | || MboI MseI | |DpnI | BstKTI BsaBI M M I S I V * Q P I T N L L L N K M K Q * * S Q S F N S P * P I F Y * T K * N R D D L N R L T A H N Q S F I E Q N E T E ----:----|----:----|----:----|----:----|----:----|----:----| I I I E I T * C G M V L R K N F L I F C S S S R L R K V A W L W D K I S C F S V H H D * D N L L G Y G I K * Q V F H F L TfiI HinfI | Hin4I | Hin4I | AlwNI | | MboI | | BclI | | Hpy188I | | | DpnI TspDTI | | | |FatI |NdeI | | | |BspHI || MboI | | | |BstKTI || BclI | | | ||CviAII Hin4I || | DpnI | | | ||Hpy178III* Hin4I || | |BstKTI | | | ||| NlaIII Hpy188I |BinI* \\ \ \\ \ \ \ \\\ \ \ \\ AGCAGTCATATGATCAAAATACAGAATCTGATCATGACTATCAATCGGAGATTGAAATAA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTCAGTATACTAGTTTTATGTCTTAGACTAGTACTGATAGTTAGCCTCTAACTTTATT / / // / / / // //// // / / | | || BclI | | || |||| |BspHI Hpy188I Hin4I | | || MboI | | || |||| |FatI Hin4I | | |DpnI | | || |||| Hpy178III* | | BstKTI | | || |||| CviAII | NdeI | | || |||BclI TspDTI | | || |||MboI | | || ||NlaIII | | || |DpnI | | || BstKTI | | |Hpy188I | | HinfI | | TfiI | AlwNI Hin4I Hin4I S S H M I K I Q N L I M T I N R R L K * A V I * S K Y R I * S * L S I G D * N K Q S Y D Q N T E S D H D Y Q S E I E I N ----:----|----:----|----:----|----:----|----:----|----:----| L L * I I L I C F R I M V I L R L N F Y S C D Y S * F V S D S * S * * D S I S I A T M H D F Y L I Q D H S D I P S Q F L MboI Hpy188I | DpnI | |BstKTI | ||PpiI | ||| MaeI | ||| Hin4I | ||| Hin4I | ||| | BslFI | ||| | | Hpy166II PpiI | ||| | | | MnlI | Hin4I | ||| | | | | XmnI Eam1105I | Hin4I TspEI \ \\\ \ \ \ \ \ \ \ \ \ ACTCTGATCCTCTAGTGAACGACTTCTCGTCCCAATCAATAAACCCTTTACAATTAGACA 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGACTAGGAGATCACTTGCTGAAGAGCAGGGTTAGTTATTTGGGAAATGTTAATCTGT / / // / / // / / / / / | | || MboI | || | Eam1105I | Hin4I TspEI | | |Hin4I | || XmnI | Hin4I | | |Hin4I | |BslFI PpiI | | |DpnI | |MnlI | | BstKTI | Hpy166II | Hpy188I MaeI | PpiI BinI* T L I L * * T T S R P N Q * T L Y N * T L * S S S E R L L V P I N K P F T I R Q S D P L V N D F S S Q S I N P L Q L D K ----:----|----:----|----:----|----:----|----:----|----:----| V R I R * H V V E R G L * Y V R * L * V F E S G R T F S K E D W D I F G K C N S S Q D E L S R S R T G I L L G K V I L C Csp6I |RsaI ||MaeII |||BsaAI ||||ApaLI |||||SetI |||||TaiI ||||||CviRI* ||||||Hpy166II ||||||| SduI ||||||| BseSI NlaIV ||||||| HgiAI* Hpy188I | BsrI ||||||| | SfaNI | MboII \ \ \\\\\\\ \ \ \ \ AGGAACCAGTCCAAAAAGTACGTGCACCAAAAGAAGTTGATGCCGACATATCTGAATACA 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTGGTCAGGTTTTTCATGCACGTGGTTTTCTTCAACTACGGCTGTATAGACTTATGT / //// / / / / / NlaIV |||| | ApaLI SfaNI | MboII BsrI |||| Hpy166II Hpy188I |||| CviRI* |||HgiAI* |||MaeII |||BseSI |||SduI ||BsaAI |Csp6I RsaI TaiI SetI R N Q S K K Y V H Q K K L M P T Y L N T G T S P K S T C T K R S * C R H I * I Q E P V Q K V R A P K E V D A D I S E Y N ----:----|----:----|----:----|----:----|----:----|----:----| L F W D L F Y T C W F F N I G V Y R F V L S G T W F T R A G F S T S A S M D S Y P V L G F L V H V L L L Q H R C I Q I C BccI | MboI | | DpnI | | |BstKTI | | || Csp6I TaqII | | || |RsaI MseI |Csp6I SspI | | || ||Hpy166II VspI ||RsaI \ \ \ \\ \\\ \ \\\ ATATTCTTCCATCTACTATACGATCTCGTACACCCCATATCATTAATAAAGAGAGTACCG 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| TATAAGAAGGTAGATGATATGCTAGAGCATGTGGGGTATAGTAATTATTTCTCTCATGGC / / // / // / / // SspI | || | |Hpy166II VspI | |Csp6I | || | |Csp6I MseI | RsaI | || | RsaI TaqII | || MboI | |DpnI | BstKTI BccI I F F H L L Y D L V H P I S L I K R V P Y S S I Y Y T I S Y T P Y H * * R E Y R I L P S T I R S R T P H I I N K E S T E ----:----|----:----|----:----|----:----|----:----|----:----| I N K W R S Y S R T C G M D N I F L T G L I R G D V I R D R V G W I M L L S L V Y E E M * * V I E Y V G Y * * Y L S Y R Acc65I HgiCI* |Csp6I ||RsaI ||NlaIV ||| KpnI BsgI ||| |Tsp4CI* |PshAI ||| || TfiI || AccI ||| || HinfI || |Hpy166II ||| || | Hpy188I MaeI || || SetI ||| || | | HphI |SetI || || |BtsI CviRI* \\\ \\ \ \ \ \\ \\ \\ \\ \ AAATGGGTGGTACCGTTGAATCAGATACTACTTCACCTAGACACTCGTCTACCTTCACTG 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| TTTACCCACCATGGCAACTTAGTCTATGATGAAGTGGATCTGTGAGCAGATGGAAGTGAC / /// // / / / / / // / / | ||Tsp4CI* || HphI SetI | | | || TspRI CviRI* | ||HgiCI* |Hpy188I | | | || BtsI | ||Acc65I HinfI | | | |AccI | |Csp6I TfiI | | | |SetI | NlaIV | | | Hpy166II | RsaI | | PshAI KpnI | BsgI MaeI K W V V P L N Q I L L H L D T R L P S L N G W Y R * I R Y Y F T * T L V Y L H C M G G T V E S D T T S P R H S S T F T A ----:----|----:----|----:----|----:----|----:----|----:----| F H T T G N F * I S S * R S V R R G E S S I P P V T S D S V V E G L C E D V K V F P H Y R Q I L Y * K V * V S T * R * Q XcmI | BssKI | SexAI | EcoRII | | ScrFI TspRI | | BseBI Csp6I Hin4II* | | |SetI |RsaI Hin4I SetI MnlI \ \ \ \\ \\ \ \ \ CACGAAACCAAAACCGACCTGGTAGTACCAATGAGATGATTGATTTGACCTCACAGGATA 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCTTTGGTTTTGGCTGGACCATCATGGTTACTCTACTAACTAAACTGGAGTGTCCTAT / / / / / /// / / / Hin4II* | | | | ||Hin4I SetI | Hin4I | | | | |Csp6I MnlI | | | | RsaI | | | EcoRII | | | SexAI | | | BssKI | | BseBI | | ScrFI | SetI XcmI H E T K T D L V V P M R * L I * P H R I T K P K P T W * Y Q * D D * F D L T G * R N Q N R P G S T N E M I D L T S Q D R ----:----|----:----|----:----|----:----|----:----|----:----| C S V L V S R T T G I L H N I Q G * L I A R F W F R G P L V L S I I S K V E C S V F G F G V Q Y Y W H S S Q N S R V P Y TaqII | AflIII MseI | | MaeII MnlI |TspEI | | | SetI | Csp6I |Hin4I | | | TaiI | |RsaI NlaIV \\ \ \ \ \ \ \\ \ GAGTTAATTATGGACTTGAAAACATCAAAACTACACGTTTGGGTGGTACGGAGGAACCAT 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAATTAATACCTGAACTTTTGTAGTTTTGATGTGCAAACCCACCATGCCTCCTTGGTA / / / / / / // / | TspEI TaqII | | | |Csp6I NlaIV MseI | | | RsaI | | MnlI | AflIII | MaeII TaiI SetI E L I M D L K T S K L H V W V V R R N H S * L W T * K H Q N Y T F G W Y G G T I V N Y G L E N I K T T R L G G T E E P Y ----:----|----:----|----:----|----:----|----:----|----:----| S N I I S K F V D F S C T Q T T R L F W L T L * P S S F M L V V R K P P V S S G L * N H V Q F C * F * V N P H Y P P V M Csp6I Hin4I TspGWI |RsaI Hin4I \ \\ \ ATATTCAACGAAATAGTGATACAAATATCAAATACAGGACTACAAATAGTACGCCCTCAA 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| TATAAGTTGCTTTATCACTATGTTTATAGTTTATGTCCTGATGTTTATCATGCGGGAGTT / /// TspGWI ||Hin4I ||Hin4I |Csp6I RsaI I F N E I V I Q I S N T G L Q I V R P Q Y S T K * * Y K Y Q I Q D Y K * Y A L N I Q R N S D T N I K Y R T T N S T P S I ----:----|----:----|----:----|----:----|----:----|----:----| I N L S I T I C I D F V P S C I T R G * Y I * R F L S V F I L Y L V V F L V G E Y E V F Y H Y L Y * I C S * L Y Y A R L Tsp4CI* | TfiI | HinfI MnlI | | TspRI | Tsp4CI* | | | Hin4I | | Eam1105I | | | Hin4I MmeI BccI CviJI \ \ \ \ \ \ \ \ \ \ TAGATGACCGTTCGTCCAACAGTGAATCCACTACTCCCATCATCTCCATAGAAACAAAGG 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| ATCTACTGGCAAGCAGGTTGTCACTTAGGTGATGAGGGTAGTAGAGGTATCTTTGTTTCC / / / / / / / / / / | | | | | | HinfI MmeI BccI CviJI | | | | | | TfiI | | | | | Hin4I | | | | | Hin4I | | | | Tsp4CI* | | | TspRI | | Eam1105I | Tsp4CI* MnlI * M T V R P T V N P L L P S S P * K Q R R * P F V Q Q * I H Y S H H L H R N K G D D R S S N S E S T T P I I S I E T K A ----:----|----:----|----:----|----:----|----:----|----:----| Y I V T R G V T F G S S G D D G Y F C L I S S R E D L L S D V V G M M E M S V F L H G N T W C H I W * E W * R W L F L P EciI | BinI* | | MnlI | | | BsaBI | | | |MboI | | | |BamHI | | | |XhoII | | | || DpnI | | | || NlaIV | | | || |BstKTI | | | || ||AciI | | | || ||| BinI* | | | || ||| | MboII | | | || ||| | | TspGWI | | | || ||| | | | TaqI | | | || ||| | | | ClaI | | | || ||| | | | |MboI | | | || ||| | | | || DpnI | | | || ||| | | | || |BstKTI | | | || ||| | | | || || Hpy188I | | | || ||| | | | || || | MlyI | | | || ||| | | | || || | PleI | | | || ||| | | | || || | FatI | | | || ||| | | | || || | |CviAII \ \ \ \\ \\\ \ \ \ \\ \\ \ \\ CTGTATGTGATAATACACCCTCCATTGATACGGATCCGCCAGAATATCGATCTTCTGACC 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| GACATACACTATTATGTGGGAGGTAACTATGCCTAGGCGGTCTTATAGCTAGAAGACTGG / / / // / / /// // / / // EciI | | || | | ||| || | | |PleI | | || | | ||| || | | NlaIII | | || | | ||| || | | MlyI | | || | | ||| || | Hpy188I | | || | | ||| || MboI | | || | | ||| |DpnI | | || | | ||| BstKTI | | || | | ||| ClaI | | || | | ||| TaqI | | || | | ||TspGWI | | || | | |MboII | | || | | BinI* | | || | AciI | | || XhoII | | || BamHI | | || MboI | | |NlaIV | | |DpnI | | BstKTI | BsaBI BinI* MnlI L Y V I I H P P L I R I R Q N I D L L T C M * * Y T L H * Y G S A R I S I F * P V C D N T P S I D T D P P E Y R S S D H ----:----|----:----|----:----|----:----|----:----|----:----| S Y T I I C G G N I R I R W F I S R R V A T H S L V G E M S V S G G S Y R D E S Q I H Y Y V R W Q Y P D A L I D I K Q G MnlI MaeIII | Hin4I | |CviJI NlaIII | || TfiI | HinfI Hin4I | || HinfI Hpy178III* \ \ \ \ \\ \ \ ATGCGACTCCTAATATAATGCCTGACAAATCCTCAAAAAATGTTACGGCTGATTCTATTC 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| TACGCTGAGGATTATATTACGGACTGTTTAGGAGTTTTTTACAATGCCGACTAAGATAAG // / / / / / / / |FatI | Hin4I | | | CviJI HinfI | HinfI | | MaeIII TfiI CviAII | Hin4I MnlI M R L L I * C L T N P Q K M L R L I L F C D S * Y N A * Q I L K K C Y G * F Y S A T P N I M P D K S S K N V T A D S I L ----:----|----:----|----:----|----:----|----:----|----:----| M R S R I Y H R V F G * F I N R S I R N W A V G L I I G S L D E F F T V A S E I H S E * Y L A Q C I R L F H * P Q N * E MnlI Hpy178III* Hpy188I BceAI SetI | MseI | TspGWI \ \ \ \ \ \ TTGACGACCTCCCACTTCCTGACTTAACCCATAAATCTCCTACGGACACTTCTGATGTTT 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGCTGGAGGGTGAAGGACTGAATTGGGTATTTAGAGGATGCCTGTGAAGACTACAAA // / / / / / / || SetI | | MseI | TspGWI |BceAI | Hpy178III* Hpy188I Hpy178III* MnlI L T T S H F L T * P I N L L R T L L M F * R P P T S * L N P * I S Y G H F * C F D D L P L P D L T H K S P T D T S D V S ----:----|----:----|----:----|----:----|----:----|----:----| K V V E W K R V * G M F R R R V S R I N R S S R G S G S K V W L D G V S V E S T Q R G G V E Q S L G Y I E * P C K Q H K Hpy188I | TspEI | |TaqII TfiI | || BsrI HinfI \ \\ \ \ CAAAAGATATTCCACACATACACTCTCGTCAGACTAATTCCAGTTTGGGTGGTATGGATG 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCTATAAGGTGTGTATGTGAGAGCAGTCTGATTAAGGTCAAACCCACCATACCTAC / / // / | | |TspEI BseGI | | BsrI | TaqII Hpy188I Q K I F H T Y T L V R L I P V W V V W M K R Y S T H T L S S D * F Q F G W Y G * K D I P H I H S R Q T N S S L G G M D D ----:----|----:----|----:----|----:----|----:----|----:----| * F I N W V Y V R T L S I G T Q T T H I E F S I G C M C E R * V L E L K P P I S L L Y E V C V S E D S * N W N P H Y P H MboI FokI | DpnI MboII BseGI | Hpy188I | |BstKTI | MnlI \ \ \ \ \\ \ \ ATTCTAATGTTCTGACTACTACCAAAAGTAAGAAAAGATCATTAGAAGATAATGAAACTG 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGATTACAAGACTGATGATGGTTTTCATTCTTTTCTAGTAATCTTCTATTACTTTGAC / // // / / / HinfI |FokI || MboI | MnlI TfiI Hpy188I |DpnI MboII BstKTI I L M F * L L P K V R K D H * K I M K L F * C S D Y Y Q K * E K I I R R * * N * S N V L T T T K S K K R S L E D N E T E ----:----|----:----|----:----|----:----|----:----|----:----| I R I N Q S S G F T L F S * * F I I F S S E L T R V V V L L L F L D N S S L S V N * H E S * * W F Y S F I M L L Y H F Q TspDTI | SetI | BsmAI | | AvaI | | Hpy178III* | | |BmeT110I | | || BciVI | | || |FatI | | || ||CviAII Hpy178III* TspEI | | || ||| NlaIII | NlaIV MboI \ \ \ \\ \\\ \ \ \ \ AAATTGAGGTATCCCGAGACACATGGAATAATAAGAATATGAGAAGTCTGGAACCACCAA 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAACTCCATAGGGCTCTGTGTACCTTATTATTCTTATACTCTTCAGACCTTGGTGGTT // //// / / // / / |SetI |||| | | |FatI | NlaIV TspDTI |||| | | CviAII Hpy178III* TspEI |||| | NlaIII |||| BciVI |||AvaI ||BmeT110I |Hpy178III* BsmAI K L R Y P E T H G I I R I * E V W N H Q N * G I P R H M E * * E Y E K S G T T K I E V S R D T W N N K N M R S L E P P R ----:----|----:----|----:----|----:----|----:----|----:----| F N L Y G S V C P I I L I H S T Q F W W S I S T D R S V H F L L F I L L R S G G F Q P I G L C M S Y Y S Y S F D P V V L ApoI TspEI MboII | MseI | |TspEI | || TseI TaqI | || CviRI* ClaI | || |BisI |MboI DpnI | || ||BlsI || DpnI |TaqI | || ||| BdaI || |BstKTI |BstKTI | || ||| BdaI BbvI || || BsrI \\ \ \\ \\\ \ \ \\ \\ \ GATCGAAGAAACGCATAAATTTAATTGCAGCAATAAAAGGAGTGAAATCGATCAAACCAG 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGCTTCTTTGCGTATTTAAATTAACGTCGTTATTTTCCTCACTTTAGCTAGTTTGGTC // // / / / ///// / // / / || |TaqI | | | ||||TseI BbvI || | BsrI || MboI | | | ||||BdaI || MboI |DpnI | | | ||||BdaI |DpnI BstKTI | | | |||BisI BstKTI | | | ||BlsI ClaI | | | |CviRI* TaqI | | | TspEI | | MseI | TspEI | ApoI MboII D R R N A * I * L Q Q * K E * N R S N Q I E E T H K F N C S N K R S E I D Q T S S K K R I N L I A A I K G V K S I K P V ----:----|----:----|----:----|----:----|----:----|----:----| S R L F A Y I * N C C Y F S H F R D F W L D F F R M F K I A A I F P T F D I L G I S S V C L N L Q L L L L L S I S * V L TaqI SmlI AsuII AflII | BdaI |MseI BdaI | BdaI |SetI TspEI TspDTI BdaI \ \ \\ \ \ \ TTCGAACGACCTTAAGATATGATGAAGCAATTACATATAATAAAGACAACAAAGAAAAAG 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTTGCTGGAATTCTATACTACTTCGTTAATGTATATTATTTCTGTTGTTTCTTTTTC / / // / / / | SetI |AflII | TspDTI BdaI AsuII |SmlI TspEI BdaI BdaI MseI BdaI TaqI F E R P * D M M K Q L H I I K T T K K K S N D L K I * * S N Y I * * R Q Q R K R R T T L R Y D E A I T Y N K D N K E K D ----:----|----:----|----:----|----:----|----:----|----:----| N S R G * S I I F C N C I I F V V F F F T R V V K L Y S S A I V Y L L S L L S F E F S R L I H H L L * M Y Y L C C L F L HindIII | AluI BdaI | CviJI BdaI | | SetI TspEI CviJI TsoI BciVI \ \ \ \ \ \ \ ACAGATATGTTGAAGCTTATCATAAAGAAATTAGCCAACTATTGAAAATGAACACTTGGG 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTATACAACTTCGAATAGTATTTCTTTAATCGGTTGATAACTTTTACTTGTGAACCC / / / / / / / | | HindIII | CviJI TsoI BciVI | CviJI TspEI | AluI BdaI SetI BdaI T D M L K L I I K K L A N Y * K * T L G Q I C * S L S * R N * P T I E N E H L G R Y V E A Y H K E I S Q L L K M N T W D ----:----|----:----|----:----|----:----|----:----|----:----| V S I N F S I M F F N A L * Q F H V S P S L Y T S A * * L S I L W S N F I F V Q C I H Q L K D Y L F * G V I S F S C K P BinI* | MboI | XhoII | | DpnI TspDTI SspI | | |BstKTI \ \ \ \ \\ ATACAAACAAATATTATGATAGAAATGACATAGATCCTAAAAAAGTAATAAACTCAATGT 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| TATGTTTGTTTATAATACTATCTTTACTGTATCTAGGATTTTTTCATTATTTGAGTTACA / / / // / TspDTI SspI | || XhoII | || MboI | |DpnI | BstKTI BinI* I Q T N I M I E M T * I L K K * * T Q C Y K Q I L * * K * H R S * K S N K L N V T N K Y Y D R N D I D P K K V I N S M F ----:----|----:----|----:----|----:----|----:----|----:----| I C V F I I I S I V Y I R F F Y Y V * H S V F L Y * S L F S M S G L F T I F E I Y L C I N H Y F H C L D * F L L L S L T BccI AluI | MaeII Csp6I CviJI | | SetI |RsaI |MaeI MnlI MseI | | TaiI ||Hpy166II ||SetI | CviRI* \ \ \ \ \\\ \\\ \ \ TTATATTTAACAAGAAACGTGATGGTACACACAAAGCTAGATTTGTTGCAAGAGGCGACA 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| AATATAAATTGTTCTTTGCACTACCATGTGTGTTTCGATCTAAACAACGTTCTCCGCTGT / / / // / / / / / MseI | MaeII || | | MaeI | CviRI* TaiI || | CviJI MnlI SetI || | AluI BccI || SetI |Hpy166II |Csp6I RsaI L Y L T R N V M V H T K L D L L Q E A T Y I * Q E T * W Y T Q S * I C C K R R H I F N K K R D G T H K A R F V A R G D I ----:----|----:----|----:----|----:----|----:----|----:----| K Y K V L F T I T C V F S S K N C S A V N I N L L F R S P V C L A L N T A L P S * I * C S V H H Y V C L * I Q Q L L R C NdeI |Hin4I Tsp4CI* |Hin4I |Csp6I || TfiI ||RsaI || HinfI ||| Hin4I || | Hpy188I ||| Hin4I || | | CviRI* ||| | MslI CviRI* \\ \ \ \ \\\ \ \ \ TTCAACACCCCGATACATATGATTCTGATATGCAATCCAATACCGTACATCACTATGCAC 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTGTGGGGCTATGTATACTAAGACTATACGTTAGGTTATGGCATGTAGTGATACGTG / / // / / /// / / / Hin4I NdeI || CviRI* | ||| | | CviRI* Hin4I |Hpy188I | ||| | TspRI HinfI | ||| MslI TfiI | ||Csp6I | |RsaI | Hin4I | Hin4I Tsp4CI* F N T P I H M I L I C N P I P Y I T M H S T P R Y I * F * Y A I Q Y R T S L C T Q H P D T Y D S D M Q S N T V H H Y A L ----:----|----:----|----:----|----:----|----:----|----:----| N L V G I C I I R I H L G I G Y M V I C M * C G S V Y S E S I C D L V T C * * A E V G R Y M H N Q Y A I W Y R V D S H V TspRI | AcyI | MaeII | |ZraI | |MaeIII | |Tsp45I | || SetI Hin4I | || TaiI | AluI | || AatII | CviJI | || | DrdI | PvuII | || | | Tsp4CI* | NspBII* | || | | | TspRI | | SetI \ \\ \ \ \ \ \ \ \ TGATGACGTCACTGTCAATCGCATTAGACAACGACTATTATATCACACAGCTGGACATAT 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| ACTACTGCAGTGACAGTTAGCGTAATCTGTTGCTGATAATATAGTGTGTCGACCTGTATA / /// / / / / | ||| Tsp4CI* Hin4I | NspBII* | ||| Tsp45I | PvuII | ||| MaeIII | CviJI | ||DrdI | AluI | |MaeII SetI | |AcyI | TspRI | ZraI AatII TaiI SetI * * R H C Q S H * T T T I I S H S W T Y D D V T V N R I R Q R L L Y H T A G H I M T S L S I A L D N D Y Y I T Q L D I S ----:----|----:----|----:----|----:----|----:----|----:----| Q H R * Q * D C * V V V I I D C L Q V Y S I V D S D I A N S L S * * I V C S S M S S T V T L R M L C R S N Y * V A P C I MnlI MnlI Hin4I EcoRV TspEI MboII SetI | BsiYI* \ \ \ \ \ \ \ \ CCTCTGCTTACTTATATGCTGATATCAAAGAAGAATTATACATAAGACCTCCACCACATT 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGACGAATGAATATACGACTATAGTTTCTTCTTAATATGTATTCTGGAGGTGGTGTAA / / / / / / / | Hin4I EcoRV | | SetI BsiYI* MnlI | MboII MnlI TspEI P L L T Y M L I S K K N Y T * D L H H I L C L L I C * Y Q R R I I H K T S T T F S A Y L Y A D I K E E L Y I R P P P H L ----:----|----:----|----:----|----:----|----:----|----:----| G R S V * I S I D F F F * V Y S R W W M D E A * K Y A S I L S S N Y M L G G G C R Q K S I H Q Y * L L I I C L V E V V N MaeII | SetI SetI TspEI | TaiI \ \ \ \ TAGGTTTGAATGATAAATTACTACGTTTGAGAAAATCACTCTATGGTTTGAAACAAAGTG 4450 4460 4470 4480 4490 4500 ----:----|----:----|----:----|----:----|----:----|----:----| ATCCAAACTTACTATTTAATGATGCAAACTCTTTTAGTGAGATACCAAACTTTGTTTCAC / / / / SetI | | MaeII | TaiI | SetI TspEI * V * M I N Y Y V * E N H S M V * N K V R F E * * I T T F E K I T L W F E T K W G L N D K L L R L R K S L Y G L K Q S G ----:----|----:----|----:----|----:----|----:----|----:----| * T Q I I F * * T Q S F * E I T Q F L T K P K F S L N S R K L F D S * P K F C L L N S H Y I V V N S F I V R H N S V F H FatI |CviAII || NspI TspDTI TspEI || CviRI* CviRI* BsrI MseI | MseI | BcgI || NlaIII \ \ \ \ \ \ \ \\ \ GTGCAAACTGGTATGAAACCATTAAATCATATTTAATAAATTGTTGCGACATGCAAGAAG 4510 4520 4530 4540 4550 4560 ----:----|----:----|----:----|----:----|----:----|----:----| CACGTTTGACCATACTTTGGTAATTTAGTATAAATTATTTAACAACGCTGTACGTTCTTC / / / / / / / / // CviRI* BsrI | TspDTI MseI | TspEI | |CviRI* MseI BcgI | |FatI | CviAII NlaIII NspI V Q T G M K P L N H I * * I V A T C K K C K L V * N H * I I F N K L L R H A R S A N W Y E T I K S Y L I N C C D M Q E V ----:----|----:----|----:----|----:----|----:----|----:----| T C V P I F G N F * I * Y I T A V H L F P A F Q Y S V M L D Y K I F Q Q S M C S H L S T H F W * I M N L L N N R C A L L FatI BseGI |CviAII || BcgI BccI || NlaIII | AciI || | FokI MaeIII BdaI | FnuDII* || | | MseI | TspEI BdaI \ \ \\ \ \ \ \ \ \ TTCGCGGATGGTCATGCGTATTTAAGAATAGTCAAGTAACAATTTGCTTATTCGTTGATG 4570 4580 4590 4600 4610 4620 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCGCCTACCAGTACGCATAAATTCTTATCAGTTCATTGTTAAACGAATAAGCAACTAC / / / / / /// // / / / | | | | | ||FatI |MseI | TspEI BdaI | | | | | |CviAII FokI MaeIII BdaI | | | | | BcgI | | | | NlaIII | | | BseGI | | AciI | FnuDII* BccI F A D G H A Y L R I V K * Q F A Y S L M S R M V M R I * E * S S N N L L I R * * R G W S C V F K N S Q V T I C L F V D D ----:----|----:----|----:----|----:----|----:----|----:----| N A S P * A Y K L I T L Y C N A * E N I T R P H D H T N L F L * T V I Q K N T S E R I T M R I * S Y D L L L K S I R Q H MseI | BdaI | BdaI SmlI | | CviRI* Bce83I* | Hpy178III* \ \ \ \ \ \ ATATGATATTATTCAGCAAAGACTTAAATGCAAATAAGAAAATCATAACAACACTCAAGA 4630 4640 4650 4660 4670 4680 ----:----|----:----|----:----|----:----|----:----|----:----| TATACTATAATAAGTCGTTTCTGAATTTACGTTTATTCTTTTAGTATTGTTGTGAGTTCT // / / / || CviRI* Bce83I* Hpy178III* |MseI SmlI BdaI BdaI I * Y Y S A K T * M Q I R K S * Q H S R Y D I I Q Q R L K C K * E N H N N T Q E M I L F S K D L N A N K K I I T T L K K ----:----|----:----|----:----|----:----|----:----|----:----| I H Y * E A F V * I C I L F D Y C C E L S I I N N L L S K F A F L F I M V V S L Y S I I * C L S L H L Y S F * L L V * S Hin4I Hin4I Csp6I | HphI |RsaI Hin4I | | ApoI || Hin4I Hin4I TaqII | | TspEI || Hin4I \ \ \ \ \ \\ \ AACAATACGATACAAAGATAATAAATCTGGGTGAAAGTGATAACGAAATTCAGTACGACA 4690 4700 4710 4720 4730 4740 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTATGCTATGTTTCTATTATTTAGACCCACTTTCACTATTGCTTTAAGTCATGCTGT / / / / / /// / Hin4I TaqII Hin4I HphI | ||| Hin4I Hin4I Hin4I | ||| Hin4I | ||Csp6I | |RsaI | Hin4I | Hin4I TspEI ApoI N N T I Q R * * I W V K V I T K F S T T T I R Y K D N K S G * K * * R N S V R H Q Y D T K I I N L G E S D N E I Q Y D I ----:----|----:----|----:----|----:----|----:----|----:----| F L V I C L Y Y I Q T F T I V F N L V V F C Y S V F I I F R P S L S L S I * Y S V I R Y L S L L D P H F H Y R F E T R C Hin4I Hin4I | TatI | |Csp6I | ||RsaI | |||FatI | |||Hin4I | |||Hin4I MboI | ||||CviAII Hin4I | DpnI | ||||| NlaIII SetI Hin4I | |BstKTI | ||||| |TspEI | TspDTI \ \ \\ \ \\\\\ \\ \ \ TACTTGGATTAGAGATCAAATATCAAAGAAGCAAGTACATGAAATTAGGTATGGAAAAAT 4750 4760 4770 4780 4790 4800 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAACCTAATCTCTAGTTTATAGTTTCTTCGTTCATGTACTTTAATCCATACCTTTTTA // / / / /// // / / || MboI Hin4I | ||| |FatI TspEI TspDTI |DpnI Hin4I | ||| | SetI BstKTI | ||| CviAII | ||TatI | |NlaIII | |Csp6I | RsaI Hin4I Hin4I Y L D * R S N I K E A S T * N * V W K N T W I R D Q I S K K Q V H E I R Y G K I L G L E I K Y Q R S K Y M K L G M E K S ----:----|----:----|----:----|----:----|----:----|----:----| Y K S * L D F I L S A L V H F * T H F F M S P N S I L Y * L L L Y M F N P I S F V Q I L S * I D F F C T C S I L Y P F I MaeII | Csp6I | |RsaI | |SetI | |TaiI GsuI TspEI | || SetI Eco57MI DdeI \ \ \\ \ \ \ CCTTGACAGAAAAATTACCCAAACTAAACGTACCTTTGAACCCAAAAGGAAAGAAACTTA 4810 4820 4830 4840 4850 4860 ----:----|----:----|----:----|----:----|----:----|----:----| GGAACTGTCTTTTTAATGGGTTTGATTTGCATGGAAACTTGGGTTTTCCTTTCTTTGAAT / / /// / / TspEI | ||Csp6I Eco57MI DdeI | |RsaI GsuI | |SetI | MaeII TaiI SetI P * Q K N Y P N * T Y L * T Q K E R N L L D R K I T Q T K R T F E P K R K E T * L T E K L P K L N V P L N P K G K K L R ----:----|----:----|----:----|----:----|----:----|----:----| G Q C F F * G F * V Y R Q V W F S L F K D K V S F N G L S F T G K F G F P F F S R S L F I V W V L R V K S G L L F S V * AluI CviJI Ecl136II | SetI | SduI | SacI | BssKI | EcoRII | HgiAI* | HgiJII* | | ScrFI | | BseBI | | | SetI | | | |HindII | | | |Hpy166II | | | || BssKI | | | || SexAI | | | || EcoRII BssKI | | | || | ScrFI EcoRII | | | || | BseBI | ScrFI BseGI FokI | | | || | | SetI | BseBI |MaeI | TspDTI \ \ \ \\ \ \ \ \ \ \\ \ \ GAGCTCCAGGTCAACCAGGTCATTATATAGACCAGGATGAACTAGAAATAGATGAAGATG 4870 4880 4890 4900 4910 4920 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGAGGTCCAGTTGGTCCAGTAATATATCTGGTCCTACTTGATCTTTATCTACTTCTAC / / // / / // / / / / / / / | | || | | || EcoRII | | | MaeI | FokI | | || | | || SexAI | | BseGI TspDTI | | || | | || BssKI | EcoRII | | || | | |BseBI | BssKI | | || | | |ScrFI BseBI | | || | | SetI ScrFI | | || | Hpy166II | | || | HindII | | || EcoRII | | || BssKI | | |BseBI | | |ScrFI | | SetI | Ecl136II | CviJI | AluI HgiJII* HgiAI* SacI SduI SetI E L Q V N Q V I I * T R M N * K * M K M S S R S T R S L Y R P G * T R N R * R * A P G Q P G H Y I D Q D E L E I D E D E ----:----|----:----|----:----|----:----|----:----|----:----| S S W T L W T M I Y V L I F * F Y I F I L A G P * G P * * I S W S S S S I S S S L E L D V L D N Y L G P H V L F L H L H MboII |TspDTI || TspDTI TspDTI || |TatI |MmeI || ||Csp6I || TspDTI || |||RsaI || | MaeI || ||||FatI || | | AluI || |||||CviAII || | | CviJI || |||||| NlaIII || | | | SetI || |||||| | CviRI* || | | | | NdeI \\ \\\\\\ \ \ \\ \ \ \ \ \ AATACAAAGAGAAAGTACATGAAATGCAAAAGTTGATTGGTCTAGCTTCATATGTTGGAT 4930 4940 4950 4960 4970 4980 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGTTTCTCTTTCATGTACTTTACGTTTTCAACTAACCAGATCGAAGTATACAACCTA / / /// // / // / /// / | | ||| |FatI | || TspDTI ||CviJI NdeI | | ||| | | |MmeI ||AluI | | ||| | | TspDTI |MaeI | | ||| | CviRI* SetI | | ||| CviAII | | ||TatI | | |NlaIII | | |Csp6I | | RsaI | TspDTI TspDTI MboII N T K R K Y M K C K S * L V * L H M L D I Q R E S T * N A K V D W S S F I C W I Y K E K V H E M Q K L I G L A S Y V G Y ----:----|----:----|----:----|----:----|----:----|----:----| F V F L F Y M F H L L Q N T * S * I N S S Y L S F T C S I C F N I P R A E Y T P I C L S L V H F A F T S Q D L K M H Q I ApoI TspEI \ ATAAATTTAGATTTGACTTACTATACTACATCAACACACTTGCTCAACATATACTATTCC 4990 5000 5010 5020 5030 5040 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTAAATCTAAACTGAATGATATGATGTAGTTGTGTGAACGAGTTGTATATGATAAGG / TspEI ApoI I N L D L T Y Y T T S T H L L N I Y Y S * I * I * L T I L H Q H T C S T Y T I P K F R F D L L Y Y I N T L A Q H I L F P ----:----|----:----|----:----|----:----|----:----|----:----| I F K S K V * * V V D V C K S L M Y * E Y L N L N S K S Y * M L V S A * C I S N Y I * I Q S V I S C * C V Q E V Y V I G FatI |CviAII || NlaIII || | NdeI TspEI || | |CspCI | FatI || | || TspDTI | |CviAII MaeI MnlI || | || |MseI | || NlaIII MaeI \ \ \\ \ \\ \\ \ \\ \ \ CCTCTAGGCAAGTTTTAGACATGACATATGAGTTAATACAATTCATGTGGGACACTAGAG 5050 5060 5070 5080 5090 5100 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGATCCGTTCAAAATCTGTACTGTATACTCAATTATGTTAAGTACACCCTGTGATCTC / / / // / / / / / // / / | MnlI | || | | | MseI | |FatI | CspCI MaeI | || | | TspDTI | CviAII MaeI | || | NdeI NlaIII | || CspCI TspEI | |FatI | CviAII NlaIII P L G K F * T * H M S * Y N S C G T L E L * A S F R H D I * V N T I H V G H * R S R Q V L D M T Y E L I Q F M W D T R D ----:----|----:----|----:----|----:----|----:----|----:----| G R P L N * V H C I L * Y L E H P V S S G E L C T K S M V Y S N I C N M H S V L R * A L K L C S M H T L V I * T P C * L CspCI SpeI |BslFI |MaeI || TspEI || FalI || | MseI || FalI || | VspI SetI CviJI || | SfaNI \\ \ \ \ \ \\ \ \ ATAAACAATTAATATGGCACAAAAACAAACCTACCAAGCCAGATAATAAACTAGTCGCAA 5110 5120 5130 5140 5150 5160 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTGTTAATTATACCGTGTTTTTGTTTGGATGGTTCGGTCTATTATTTGATCAGCGTT / // / / / // // | |VspI SetI CviJI FalI |SpeI |SfaNI | |MseI FalI MaeI TspDTI | TspEI BslFI I N N * Y G T K T N L P S Q I I N * S Q * T I N M A Q K Q T Y Q A R * * T S R N K Q L I W H K N K P T K P D N K L V A I ----:----|----:----|----:----|----:----|----:----|----:----| I F L * Y P V F V F R G L W I I F * D C S L C N I H C L F L G V L G S L L S T A Y V I L I A C F C V * W A L Y Y V L R L TsoI NdeI |MaeIII | MaeIII |Tsp45I | BstEII FalI || TspEI TspDTI | |BtgZI FalI || | MaeIII \ \ \\ \ \\ \ \ TAAGCGATGCTTCATATGGTAACCAACCATATTACAAGTCACAAATTGGTAACATTTTCC 5170 5180 5190 5200 5210 5220 ----:----|----:----|----:----|----:----|----:----|----:----| ATTCGCTACGAAGTATACCATTGGTTGGTATAATGTTCAGTGTTTAACCATTGTAAAAGG / / / / / / / | | BstEII TsoI | TspEI MaeIII | | MaeIII Tsp45I | | BtgZI MaeIII | FalI | FalI NdeI * A M L H M V T N H I T S H K L V T F S K R C F I W * P T I L Q V T N W * H F P S D A S Y G N Q P Y Y K S Q I G N I F L ----:----|----:----|----:----|----:----|----:----|----:----| Y A I S * I T V L W I V L * L N T V N E I L S A E Y P L W G Y * L D C I P L M K L R H K M H Y G V M N C T V F Q Y C K G MseI |HpaI |HindII |Hpy166II SalI || FatI |TaqI || |CviAII |AccI || || NspI ||HindII || || CviRI* ||Hpy166II || || NlaIII MnlI TspGWI ||| CviJI || || | BarI \ \ \\\ \ \\ \\ \ \ TACTCAACGGAAAAGTGATTGGAGGAAAGTCGACAAAGGCTTCGTTAACATGCACTTCAA 5230 5240 5250 5260 5270 5280 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAGTTGCCTTTTCACTAACCTCCTTTCAGCTGTTTCCGAAGCAATTGTACGTGAAGTT / / /// / /// /// MnlI TspGWI ||SalI CviJI ||| ||BarI |AccI ||| |CviRI* |TaqI ||| |FatI Hpy166II ||| CviAII HindII ||NlaIII ||NspI |MseI Hpy166II HindII HpaI Y S T E K * L E E S R Q R L R * H A L Q T Q R K S D W R K V D K G F V N M H F N L N G K V I G G K S T K A S L T C T S T ----:----|----:----|----:----|----:----|----:----|----:----| * E V S F H N S S L R C L S R * C A S * R S L P F T I P P F D V F A E N V H V E V * R F L S Q L F T S L P K T L M C K L BarI | TspRI | |AluI | |CviJI | ||XmnI HphI | |||BdaI | DdeI | |||BdaI | |SetI | |||SetI | || MaeIII SfeI* | |||| AciI | || Tsp45I \ \ \\\\ \ \ \\ \ CTACAGAAGCAGAAATACACGCAGTCAGTGAAGCTATTCCGCTATTGAATAACCTCAGTC 5290 5300 5310 5320 5330 5340 ----:----|----:----|----:----|----:----|----:----|----:----| GATGTCTTCGTCTTTATGTGCGTCAGTCACTTCGATAAGGCGATAACTTATTGGAGTCAG / / / / // / // / / SfeI* | BarI | |XmnI AciI |SetI | SetI TspRI | CviJI HphI DdeI | AluI | BdaI | BdaI SetI L Q K Q K Y T Q S V K L F R Y * I T S V Y R S R N T R S Q * S Y S A I E * P Q S T E A E I H A V S E A I P L L N N L S H ----:----|----:----|----:----|----:----|----:----|----:----| S C F C F Y V C D T F S N R * Q I V E T V V S A S I C A T L S A I G S N F L R L * L L L F V R L * H L * E A I S Y G * D MnlI |SetI ||DraIII ||| BspCNI MboI ||| |CviRI* | DpnI ||| |BseMII FalI CviJI | |FalI ||| ||BdaI FalI | Hin4I Hin4I | |FalI ||| ||BdaI MseI TspEI MseI | Hin4I Hin4I | |BstKTI \\\ \\\ \ \ \ \ \ \ \ \\ ACCTTGTGCAAGAACTTAACAAGAAACCAATTATTAAAGGCTTACTTACTGATAGTAGAT 5350 5360 5370 5380 5390 5400 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAACACGTTCTTGAATTGTTCTTTGGTTAATAATTTCCGAATGAATGACTATCATCTA / //// / / / // / / / // | |||CviRI* MseI FalI | || | Hin4I | |DpnI | ||BdaI FalI | || | Hin4I | BstKTI | ||BdaI | || CviJI FalI | |BseMII | |Hin4I FalI | BspCNI | |Hin4I Tsp45I | MseI MaeIII TspEI DraIII MnlI T L C K N L T R N Q L L K A Y L L I V D P C A R T * Q E T N Y * R L T Y * * * I L V Q E L N K K P I I K G L L T D S R S ----:----|----:----|----:----|----:----|----:----|----:----| V K H L F K V L F W N N F A * K S I T S * R T C S S L L F G I I L P K S V S L L G Q A L V * C S V L * * L S V * Q Y Y I MboI | DpnI | |BstKTI AccI | || TspEI Hin4I | || |Hin4I Hin4I | || |Hin4I |Hpy166II ApoI MboII | || || MseI || Ksp632I* TspEI |TspDTI \ \\ \\ \ \\ \ \ \\ CAACGATCAGTATAATTAAGTCTACAAATGAAGAGAAATTTAGAAACAGATTTTTTGGCA 5410 5420 5430 5440 5450 5460 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGCTAGTCATATTAATTCAGATGTTTACTTCTCTTTAAATCTTTGTCTAAAAAACCGT / // // /// // / // | || |Hin4I ||| |AccI Ksp632I* |TspDTI | || |Hin4I ||| Hpy166II |MboII | || MboI ||MseI TspEI | |DpnI |TspEI ApoI | BstKTI Hin4I MboI Hin4I Q R S V * L S L Q M K R N L E T D F L A N D Q Y N * V Y K * R E I * K Q I F W H T I S I I K S T N E E K F R N R F F G T ----:----|----:----|----:----|----:----|----:----|----:----| * R D T Y N L R C I F L F K S V S K K A D V I L I I L D V F S S F N L F L N K P L S * Y L * T * L H L S I * F C I K Q C Hin4I Hin4I | MaeII | |BsaAI | |SnaBI | || AccI | || SetI | || TaiI | || |BssNAI | || |Hpy166II Hin4I | || || BsmAI Hin4I SetI | || || Eco31I |BsrDI | TspDTI | || || | TaqI BsmAI || DdeI | |TspEI | || || | |Hpy178III* \ \\ \ \ \\ \ \\ \\ \ \\ CAAAGGCAATGAGACTTAGAGATGAAGTATCAGGTAATAATTTATACGTATACTACATCG 5470 5480 5490 5500 5510 5520 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCCGTTACTCTGAATCTCTACTTCATAGTCCATTATTAAATATGCATATGATGTAGC / / / / / / / / / // // / / | | BsrDI DdeI | | | | | || |AccI | TaqI | BsmAI | | | | | || | Eco31I Hin4I | | | | | || | BsmAI Hin4I | | | | | || Hpy166II | | | | | || BssNAI | | | | | |MaeII | | | | | SnaBI | | | | | BsaAI | | | | TaiI | | | | SetI | | | TspEI | | Hin4I | | Hin4I | TspDTI SetI Q R Q * D L E M K Y Q V I I Y T Y T T S K G N E T * R * S I R * * F I R I L H R K A M R L R D E V S G N N L Y V Y Y I E ----:----|----:----|----:----|----:----|----:----|----:----| C L C H S K S I F Y * T I I * V Y V V D V F A I L S L S S T D P L L K Y T Y * M L P L S V * L H L I L Y Y N I R I S C R Hpy188I Hin4I Hin4I Ksp632I* | MseI BsrDI MboII MboII SetI | MnlI | |AhaIII* \ \ \ \ \ \ \ \\ AGACCAAGAAGAACATTGCTGATGTGATGACAAAACCTCTTCCGATAAAAACATTTAAAC 5530 5540 5550 5560 5570 5580 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGGTTCTTCTTGTAACGACTACACTACTGTTTTGGAGAAGGCTATTTTTGTAAATTTG / / / / / / / /// // | | | MboII | SetI | ||Hin4I |MseI | | Hin4I MboII | |Ksp632I* AhaIII* | BsrDI | MnlI Hpy178III* Hpy188I R P R R T L L M * * Q N L F R * K H L N D Q E E H C * C D D K T S S D K N I * T T K K N I A D V M T K P L P I K T F K L ----:----|----:----|----:----|----:----|----:----|----:----| L G L L V N S I H H C F R K R Y F C K F S V L F F M A S T I V F G R G I F V N L S W S S C Q Q H S S L V E E S L F M * V MboI BglII XhoII | DpnI | |BstKTI TfiI | || TaqII MseI TspDTI HinfI | || |MmeI \ \ \ \ \\ \\ TATTAACTAACAAATGGATTCATTAGATCTATTACATTATGGGTGGTATGTTGGAATAAA 5590 5600 5610 5620 5630 5640 ----:----|----:----|----:----|----:----|----:----|----:----| ATAATTGATTGTTTACCTAAGTAATCTAGATAATGTAATACCCACCATACAACCTTATTT / / / //// | TspDTI HinfI |||XhoII MseI TfiI |||BglII |||MboI |||MmeI ||TaqII |DpnI BstKTI Y * L T N G F I R S I T L W V V C W N K I N * Q M D S L D L L H Y G W Y V G I K L T N K W I H * I Y Y I M G G M L E * K ----:----|----:----|----:----|----:----|----:----|----:----| * * S V F P N M L D I V N H T T H Q F L S N V L L H I * * I * * M I P P I N S Y I L * C I S E N S R N C * P H Y T P I F MaeII |MaeIII || SetI || TaiI SpeI || | SpeI |MaeI || | |MaeI Tsp4CI* \\ \\ \ \\ \ AATCAACTATCATCTACTAACTAGTATTTACGTTACTAGTATATTATCATATACGGTGTT 5650 5660 5670 5680 5690 5700 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTTGATAGTAGATGATTGATCATAAATGCAATGATCATATAATAGTATATGCCACAA // / / / // / |SpeI | | | |SpeI Tsp4CI* MaeI | | | MaeI | | MaeIII | MaeII TaiI SetI N Q L S S T N * Y L R Y * Y I I I Y G V I N Y H L L T S I Y V T S I L S Y T V L S T I I Y * L V F T L L V Y Y H I R C * ----:----|----:----|----:----|----:----|----:----|----:----| F * S D D V L * Y K R * * Y I I M Y P T F D V I M * * S T N V N S T Y * * I R H I L * * R S V L I * T V L I N D Y V T N Hin4I Hin4I | AluI | MboII | CviJI | | HgaI TspEI | | SetI \ \ \ \ \ \ \ AGAAGATGACGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGCTGAAACGCAAGG 5710 5720 5730 5740 5750 5760 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTCTACTGCGTTTACTACTCTTTATCAGTAGATTTAATCACCTTCGACTTTGCGTTCC / / / // / / Hin4I MboII HgaI |TspEI | CviJI Hin4I | AluI SetI R R * R K * * E I V I * I S G S * N A R E D D A N D E K * S S K L V E A E T Q G K M T Q M M R N S H L N * W K L K R K D ----:----|----:----|----:----|----:----|----:----|----:----| L L H R L H H S I T M * I L P L Q F A L * F I V C I I L F L * R F * H F S F R L S S S A F S S F Y D D L N T S A S V C P MboI | DpnI | |BstKTI | || BinI* | || | SspI | || | | MseI TspDTI SspI \ \\ \ \ \ \ \ ATTGATAATGTAATAGGATCAATGAATATTAACATATAAAATGATGATAATAATATTTAT 5770 5780 5790 5800 5810 5820 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTATTACATTATCCTAGTTACTTATAATTGTATATTTTACTACTATTATTATAAATA // / / / / / / || MboI | | | TspDTI SspI |DpnI | | MseI BstKTI | SspI BinI* I D N V I G S M N I N I * N D D N N I Y L I M * * D Q * I L T Y K M M I I I F I * * C N R I N E Y * H I K * * * * Y L * ----:----|----:----|----:----|----:----|----:----|----:----| I S L T I P D I F I L M Y F S S L L I * S Q Y H L L I L S Y * C I F H H Y Y Y K N I I Y Y S * H I N V Y L I I I I I N I MnlI | AvaI | XhoI | SmlI | AbsI TspEI | PspXI | CviRI* BsiYI* | |TaqI | | TfiI | TfiI | |BmeT110I TspEI | | HinfI | HinfI | || MnlI MaeI \ \ \ \ \ \ \ \\ \ \ AGAATTGTGTAGAATTGCAGATTCCCTTTTATGGATTCCTAAATCCTCGAGGAGAACTTC 5830 5840 5850 5860 5870 5880 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTAACACATCTTAACGTCTAAGGGAAAATACCTAAGGATTTAGGAGCTCCTCTTGAAG / // / / / / // / TspEI || | BsiYI* | MnlI || MnlI || HinfI HinfI |PspXI || TfiI TfiI |AbsI |CviRI* |SmlI TspEI |XhoI |AvaI BmeT110I TaqI R I V * N C R F P F M D S * I L E E N F E L C R I A D S L L W I P K S S R R T S N C V E L Q I P F Y G F L N P R G E L L ----:----|----:----|----:----|----:----|----:----|----:----| L I T Y F Q L N G K I S E * I R S S F K Y F Q T S N C I G K * P N R F G R P S S S N H L I A S E R K H I G L D E L L V E SetI CviJI TfiI BseRI | SspI | MseI HinfI TspEI \ \ \ \ \ \ \ TAGTATATCTACATACCTAATATTATAGCCTTAATCACAATGGAATCCCAACAATTACAT 5890 5900 5910 5920 5930 5940 ----:----|----:----|----:----|----:----|----:----|----:----| ATCATATAGATGTATGGATTATAATATCGGAATTAGTGTTACCTTAGGGTTGTTAATGTA / / / / / / / BseRI SetI SspI | MseI HinfI TspEI MaeI CviJI TfiI * Y I Y I P N I I A L I T M E S Q Q L H S I S T Y L I L * P * S Q W N P N N Y I V Y L H T * Y Y S L N H N G I P T I T S ----:----|----:----|----:----|----:----|----:----|----:----| * Y I * M G L I I A K I V I S D W C N C R T Y R C V * Y * L R L * L P I G V I V L I D V Y R I N Y G * D C H F G L L * M MboII \ CAAAATCCACATTCTCTTCAA 5950 5960 ----:----|----:----|- GTTTTAGGTGTAAGAGAAGTT / MboII Q N P H S L Q K I H I L F X K S T F S S X ----:----|----:----|- * F G C E R * D F D V N E E L I W M R K L # Enzymes that cut Frequency Isoschizomers AarI 1 AatII 1 AbsI 2 Acc65I 1 Asp718I AccI 5 FblI,XmiI AciI 3 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 3 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 3 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AluI 19 AluBI AlwNI 1 CaiI ApaLI 2 Alw44I,VneI ApoI 11 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 3 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BamHI 1 BarI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BccI 9 Bce83I* 4 BpuEI BceAI 5 BcgI 2 BciVI 2 BfuI BclI 4 FbaI,Ksp22I BdaI 12 BetI* 4 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 10 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmeT110I 3 BmgT120I 3 BmtI 1 BspOI BsaAI 3 BstBAI,Ppu21I BsaBI 3 Bse8I,BseJI BseBI 7 Bst2UI,BstNI,BstOI,MvaI BseGI 7 BstF5I,BtsCI BseMII 3 BseRI 3 BseSI 3 BaeGI,BstSLI BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 5 BsmFI,FaqI BsmAI 8 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 3 BspHI 2 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 3 BfuAI,Acc36I,BveI BsrDI 3 BseMI,Bse3DI BsrI 8 BseNI,Bse1I,BsrSI BssKI 7 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 27 BtgZI 2 BtrI 1 BmgBI,AjiI BtsI 3 Cac8I 6 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I ClaI 4 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 28 CviQI,RsaNI CspCI 1 CviAII 24 CviJI 39 CviKI-1 CviRI* 23 HpyCH4V DdeI 11 BstDEI,HpyF3I DpnI 27 MalI DraIII 2 AdeI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI Eam1105I 2 AspEI,BmeRI,DriI,AhdI EciI 1 Ecl136II 1 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 2 EcoP15I 2 EcoRII 7 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 6 FatI 24 FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 7 GlaI 1 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 4 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 26 Hin4II* 6 HpyAV Hin6I 1 HinP1I,HspAI HindII 7 HincII HindIII 1 HinfI 26 HpaI 2 KspAI HpaII 4 HapII,BsiSI,MspI HphI 11 AsuHPI Hpy166II 21 Hpy8I Hpy178III* 19 Hpy188III Hpy188I 24 Hpy99I 3 KpnI 1 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 19 FspBI,BfaI,XspI MaeII 15 HpyCH4IV MaeIII 17 MboI 27 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 21 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 3 SchI MmeI 3 MnlI 28 MseI 40 Tru1I,Tru9I MslI 7 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NdeI 6 FauNDI NheI 1 AsuNHI NlaIII 24 Hin1II,Hsp92II,FaeI NlaIV 8 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 7 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 3 PpsI PpiI 1 PshAI 1 BstPAI,BoxI PsiI 1 AanI PspXI 2 PvuII 2 RsaI 28 AfaI SacI 1 Psp124BI,SstI SalI 1 ScaI 3 BmcAI,AssI,ZrmI ScrFI 7 BmrFI,MspR9I,Bme1390I SduI 5 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 75 SexAI 2 MabI SfaNI 3 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 9 SmoI SnaBI 2 Eco105I,BstSNI SpeI 5 BcuI,AhlI SphI 1 PaeI,BbuI SspI 10 TaiI 15 TaqI 16 TaqII 8 TatI 8 TfiI 23 PfeI TseI 2 ApeKI TsoI 6 Tsp45I 7 NmuCI Tsp4CI* 18 HpyCH4III,TaaI,Bst4CI TspDTI 29 TspEI 52 TasI,Tsp509I,Sse9I TspGWI 9 TspRI 8 TscAI TstI 1 VspI 5 PshBI,AseI XbaI 1 XcmI 3 XhoI 2 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 4 BstYI,MflI,PsuI,BstX2I XmnI 3 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AclI AjuI AlfI AloI ApaI AscI AvrII BalI BbvCI BbvII* BglI BplI Bpu10I BsaXI BsePI BseYI Bsp120I BspMII* BsrBI BstAPI BstXI CauII* Cfr9I CfrI DinI DraII Eco47III EcoNI EcoRI EcoT22I EgeI EheI Esp3I EspI* FauI FseI FspAI GsaI KasI MauBI MfeI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NmeAIII NotI NruI NsiI OliI PacI PasI PfoI PmaCI PmeI PpuMI PspOMI PsrI PstI PvuI RsrII SacII SanDI SapI SauI* SfiI SfoI SgfI SgrAI SgrDI SmaI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TauI TspMI Tth111I XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769