Restriction Map of GND2/YGR256W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

GND2/YGR256W on chromosome VII from coordinates 1004624 to 1006102.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.20622

BceAI |CviJI ApoI ||DdeI BccI TspEI SetI |||HphI |CviJI | MboI \ \\\\ \\ \ \ ATGTCAAAGGCAGTAGGTGATTTAGGCTTAGTTGGTTTAGCCGTGATGGGTCAAAATTTG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTTTCCGTCATCCACTAAATCCGAATCAACCAAATCGGCACTACCCAGTTTTAAAC / // / / / / SetI || DdeI CviJI | BstKTI |BceAI BccI TspEI |HphI ApoI CviJI M S K A V G D L G L V G L A V M G Q N L C Q R Q * V I * A * L V * P * W V K I * V K G S R * F R L S W F S R D G S K F D ----:----|----:----|----:----|----:----|----:----|----:----| X D F A T P S K P K T P K A T I P * F K X T L P L L H N L S L Q N L R S P D F N H * L C Y T I * A * N T * G H H T L I Q TseI |BisI ||BlsI |||AciI |||NspBII* ||||TstI |||||MboI SecI* |||||| DpnI DsaI* DpnI |||||| |BstKTI |Tsp4CI* |BstKTI |||||| || BbvI || TspGWI || MseI |||||| || |BinI* || | PsiI TstI HgaI \\ \ \\\\\\ \\ \\ \\ \ \ \ \ ATCTTAAACGCAGCGGATCACGGATTTACCGTGGTTGCTTATAATAGGACGCAATCAAAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAATTTGCGTCGCCTAGTGCCTAAATGGCACCAACGAATATTATCCTGCGTTAGTTTC / / / / /// /// / / / / / / / | | | | ||| ||| MboI | | | TspGWI TstI SetI | | | | ||| ||DpnI | | | DsaI* PsiI | | | | ||| |BstKTI | | | SecI* | | | | ||| AciI | | Tsp4CI* | | | | ||NspBII* | BbvI | | | | ||TseI BinI* | | | | |BisI | | | | BlsI | | | TstI | | MseI | MboI DpnI I L N A A D H G F T V V A Y N R T Q S K S * T Q R I T D L P W L L I I G R N Q R L K R S G S R I Y R G C L * * D A I K G ----:----|----:----|----:----|----:----|----:----|----:----| I K F A A S * P N V T T A * L L V C D F S R L R L P D R I * R P Q K Y Y S A I L D * V C R I V S K G H N S I I P R L * L SetI | MaeI | | MnlI | | |AluI CviRI* | | |CviJI | MnlI | | || SetI | | MfeI SetI | | || | MwoI TspEI | | TspEI \ \ \ \\ \ \ \ \ \ \ GTAGATAGGTTTCTAGCTAATGAGGCAAAAGGAAAATCAATAATTGGTGCAACTTCAATT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CATCTATCCAAAGATCGATTACTCCGTTTTCCTTTTAGTTATTAACCACGTTGAAGTTAA / / /// / / / / / | SetI ||| MwoI | | MnlI TspEI HgaI ||CviJI | CviRI* MfeI ||AluI TspEI |MaeI SetI MnlI V D R F L A N E A K G K S I I G A T S I * I G F * L M R Q K E N Q * L V Q L Q L R * V S S * * G K R K I N N W C N F N * ----:----|----:----|----:----|----:----|----:----|----:----| T S L N R A L S A F P F D I I P A V E I P L Y T E L * H P L L F I L L Q H L K L Y I P K * S I L C F S F * Y N T C S * N CviJI MaeI Cfr10I |SetI MseI |HpaII \\ \ \\ GAGGACTTGGTTGCGAAACTAAAGAAACCTAGAAAGATTATGCTTTTAATCAAAGCCGGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTGAACCAACGCTTTGATTTCTTTGGATCTTTCTAATACGAAAATTAGTTTCGGCCA / / / / // SetI MaeI MseI | |Cfr10I | |HgiAI* | |SduI | HpaII CviJI E D L V A K L K K P R K I M L L I K A G R T W L R N * R N L E R L C F * S K P V G L G C E T K E T * K D Y A F N Q S R C ----:----|----:----|----:----|----:----|----:----|----:----| S S K T A F S F F G L F I I S K I L A P Q P S P Q S V L S V * F S * A K L * L R L V Q N R F * L F R S L N H K * D F G T SduI BetI* HgiAI* |HpaII || SalI || |TaqI || |AccI || |McrI* || ||HindII || ||Hpy166II Csp6I || ||| MseI |RsaI Hpy178III* \\ \\\ \ \\ \ GCTCCGGTCGACACTTTAATAAAGGAACTTGTACCACATCTTGATAAAGGCGACATTATT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGGCCAGCTGTGAAATTATTTCCTTGAACATGGTGTAGAACTATTTCCGCTGTAATAA // /// / // / || ||SalI MseI |Csp6I Hpy178III* || |AccI RsaI || |TaqI || Hpy166II || HindII |BetI* HpaII McrI* A P V D T L I K E L V P H L D K G D I I L R S T L * * R N L Y H I L I K A T L L S G R H F N K G T C T T S * * R R H Y Y ----:----|----:----|----:----|----:----|----:----|----:----| A G T S V K I F S S T G C R S L P S M I H E P R C K L L P V Q V V D Q Y L R C * S R D V S * Y L F K Y W M K I F A V N N SapI Ksp632I* | HgaI | | AluI | | CviJI PfoI | | | FalI BssKI | | | FalI Hpy99I | HpaII | | | SetI Tsp4CI* | ScrFI | | | | MwoI TaqI | MaeIII | CauII* | | | | |MboII \ \ \ \ \ \ \ \ \ \\ ATCGACGGTGGTAACTCACATTTCCCGGACACTAACAGACGCTACGAAGAGCTAACAAAG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTGCCACCATTGAGTGTAAAGGGCCTGTGATTGTCTGCGATGCTTCTCGATTGTTTC / / / / /// / // // / / | | Tsp4CI* MaeIII ||BssKI | || || | MboII | TaqI ||PfoI | || || MwoI Hpy99I |HpaII | || |HgaI CauII* | || CviJI ScrFI | || AluI | |SetI | FalI | FalI Ksp632I* SapI I D G G N S H F P D T N R R Y E E L T K S T V V T H I S R T L T D A T K S * Q S R R W * L T F P G H * Q T L R R A N K A ----:----|----:----|----:----|----:----|----:----|----:----| I S P P L E C K G S V L L R * S S S V F * R R H Y S V N G P C * C V S R L A L L D V T T V * M E R V S V S A V F L * C L BspCNI |BseMII || ApaLI || | HphI || | CviRI* || | Hpy166II || | | SduI || | | MaeII || | | BseSI || | | HgiAI* || | | |MboII CviJI || | | || SetI | SduI DdeI || | | || TaiI ApoI | HgiJII* | BsmAI || | | || | AsuI* TspEI | | FalI | | AciI || | | || | AvaII EcoRI | | FalI | | | BccI || | | || | |BmgT120I \ \ \ \ \ \ \ \ \\ \ \ \\ \ \\ CAAGGAATTCTTTTTGTGGGCTCTGGTGTCTCAGGCGGTGAAGATGGTGCACGTTTTGGT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCTTAAGAAAAACACCCGAGACCACAGAGTCCGCCACTTCTACCACGTGCAAAACCA / / / / // // ///// / / EcoRI | CviJI | || || ||||| MaeII BmgT120I TspEI | FalI | || || ||||MboII ApoI | FalI | || || ||||ApaLI HgiJII* | || || |||TaiI SduI | || || |||SetI | || || ||Hpy166II | || || ||CviRI* | || || |HphI | || || HgiAI* | || || BseSI | || || SduI | || |BseMII | || BspCNI | |BccI | BsmAI | AciI DdeI Q G I L F V G S G V S G G E D G A R F G K E F F L W A L V S Q A V K M V H V L V R N S F C G L W C L R R * R W C T F W S ----:----|----:----|----:----|----:----|----:----|----:----| C P I R K T P E P T E P P S S P A R K P A L F E K Q P S Q H R L R H L H H V N Q L S N K K H A R T D * A T F I T C T K T FatI |CviAII || CfrI || |NlaIII || ||CviJI || ||HaeIII MseI || |||FalI | BccI || |||FalI | | BssKI || |||AciI | | EcoRII || |||BisI | | | ScrFI || ||||BlsI Hpy178III* | | | BseBI || |||||TauI | EcoP15I \ \ \ \ \\ \\\\\\ \ \ CCATCTTTAATGCCTGGTGGGTCAGCAGAAGCATGGCCGCACATCAAGAACATCTTTCAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGAAATTACGGACCACCCAGTCGTCTTCGTACCGGCGTGTAGTTCTTGTAGAAAGTT / // / / // ////// / / AvaII |BccI | EcoRII || |||||AciI | EcoP15I AsuI* MseI | BssKI || ||||CfrI Hpy178III* BseBI || ||||BisI ScrFI || |||BlsI || ||HaeIII || ||CviJI || ||TauI || |FatI || CviAII |FalI |FalI NlaIII P S L M P G G S A E A W P H I K N I F Q H L * C L V G Q Q K H G R T S R T S F N I F N A W W V S R S M A A H Q E H L S I ----:----|----:----|----:----|----:----|----:----|----:----| G D K I G P P D A S A H G C M L F M K * D M K L A Q H T L L L M A A C * S C R E W R * H R T P * C F C P R V D L V D K L BbvI | Tsp4CI* | | CviJI | | |FatI AsuI* | | ||CviAII DraII | | |||TaqII |NlaIV AciI | | |||| TseI |BmgT120I BisI | | |||| NlaIII ||CviJI |BlsI | | |||| |BisI ||HaeIII |FalI | | |||| ||BlsI ||| Cac8I |FalI | | |||| ||HphI ||| | Cfr10I ||TauI | | |||| |||XcmI ||| | |HpaII \\\ \ \ \\\\ \\\\ \\\ \ \\ TCTATTGCCGCCAAATCAAACGGTGAGCCATGCTGCGAATGGGTGGGGCCTGCCGGTTCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGATAACGGCGGTTTAGTTTGCCACTCGGTACGACGCTTACCCACCCCGGACGGCCAAGA / //// / / // ///// //// // | |||AciI | | || ||||TseI |||| |Cfr10I | ||BisI | | || |||XcmI |||| HpaII | |BlsI | | || |||BisI |||Cac8I | TauI | | || ||HphI ||DraII FalI | | || ||BlsI ||AsuI* FalI | | || |FatI |BmgT120I | | || CviAII |HaeIII | | |NlaIII |CviJI | | |TaqII NlaIV | | CviJI | BbvI Tsp4CI* S I A A K S N G E P C C E W V G P A G S L L P P N Q T V S H A A N G W G L P V L Y C R Q I K R * A M L R M G G A C R F W ----:----|----:----|----:----|----:----|----:----|----:----| D I A A L D F P S G H Q S H T P G A P E I * Q R W I L R H A M S R I P P A Q R N R N G G F * V T L W A A F P H P R G T R Csp6I |RsaI ||Hpy166II ||| MboII ||| | Tsp4CI* ||| | | TaqI ||| | | | Csp6I ||| | | | |RsaI ||| | | | || Tsp4CI* ||| | | | || | BaeI BccI ||| | | | || | | CviRI* MaeIII DraIII ||| | | | || | | | HphI Tsp45I | BaeI ||| | | | || | | | | MnlI \ \ \ \\\ \ \ \ \\ \ \ \ \ \ GGTCACTATGTGAAGATGGTACACAACGGTATCGAGTACGGTGATATGCAGTTGATTTGC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGTGATACACTTCTACCATGTGTTGCCATAGCTCATGCCACTATACGTCAACTAAACG // / // / / / //// / / / || BccI || | | | |||BaeI | | MnlI |BaeI || | | | ||Tsp4CI* | HphI Tsp45I || | | | |Csp6I CviRI* MaeIII || | | | RsaI DraIII || | | TaqI || | Tsp4CI* || MboII |Hpy166II |Csp6I RsaI G H Y V K M V H N G I E Y G D M Q L I C V T M * R W Y T T V S S T V I C S * F A S L C E D G T Q R Y R V R * Y A V D L R ----:----|----:----|----:----|----:----|----:----|----:----| P * * T F I T C L P I S Y P S I C N I Q Q D S H S S P V C R Y R T R H Y A T S K T V I H L H Y V V T D L V T I H L Q N A EcoRV | FatI | BspHI | |CviAII | |Hpy178III* | || NlaIII | || | TspEI | || | | CfrI | || | | | CviJI | || | | | Cfr10I | || | | | HaeIII MboI | || | | | |HpaII | DpnI | || | | | ||TspDTI | |BstKTI | || | | | ||| Hpy166II | || TspGWI CviJI | || | | | ||| |BsiYI* | || | TspRI \ \ \\ \ \ \ \\\ \\ \ \\ \ \ GAGGCTTACGATATCATGAAACGAATTGGCCGGTTTACGGATAAAGAGATCAGTGAAGTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCGAATGCTATAGTACTTTGCTTAACCGGCCAAATGCCTATTTCTCTAGTCACTTCAT / / / // / / /// / //// CviJI | | |BspHI | | ||| Hpy166II |||MboI | | |FatI | | ||Cfr10I ||TspGWI | | | | | ||BsiYI* |DpnI | | | | | |HpaII BstKTI | | | | | CfrI TspRI | | | | TspDTI | | | | HaeIII | | | | CviJI | | | TspEI | | Hpy178III* | | CviAII | NlaIII EcoRV E A Y D I M K R I G R F T D K E I S E V R L T I S * N E L A G L R I K R S V K Y G L R Y H E T N W P V Y G * R D Q * S I ----:----|----:----|----:----|----:----|----:----|----:----| S A * S I M F R I P R N V S L S I L S T R P K R Y * S V F Q G T * P Y L S * H L L S V I D H F S N A P K R I F L D T F Y Hpy178III* | GsuI | Eco57MI BdaI | | BsaBI BdaI | | |MnlI BsrI |TfiI | | || BsiI* TspRI |HinfI | | || Hpy178III* \ \\ \ \ \\ \ TTTGACAAGTGGAACACTGGAGTTTTGGATTCTTTCTTGATTGAAATCACGAGGGACATT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTGTTCACCTTGTGACCTCAAAACCTAAGAAAGAACTAACTTTAGTGCTCCCTGTAA / / / / / / / / / / TspRI BsrI BdaI | | | BsaBI | BsiI* BdaI BdaI | | | MnlI | BdaI | | Hpy178III* Hpy178III* | Eco57MI | GsuI HinfI TfiI F D K W N T G V L D S F L I E I T R D I L T S G T L E F W I L S * L K S R G T F * Q V E H W S F G F F L D * N H E G H F ----:----|----:----|----:----|----:----|----:----|----:----| N S L H F V P T K S E K K I S I V L S M I Q C T S C Q L K P N K R S Q F * S P C K V L P V S S N Q I R E Q N F D R P V N AcyI MaeII |ZraI ||SalI ||SgrDI |||TaqI |||AccI |||SetI MseI |||TaiI BdaI |||AatII BdaI ||||HindII |AhaIII* ||||Hpy166II || ApoI |||||Hpy99I || TspEI |||||| Hpy99I || | BslFI |||||| Tsp4CI* TspEI Cfr10I || | |TaqI |||||| | CviJI |BciVI |HpaII \\ \ \\ \\\\\\ \ \ \\ \\ TTAAAATTCGATGACGTCGACGGTAAGCCATTGGTGGAAAAAATTATGGATACTGCCGGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTTAAGCTACTGCAGCTGCCATTCGGTAACCACCTTTTTTAATACCTATGACGGCCA // / // ///////// / / / // |MseI | || ||||||||| CviJI | TspEI |Cfr10I | | || ||||||||Tsp4CI* BciVI HpaII | | || |||||||SgrDI | | || |||||||SalI | | || ||||||AccI | | || ||||||TaqI | | || |||||Hpy166II | | || |||||HindII | | || ||||Hpy99I | | || |||MaeII | | || |||AcyI | | || ||ZraI | | || |Hpy99I | | || AatII | | || TaiI | | || SetI | | |BslFI | | TaqI | TspEI | ApoI AhaIII* L K F D D V D G K P L V E K I M D T A G * N S M T S T V S H W W K K L W I L P V K I R * R R R * A I G G K N Y G Y C R S ----:----|----:----|----:----|----:----|----:----|----:----| K F N S S T S P L G N T S F I I S V A P K L I R H R R R Y A M P P F F * P Y Q R * F E I V D V T L W Q H F F N H I S G T CviRI* BsrI | MwoI |BsmI Csp6I | | StyI ||MaeIII |RsaI BsrI | | SecI* ||Tsp45I \\ \ \ \ \ \\\ CAAAAGGGTACTGGTAAATGGACTGCAATCAACGCCTTGGATTTAGGAATGCCAGTCACT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCCCATGACCATTTACCTGACGTTAGTTGCGGAACCTAAATCCTTACGGTCAGTGA // / / / / // / || BsrI | MwoI SecI* |BsmI Tsp45I |Csp6I CviRI* StyI BsrI MaeIII RsaI Q K G T G K W T A I N A L D L G M P V T K R V L V N G L Q S T P W I * E C Q S L K G Y W * M D C N Q R L G F R N A S H F ----:----|----:----|----:----|----:----|----:----|----:----| * F P V P L H V A I L A K S K P I G T V D F P Y Q Y I S Q L * R R P N L F A L * L L T S T F P S C D V G Q I * S H W D S MseI MaeII |TspEI | SetI ||MnlI CviJI MwoI CviJI BarI | TaiI \\\ \ \ \ \ \ \ TTAATTGGGGAGGCTGTTTTCGCTCGTTGTTTGTCAGCCATAAAGGACGAACGTAAAAGA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AATTAACCCCTCCGACAAAAGCGAGCAACAAACAGTCGGTATTTCCTGCTTGCATTTTCT // / / / / / / / / || TspEI | MwoI | BarI | MaeII SetI |MseI CviJI CviJI TaiI MnlI SetI L I G E A V F A R C L S A I K D E R K R * L G R L F S L V V C Q P * R T N V K E N W G G C F R S L F V S H K G R T * K S ----:----|----:----|----:----|----:----|----:----|----:----| K I P S A T K A R Q K D A M F S S R L L K L Q P P Q K R E N N T L W L P R V Y F * N P L S N E S T T Q * G Y L V F T F S BarI | AsuI* | AvaII CviRI* AluI | |BmgT120I | BseGI CviJI | || SfaNI | | FatI | SetI | || Tsp4CI* | | |CviAII | |TaqI | || |Csp6I | | || FokI | |AsuII | || ||RsaI | | || NlaIII TspEI \ \\ \ \\ \\\ \ \ \\ \ \ GCTTCGAAACTTCTGGCAGGACCAACAGTACCAAAGGATGCAATACATGATAGAGAACAA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGCTTTGAAGACCGTCCTGGTTGTCATGGTTTCCTACGTTATGTACTATCTCTTGTT / / / // / /// / / // / | AsuII BarI || | ||SfaNI | | || FokI | TaqI || | |Csp6I | | |FatI CviJI || | RsaI | | CviAII AluI || Tsp4CI* | NlaIII |AvaII CviRI* |AsuI* BseGI BmgT120I A S K L L A G P T V P K D A I H D R E Q L R N F W Q D Q Q Y Q R M Q Y M I E N N F E T S G R T N S T K G C N T * * R T I ----:----|----:----|----:----|----:----|----:----|----:----| A E F S R A P G V T G F S A I C S L S C L K S V E P L V L L V L P H L V H Y L V S R F K Q C S W C Y W L I C Y M I S F L NdeI TspDTI | TspDTI MwoI | Bce83I* | | SmlI SetI \ \ \ \ \ \ \ TTTGTGTATGATTTGGAACAAGCATTATACGCTTCAAAGATTATTTCATATGCTCAAGGT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AAACACATACTAAACCTTGTTCGTAATATGCGAAGTTTCTAATAAAGTATACGAGTTCCA / / / / // // TspEI MwoI | Bce83I* |NdeI |SmlI TspDTI TspDTI SetI F V Y D L E Q A L Y A S K I I S Y A Q G L C M I W N K H Y T L Q R L F H M L K V C V * F G T S I I R F K D Y F I C S R F ----:----|----:----|----:----|----:----|----:----|----:----| N T Y S K S C A N Y A E F I I E Y A * P I Q T H N P V L M I R K L S * K M H E L K H I I Q F L C * V S * L N N * I S L T FatI |BinI* |CviAII || BbvI || NlaIII || | MboI || | | DpnI || | | |BstKTI || | | ||AciI || | | ||| FnuDII* || | | ||| | TseI || | | ||| | AluI || | | ||| | CviJI || | | ||| | |BisI BceAI || | | ||| | ||BlsI | BseYI || | | ||| | ||SetI | | AluI || | | ||| | ||| MboI CviJI | | GsaI || | | ||| | ||| | DpnI | TspEI | | CviJI || | | ||| | ||| | |BstKTI | | MseI | | | SetI \\ \ \ \\\ \ \\\ \ \\ \ \ \ \ \ \ \ TTCATGCTGATCCGCGAAGCTGCCAGATCATACGGCTGGAAATTAAACAACCCAGCTATT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTACGACTAGGCGCTTCGACGGTCTAGTATGCCGACCTTTAATTTGTTGGGTCGATAA / /// // / / / //// // / / // // / / | ||| || | | | |||| || MboI CviJI |MseI || | BseYI | ||| || | | | |||| |DpnI TspEI || | CviJI | ||| || | | | |||| BstKTI || | AluI | ||| || | | | |||TseI || SetI | ||| || | | | ||BisI |GsaI | ||| || | | | |BlsI BceAI | ||| || | | | CviJI | ||| || | | | AluI | ||| || | | SetI | ||| || | FnuDII* | ||| || | AciI | ||| || MboI | ||| |DpnI | ||| |BbvI | ||| BstKTI | ||FatI | |CviAII | BinI* NlaIII F M L I R E A A R S Y G W K L N N P A I S C * S A K L P D H T A G N * T T Q L L H A D P R S C Q I I R L E I K Q P S Y C ----:----|----:----|----:----|----:----|----:----|----:----| K M S I R S A A L D Y P Q F N F L G A I N * A S G R L Q W I M R S S I L C G L * E H Q D A F S G S * V A P F * V V W S N MboI BglII XhoII Hpy188I | DpnI | |BstKTI | || BseMII | || |BspCNI | || || DdeI | || || | AluI | || || | CviJI | || || | |DdeI SetI | || || | ||SetI MnlI | CviJI | || || | ||| Hin4II* \ \ \ \ \\ \\ \ \\\ \ GCTCTAATGTGGAGAGGTGGCTGTATAATCAGATCTGTGTTCTTAGCTGAGATTACGAAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGATTACACCTCTCCACCGACATATTAGTCTAGACACAAGAATCGACTCTAATGCTTC / / / / // /// /// / MnlI SetI CviJI | || ||BspCNI ||| Hin4II* | || |BseMII ||| DdeI | || XhoII ||CviJI | || BglII ||AluI | || MboI |DdeI | |DpnI SetI | BstKTI Hpy188I A L M W R G G C I I R S V F L A E I T K L * C G E V A V * S D L C S * L R L R R S N V E R W L Y N Q I C V L S * D Y E G ----:----|----:----|----:----|----:----|----:----|----:----| A R I H L P P Q I I L D T N K A S I V F Q E L T S L H S Y L * I Q T R L Q S * S S * H P S T A T Y D S R H E * S L N R L BinI* | MboI | | DpnI | | |BstKTI | | ||Hpy178III* SfeI* | | ||| BslFI | CviRI* | | ||| | ApoI | | PstI CviJI | | ||| | TspEI MboII | | MaeIII \ \ \ \\\ \ \ \ \ \ \ GCTTATAGGGACGATCCAGATTTGGAAAATTTATTATTCAACGAGTTCTTCGCTTCTGCA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CGAATATCCCTGCTAGGTCTAAACCTTTTAAATAATAAGTTGCTCAAGAAGCGAAGACGT / / // / / / / / / /// CviJI | || | | | TspEI MboII | ||SfeI* | || | | | ApoI | |MmeI | || | | BslFI | CviRI* | || | Hpy178III* PstI | || MboI | |DpnI | BstKTI BinI* A Y R D D P D L E N L L F N E F F A S A L I G T I Q I W K I Y Y S T S S S L L Q L * G R S R F G K F I I Q R V L R F C S ----:----|----:----|----:----|----:----|----:----|----:----| A * L S S G S K S F K N N L S N K A E A P K Y P R D L N P F N I I * R T R R K Q S I P V I W I Q F I * * E V L E E S R C MmeI | DdeI | | AsuI* | | |CviJI MboII | | |HaeIII | TseI | | |BmgT120I | MwoI GsuI | | || BetI* | |BisI Eco57MI | | || |HpaII BbvI | ||BlsI | Tsp4CI* \ \ \\ \\ \ \ \\\ \ \ GTTACTAAGGCCCAATCCGGTTGGAGAAGAACTATTGCCCTTGCTGCTACTTACGGTATT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGATTCCGGGTTAGGCCAACCTCTTCTTGATAACGGGAACGACGATGAATGCCATAA / / /// // / / / /// / / | | ||AsuI* |BetI* | | | ||| | Tsp4CI* | | || HpaII | | | ||| Eco57MI | | |BmgT120I | | | ||| GsuI | | HaeIII | | | ||TseI | | CviJI | | | |BisI | DdeI | | | BlsI MaeIII | | MwoI | MboII BbvI V T K A Q S G W R R T I A L A A T Y G I L L R P N P V G E E L L P L L L L T V F Y * G P I R L E K N Y C P C C Y L R Y S ----:----|----:----|----:----|----:----|----:----|----:----| T V L A W D P Q L L V I A R A A V * P I L * * P G I R N S F F * Q G Q Q * K R Y N S L G L G T P S S S N G K S S S V T N Hpy99I |CviJI |BseMII ||SfeI* ||BspCNI ||| MboI ||| BglII ||| XhoII ||| |MnlI ||| ||DpnI ||| |||BstKTI ||| ||||DdeI AluI ||| |||||Hpy188I CviJI ||| |||||| BceAI | SetI MmeI ||| |||||| | CviJI \ \ \ \\\ \\\\\\ \ \ CCAACTCCAGCTTTCTCTACTGCTTTAGCGTTTTACGACGGCTATAGATCTGAGAGGCTA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTGAGGTCGAAAGAGATGACGAAATCGCAAAATGCTGCCGATATCTAGACTCTCCGAT / / / / /// /// / / // | CviJI MmeI | ||| ||| | | |CviJI | AluI | ||| ||| | | BceAI SetI | ||| ||| | DdeI | ||| ||| Hpy188I | ||| ||| XhoII | ||| ||| BglII | ||| ||| MboI | ||| ||DpnI | ||| |BstKTI | ||| SfeI* | ||| MnlI | ||CviJI | |BspCNI | BseMII Hpy99I P T P A F S T A L A F Y D G Y R S E R L Q L Q L S L L L * R F T T A I D L R G Y N S S F L Y C F S V L R R L * I * E A T ----:----|----:----|----:----|----:----|----:----|----:----| G V G A K E V A K A N * S P * L D S L S E L E L K R * Q K L T K R R S Y I Q S A W S W S E R S S * R K V V A I S R L P * Hin6I |GlaI ||HhaI Hin6I ||| MaeII |GlaI ||| | SetI ||HhaI ApoI MaeIII ||| | TaiI |||HaeII TspEI \ \\\ \ \ \\\\ \ CCAGCAAACTTGTTACAAGCGCAACGTGATTATTTTGGCGCTCATACATTTAGAATTTTA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCGTTTGAACAATGTTCGCGTTGCACTAATAAAACCGCGAGTATGTAAATCTTAAAAT / /// / / //// / / | ||| | MaeII |||Hin6I | SetI | ||| TaiI ||GlaI TspEI | ||| SetI |HhaI ApoI | ||Hin6I HaeII | |GlaI | HhaI MaeIII P A N L L Q A Q R D Y F G A H T F R I L Q Q T C Y K R N V I I L A L I H L E F Y S K L V T S A T * L F W R S Y I * N F T ----:----|----:----|----:----|----:----|----:----|----:----| G A F K N C A C R S * K P A * V N L I K V L L S T V L A V H N N Q R E Y M * F K W C V Q * L R L T I I K A S M C K S N * BsrI | AccI MnlI | |Hpy166II MfeI | BarI SetI | ||TspDTI TspEI | BsrI \ \ \\\ \ \ \ CCTGAATGTGCTTCTGCCCATTTGCCAGTAGACAAGGATATTCATATCAATTGGACTGGG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GGACTTACACGAAGACGGGTAAACGGTCATCTGTTCCTATAAGTATAGTTAACCTGACCC / /// / / // BsrI ||AccI | | |BseSI |Hpy166II | | |BsrI TspDTI | | |SduI | | MnlI | BarI TspEI MfeI P E C A S A H L P V D K D I H I N W T G L N V L L P I C Q * T R I F I S I G L G * M C F C P F A S R Q G Y S Y Q L D W A ----:----|----:----|----:----|----:----|----:----|----:----| G S H A E A W K G T S L S I * I L Q V P V Q I H K Q G N A L L C P Y E Y * N S Q R F T S R G M Q W Y V L I N M D I P S P SetI | MnlI | | BarI SduI | | HindIII BseSI | | | AluI | BfiI | | | CviJI | | MboII | | | | MseI | | |SetI TspGWI | | | | SetI \ \ \\ \ \ \ \ \ \ CACGGAGGTAATATATCTTCCTCAACCTACCAAGCTTAA 1450 1460 1470 ----:----|----:----|----:----|----:---- GTGCCTCCATTATATAGAAGGAGTTGGATGGTTCGAATT // / / / / / / / / / || MboII TspGWI | | | | | | MseI |SetI | | | | | HindIII BfiI | | | | CviJI | | | | AluI | | | SetI | | MnlI | BarI SetI H G G N I S S S T Y Q A * T E V I Y L P Q P T K L X R R * Y I F L N L P S L X ----:----|----:----|----:----|----:---- C P P L I D E E V * W A * A R L Y Y I K R L R G L K V S T I Y R G * G V L S L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 3 FblI,XmiI AciI 5 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AhaIII* 1 DraI AluI 8 AluBI ApaLI 1 Alw44I,VneI ApoI 5 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BarI 2 BbvI 4 BseXI,BstV1I,Lsp1109I BccI 4 Bce83I* 1 BpuEI BceAI 3 BciVI 1 BfuI BdaI 2 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 2 BinI* 3 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmgT120I 4 BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 3 BseSI 2 BaeGI,BstSLI BseYI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 3 BspHI 1 CciI,PagI,RcaI BsrI 5 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 8 Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 4 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 5 CviQI,RsaNI CviAII 5 CviJI 26 CviKI-1 CviRI* 6 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 8 MalI DraII 1 EcoO109I DraIII 1 AdeI DsaI* 1 BtgI,BstDSI Eco57MI 2 EcoP15I 1 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I FalI 4 FatI 5 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 1 GlaI 2 GsaI 1 GsuI 2 BpmI HaeII 1 BstH2I HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 2 HinP1I,HspAI HindII 2 HincII HindIII 1 HinfI 1 HpaII 7 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 2 Hpy99I 4 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 5 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 2 MunI MmeI 2 MnlI 9 MseI 8 Tru1I,Tru9I MwoI 6 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PfoI 1 PsiI 1 AanI PstI 1 RsaI 5 AfaI SalI 2 SapI 1 LguI,PciSI,BspQI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 21 SfaNI 1 LweI SfeI* 2 BstSFI,SfcI,BfmI SgrDI 1 SmlI 1 SmoI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 6 TaqII 1 TauI 2 TfiI 1 PfeI TseI 4 ApeKI Tsp45I 2 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 13 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 2 TscAI TstI 1 XcmI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AclI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI AscI Asp718I AvaI AvrII BalI BamHI BbvCI BbvII* BcgI BclI BglI BmeT110I BmtI BplI Bpu10I BsaAI BsaXI BsePI BseRI BsgI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI BtsI Cfr9I ClaI CspCI DinI DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I EcoICRI EcoNI EcoT22I EgeI EheI Esp3I EspI* FauI FseI FspAI HgiCI* Hin4I HpaI KasI KpnI MauBI MluI MlyI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PleI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SanDI SauI* ScaI SchI SexAI SfiI SfoI SgfI SgrAI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TatI TsoI TspMI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* XmnI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769