Restriction Map of GCN5/YGR252W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

GCN5/YGR252W on chromosome VII from coordinates 996869 to 998188.


BseGI |AluI |CviJI ||BdaI ||BdaI |||SetI ||||BinI* ||||| FokI ||||| | MboI ||||| | BamHI MboI ||||| | XhoII | DpnI ||||| | Hpy99I | |BstKTI ||||| | | DpnI | ||BccI ||||| | | NlaIV Hpy188I | ||| MboII ||||| | | |BstKTI MaeIII BdaI Ksp632I* | ||| |MslI ||||| | | ||Hpy178III* Tsp45I BdaI |MnlI | ||| |BinI* ||||| | | ||| BinI* \ \ \\ \ \\\ \\ \\\\\ \ \ \\\ \ ATGGTCACAAAACATCAGATTGAAGAGGATCACTTGGATGGAGCTACGACGGATCCCGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAGTGTTTTGTAGTCTAACTTCTCCTAGTGAACCTACCTCGATGCTGCCTAGGGCTT / // / // /// // //// // // / / / Tsp45I || | || ||| || |||| || || | | BinI* MaeIII || | || ||| || |||| || || | Hpy178III* BdaI || | || ||| || |||| || || XhoII BdaI || | || ||| || |||| || || BamHI || | || ||| || |||| || || MboI || | || ||| || |||| || |NlaIV || | || ||| || |||| || |FokI || | || ||| || |||| || |DpnI || | || ||| || |||| || BstKTI || | || ||| || |||| |BinI* || | || ||| || |||| Hpy99I || | || ||| || |||CviJI || | || ||| || |||AluI || | || ||| || ||BdaI || | || ||| || ||BdaI || | || ||| || |SetI || | || ||| || BseGI || | || ||| |BinI* || | || ||| MslI || | || ||MboII || | || |BccI || | || MboI || | |DpnI || | BstKTI || Ksp632I* |MnlI Hpy188I M V T K H Q I E E D H L D G A T T D P E W S Q N I R L K R I T W M E L R R I P K G H K T S D * R G S L G W S Y D G S R S ----:----|----:----|----:----|----:----|----:----|----:----| X T V F C * I S S S * K S P A V V S G S X P * L V D S Q L P D S P H L * S P D R H D C F M L N F L I V Q I S S R R I G F MboII |DdeI |BseMII |Bpu10I ||SetI ||BspCNI ||| BsmAI AclI ||| Eco31I MaeII ||| |Cac8I MseI | SetI BseMII ||| || CviJI | TspGWI TspEI | TaiI |BspCNI ||| || |DdeI \ \ \ \ \ \\ \\\ \\ \\ GTTAAACGGGTAAAATTAGAAAACAACGTTGAAGAAATACAACCTGAGCAGGCTGAGACC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTTGCCCATTTTAATCTTTTGTTGCAACTTCTTTATGTTGGACTCGTCCGACTCTGG / / / / / // /// / / // / | MseI TspEI | | |BspCNI ||| | | || DdeI TspGWI | | BseMII ||| | | |Eco31I | MaeII ||| | | |BsmAI | AclI ||| | | CviJI TaiI ||| | Cac8I SetI ||| Bpu10I ||| DdeI ||BspCNI |BseMII |MboII SetI V K R V K L E N N V E E I Q P E Q A E T L N G * N * K T T L K K Y N L S R L R P * T G K I R K Q R * R N T T * A G * D Q ----:----|----:----|----:----|----:----|----:----|----:----| T L R T F N S F L T S S I C G S C A S V L * V P L I L F C R Q L F V V Q A P Q S N F P Y F * F V V N F F Y L R L L S L G HgiCI* TaqI | NlaIV |Hpy178III* | |SduI || BseMII MnlI MnlI | |BseSI || |BspCNI DdeI |TstI \ \ \\ \\ \\ \ \\ AATAAACAAGAGGGCACCGATAAAGAGAATAAAGGAAAGTTCGAGAAAGAAACTGAGAGA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTGTTCTCCCGTGGCTATTTCTCTTATTTCCTTTCAAGCTCTTTCTTTGACTCTCT / / / / /// / // MnlI | | HgiCI* ||| | |MnlI | NlaIV ||| | DdeI BseSI ||| TstI SduI ||Hpy178III* |BspCNI |TaqI BseMII N K Q E G T D K E N K G K F E K E T E R I N K R A P I K R I K E S S R K K L R E * T R G H R * R E * R K V R E R N * E N ----:----|----:----|----:----|----:----|----:----|----:----| L L C S P V S L S F L P F N S F S V S L W Y V L P C R Y L S Y L F T R S L F Q S I F L L A G I F L I F S L E L F F S L S TsoI MboI XhoII | DpnI | |BstKTI TstI | || Hpy188I |Eco57I BccI | || | BinI* |Eco57MI ApoI ApoI | || | | MaeIII || TspEI TspEI TspEI \ \\ \ \ \ \\ \ \ \ ATAGGAGGATCTGAAGTGGTTACAGATGTGGAAAAAGGAATTGTCAAATTTGAATTTGAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TATCCTCCTAGACTTCACCAATGTCTACACCTTTTTCCTTAACAGTTTAAACTTAAACTA / // / / / / / / / / / | || | BinI* | | Eco57MI TspEI | | TspEI | || Hpy188I | | Eco57I | | ApoI | || XhoII | TstI | BccI | || MboI MaeIII TspEI | |DpnI ApoI | BstKTI TsoI I G G S E V V T D V E K G I V K F E F D * E D L K W L Q M W K K E L S N L N L M R R I * S G Y R C G K R N C Q I * I * W ----:----|----:----|----:----|----:----|----:----|----:----| I P P D S T T V S T S F P I T L N S N S F L L I Q L P * L H P F L F Q * I Q I Q Y S S R F H N C I H F F S N D F K F K I Hin4I Hin4II* Hin4I BsrI | Hin4I |BsmAI | Eam1105I | Hin4I |Eco31I | | MnlI | | SetI || BfiI | | | TspRI | | | TspEI \\ \ \ \ \ \ \ \ \ \ GGTGTTGAATACACATTCAAAGAGAGACCCAGTGTCGTAGAGGAAAATGAAGGTAAAATT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAACTTATGTGTAAGTTTCTCTCTGGGTCACAGCATCTCCTTTTACTTCCATTTTAA / / / / / / / / / Hin4I | | | MnlI | Hin4I SetI TspDTI Hin4I | | Eam1105I | Hin4I TspEI | TspRI Hin4II* | BsrI Eco31I BsmAI BfiI G V E Y T F K E R P S V V E E N E G K I V L N T H S K R D P V S * R K M K V K L C * I H I Q R E T Q C R R G K * R * N * ----:----|----:----|----:----|----:----|----:----|----:----| P T S Y V N L S L G L T T S S F S P L I H H Q I C M * L S V W H R L P F H L Y F T N F V C E F L S G T D Y L F I F T F N BccI | FatI | |CviAII | || NlaIII | || | AsuI* | || | AvaII BsrI TspDTI HphI | || | |BmgT120I |MseI \ \ \ \\ \ \\ \\ GAGTTTAGGGTGGTGAATAATGATAATACTAAAGAAAACATGATGGTCCTAACTGGATTA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTCAAATCCCACCACTTATTACTATTATGATTTCTTTTGTACTACCAGGATTGACCTAAT / // // // / / HphI || |FatI |AvaII BsrI MseI || | |AsuI* || | BmgT120I || CviAII |NlaIII BccI E F R V V N N D N T K E N M M V L T G L S L G W * I M I I L K K T * W S * L D * V * G G E * * * Y * R K H D G P N W I K ----:----|----:----|----:----|----:----|----:----|----:----| S N L T T F L S L V L S F M I T R V P N Q T * P P S Y H Y Y * L F C S P G L Q I L K P H H I I I I S F F V H H D * S S * BsrDI | BssKI | EcoRII | | ScrFI | | BseBI | | |BdaI | | |BdaI TspEI | | || SetI \ \ \ \\ \ AAAAACATTTTTCAAAAGCAATTACCAAAAATGCCCAAAGAATACATTGCCAGGTTAGTC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTGTAAAAAGTTTTCGTTAATGGTTTTTACGGGTTTCTTATGTAACGGTCCAATCAG / / /// / TspEI BsrDI ||| EcoRII ||| BssKI ||BseBI ||ScrFI |SetI BdaI BdaI K N I F Q K Q L P K M P K E Y I A R L V K T F F K S N Y Q K C P K N T L P G * S K H F S K A I T K N A Q R I H C Q V S L ----:----|----:----|----:----|----:----|----:----|----:----| F F M K * F C N G F I G L S Y M A L N T L F C K E F A I V L F A W L I C Q W T L F V N K L L L * W F H G F F V N G P * D FatI NcoI StyI SecI* DsaI* |CviAII MboI || NlaIII | DpnI || |CviJI | |TaqI || ||BdaI | |BstKTI || ||BdaI CviJI Tsp4CI* SetI \ \\ \\ \\\ \ \ \ TATGATCGAAGTCATCTTTCCATGGCTGTCATTAGGAAGCCATTGACTGTCGTAGGTGGC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTAGCTTCAGTAGAAAGGTACCGACAGTAATCCTTCGGTAACTGACAGCATCCACCG // // / /// / / / || |TaqI | ||CviJI CviJI | SetI || MboI | |DsaI* Tsp4CI* |DpnI | |SecI* BstKTI | |BdaI | |BdaI | |StyI | |NcoI | |FatI | CviAII NlaIII Y D R S H L S M A V I R K P L T V V G G M I E V I F P W L S L G S H * L S * V A * S K S S F H G C H * E A I D C R R W H ----:----|----:----|----:----|----:----|----:----|----:----| * S R L * R E M A T M L F G N V T T P P R H D F D D K W P Q * * S A M S Q R L H I I S T M K G H S D N P L W Q S D Y T A ApoI SetI TspEI TaqI | TaqI EcoRI TspEI \ \ \ \ \ ATAACATATCGACCTTTCGATAAGAGAGAATTCGCAGAAATTGTTTTCTGTGCCATCAGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TATTGTATAGCTGGAAAGCTATTCTCTCTTAAGCGTCTTTAACAAAAGACACGGTAGTCA / / / / TaqI TaqI EcoRI TspEI SetI TspEI ApoI I T Y R P F D K R E F A E I V F C A I S * H I D L S I R E N S Q K L F S V P S V N I S T F R * E R I R R N C F L C H Q F ----:----|----:----|----:----|----:----|----:----|----:----| M V Y R G K S L L S N A S I T K Q A M L C L M D V K R Y S L I R L F Q K R H W * Y C I S R E I L S F E C F N N E T G D T Csp6I |RsaI Hin6I |SetI |GlaI || AciI |MstI* TfiI TaqI || FnuDII* |FspAI HinfI BccI Hpy99I || | TspGWI ||HhaI SfaNI MseI TspDTI \ \ \\ \ \ \\\ \ \ \ TCGACGGAACAGGTACGCGGTTATGGTGCGCATCTAATGAATCACTTAAAAGACTATGTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTGCCTTGTCCATGCGCCAATACCACGCGTAGATTACTTAGTGAATTTTCTGATACAA /// / // / / /// // / / ||TaqI | || | AciI ||Hin6I || | TspDTI |BccI | || FnuDII* |FspAI || MseI Hpy99I | || TspGWI |MstI* |SfaNI | |Csp6I |GlaI HinfI | RsaI HhaI TfiI SetI S T E Q V R G Y G A H L M N H L K D Y V R R N R Y A V M V R I * * I T * K T M L D G T G T R L W C A S N E S L K R L C * ----:----|----:----|----:----|----:----|----:----|----:----| E V S C T R P * P A C R I F * K F S * T N S P V P V R N H H A D L S D S L L S H R R F L Y A T I T R M * H I V * F V I N NdeI TaqI MnlI | CviRI* FalI SetI | SspI | | TspEI BciVI FalI \ \ \ \ \ \ \ \ AGAAATACCTCGAACATAAAATATTTTTTGACATATGCAGATAATTACGCTATTGGATAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTATGGAGCTTGTATTTTATAAAAAACTGTATACGTCTATTAATGCGATAACCTATG / / / / / / / / / SetI TaqI MnlI SspI | CviRI* | | FalI NdeI | | FalI | BciVI TspEI R N T S N I K Y F L T Y A D N Y A I G Y E I P R T * N I F * H M Q I I T L L D T K Y L E H K I F F D I C R * L R Y W I L ----:----|----:----|----:----|----:----|----:----|----:----| L F V E F M F Y K K V Y A S L * A I P Y * F Y R S C L I N K S M H L Y N R * Q I S I G R V Y F I K Q C I C I I V S N S V FalI FalI |MaeII MseI MmeI || SetI |AhaIII* CviJI || TaiI BccI BseGI \\ \ \\ \ \ \ TTTAAAAAGCAAGGCTTCACTAAAGAAATCACGTTGGATAAAAGTATATGGATGGGATAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTTTTCGTTCCGAAGTGATTTCTTTAGTGCAACCTATTTTCATATACCTACCCTATA // / / / / / / / |MseI | CviJI FalI | MaeII BccI BseGI AhaIII* MmeI FalI TaiI SetI F K K Q G F T K E I T L D K S I W M G Y L K S K A S L K K S R W I K V Y G W D I * K A R L H * R N H V G * K Y M D G I Y ----:----|----:----|----:----|----:----|----:----|----:----| K L F C P K V L S I V N S L L I H I P Y S * F A L S * * L F * T P Y F Y I S P I K F L L A E S F F D R Q I F T Y P H S I SfaNI MseI |SetI |FokI || Csp6I TspDTI BsrDI || Hin4II* || |RsaI | CviRI* | MaeIII BspMI \\ \ \\ \\ \ \ \ \ \ ATTAAAGATTATGAAGGTGGTACGCTGATGCAATGTTCTATGTTACCAAGAATACGATAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTTCTAATACTTCCACCATGCGACTACGTTACAAGATACAATGGTTCTTATGCTATA / // / // / / / / | |FokI SetI || | | BsrDI MaeIII | Hin4II* || | CviRI* MseI || TspDTI |Csp6I SfaNI RsaI I K D Y E G G T L M Q C S M L P R I R Y L K I M K V V R * C N V L C Y Q E Y D I * R L * R W Y A D A M F Y V T K N T I F ----:----|----:----|----:----|----:----|----:----|----:----| I L S * S P P V S I C H E I N G L I R Y Y * L N H L H Y A S A I N * T V L F V I N F I I F T T R Q H L T R H * W S Y S I AciI |BisI ||BlsI ||AsuI* SetI |||TauI |HgaI |||CviJI || TfiI |||HaeIII MboII || HinfI |||BmgT120I | XmnI \\ \ \\\\ \ \ TTGGACGCAGGTAAGATTCTATTATTACAAGAAGCGGCCCTGCGAAGAAAAATAAGAACG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTGCGTCCATTCTAAGATAATAATGTTCTTCGCCGGGACGCTTCTTTTTATTCTTGC / / / ////// / / BspMI SetI HinfI |||||AsuI* | XmnI HgaI ||||BmgT120I MboII TfiI |||HaeIII |||CviJI ||BisI ||AciI |BlsI TauI L D A G K I L L L Q E A A L R R K I R T W T Q V R F Y Y Y K K R P C E E K * E R G R R * D S I I T R S G P A K K N K N D ----:----|----:----|----:----|----:----|----:----|----:----| K S A P L I R N N C S A A R R L F I L V N P R L Y S E I I V L L P G A F F F L F Q V C T L N * * * L F R G Q S S F Y S R StuI BssKI CviJI EcoRII HaeIII TaqI | ScrFI AsuII | BseBI TspEI MseI \ \ \ \ \ ATTTCGAAATCGCATATTGTAAGGCCTGGTTTAGAGCAATTCAAAGACTTAAACAATATC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGCTTTAGCGTATAACATTCCGGACCAAATCTCGTTAAGTTTCTGAATTTGTTATAG / / / / / / AsuII | | EcoRII TspEI MseI TaqI | | BssKI | BseBI | ScrFI HaeIII CviJI StuI I S K S H I V R P G L E Q F K D L N N I F R N R I L * G L V * S N S K T * T I S F E I A Y C K A W F R A I Q R L K Q Y Q ----:----|----:----|----:----|----:----|----:----|----:----| I E F D C I T L G P K S C N L S K F L I S K S I A Y Q L A Q N L A I * L S L C Y N R F R M N Y P R T * L L E F V * V I D MroNI CviJI Cfr10I |HpaII ||MlyI ||PleI ||NaeI ||Cac8I |||BcgI ||||CviJI ||||| HinfI BssKI ||||| | BccI BinI* EcoRII ||||| | SfaNI | MboI | ScrFI ||||| | |AvaI | | DpnI | BseBI ||||| | |Hpy178III* | | |BstKTI | | CviJI ||||| | ||BmeT110I \ \ \\ \ \ \ \\\\\ \ \\\ AAACCGATTGATCCAATGACTATTCCTGGCTTGAAAGAAGCCGGCTGGACTCCCGAGATG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGCTAACTAGGTTACTGATAAGGACCGAACTTTCTTCGGCCGACCTGAGGGCTCTAC / // / / / ///// // /// | || MboI | EcoRII ||||Cfr10I || ||AvaI | |DpnI | BssKI ||||MroNI || |BmeT110I | BstKTI | CviJI ||||CviJI || |SfaNI BinI* BseBI |||HpaII || Hpy178III* ScrFI |||PleI |BccI ||Cac8I HinfI ||NaeI ||MlyI |BcgI CviJI K P I D P M T I P G L K E A G W T P E M N R L I Q * L F L A * K K P A G L P R W T D * S N D Y S W L E R S R L D S R D G ----:----|----:----|----:----|----:----|----:----|----:----| L G I S G I V I G P K F S A P Q V G S I * V S Q D L S * E Q S S L L R S S E R S F R N I W H S N R A Q F F G A P S G L H BsiYI* FokI | SfaNI | MaeII | |AsuI* TseI | | BcgI | |AvaII CviRI* BslFI | | |SetI | ||BmgT120I |BisI | BseGI | | |TaiI | ||| Hpy166II ||BlsI BbvI \ \ \ \ \\ \ \\\ \ \\\ \ GATGCGTTGGCACAACGTCCCAAGCGTGGTCCACACGATGCAGCAATACAGAATATACTC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGCAACCGTGTTGCAGGGTTCGCACCAGGTGTGCTACGTCGTTATGTCTTATATGAG / / // / / // //// / | BslFI || | BsiYI* |Hpy166II |||TseI BbvI BseGI || MaeII |AvaII ||BisI || FokI |AsuI* |BlsI |BcgI |SfaNI CviRI* TaiI BmgT120I SetI D A L A Q R P K R G P H D A A I Q N I L M R W H N V P S V V H T M Q Q Y R I Y S C V G T T S Q A W S T R C S N T E Y T H ----:----|----:----|----:----|----:----|----:----|----:----| S A N A C R G L R P G C S A A I C F I S P H T P V V D W A H D V R H L L V S Y V I R Q C L T G L T T W V I C C Y L I Y E FatI |CviAII || TseI || CviRI* || NlaIII || |BisI || ||BlsI || |||TseI || ||||BisI || |||||BlsI || ||||||AluI || ||||||CviJI || ||||||| SetI || ||||||| | AsuI* Hin4II* || ||||||| | |CviJI | BslFI || ||||||| | |HaeIII | |MseI AsuI* AluI || ||||||| | |BmgT120I | ||MnlI AvaII CviJI || ||||||| | ||BbvI | ||| EcoP15I DraII | SetI || ||||||| | ||| BbvI | ||| |MnlI PpuMI \ \ \\ \\\\\\\ \ \\\ \ \ \\\ \\ \ ACAGAGCTACAAAATCATGCAGCAGCTTGGCCCTTCTTACAACCCGTTAATAAAGAGGAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTCGATGTTTTAGTACGTCGTCGAACCGGGAAGAATGTTGGGCAATTATTTCTCCTC / / / //////// /// / / / / // / / | CviJI | |||||||| ||| | | | | || | SetI | AluI | |||||||| ||| | | | | || EcoP15I SetI | |||||||| ||| | | | | |BslFI | |||||||| ||| | | | | |MnlI | |||||||| ||| | | | | MseI | |||||||| ||| | | | MnlI | |||||||| ||| | | Hin4II* | |||||||| ||| | BbvI | |||||||| ||| BbvI | |||||||| ||AsuI* | |||||||| |BmgT120I | |||||||| HaeIII | |||||||| CviJI | |||||||CviJI | |||||||TseI | |||||||AluI | ||||||BisI | |||||BlsI | |||||SetI | ||||TseI | |||BisI | ||BlsI | |CviRI* | |FatI | CviAII NlaIII T E L Q N H A A A W P F L Q P V N K E E Q S Y K I M Q Q L G P S Y N P L I K R R R A T K S C S S L A L L T T R * * R G G ----:----|----:----|----:----|----:----|----:----|----:----| V S S C F * A A A Q G K K C G T L L S S * L A V F D H L L K A R R V V R * Y L P C L * L I M C C S P G E * L G N I F L L SduI HgiAI* |FatI |NcoI |StyI |SecI* BmgT120I |DsaI* |SetI ||CviAII TspEI |NlaIV BseRI CviJI SmlI ||| NlaIII | Bce83I* \\ \ \ \ \\\ \ \ \ GTCCCCGACTATTATGATTTTATCAAAGAGCCAATGGACTTGAGCACCATGGAAATAAAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CAGGGGCTGATAATACTAAAATAGTTTCTCGGTTACCTGAACTCGTGGTACCTTTATTTT // / / // / // / || BseRI CviJI || | |DsaI* Bce83I* |PpuMI || | |SecI* |DraII || | |StyI |AvaII || | |NcoI |AsuI* || | |FatI BmgT120I || | CviAII NlaIV || NlaIII |SmlI HgiAI* SduI V P D Y Y D F I K E P M D L S T M E I K S P T I M I L S K S Q W T * A P W K * N P R L L * F Y Q R A N G L E H H G N K I ----:----|----:----|----:----|----:----|----:----|----:----| T G S * * S K I L S G I S K L V M S I F P G R S N H N * * L A L P S S C W P F L D G V I I I K D F L W H V Q A G H F Y F SfaNI BccI MboII | Hpy188I | BbvII* | | TspDTI | | MboII MseI \ \ \ \ \ \ \ TTAGAGAGCAACAAATATCAGAAGATGGAAGACTTCATATATGATGCCAGATTGGTGTTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTCTCGTTGTTTATAGTCTTCTACCTTCTGAAGTATATACTACGGTCTAACCACAAA / / / / / / TspEI | TspDTI | | BbvII* Hpy188I | | MboII BccI | SfaNI MboII L E S N K Y Q K M E D F I Y D A R L V F * R A T N I R R W K T S Y M M P D W C L R E Q Q I S E D G R L H I * C Q I G V * ----:----|----:----|----:----|----:----|----:----|----:----| N S L L L Y * F I S S K M Y S A L N T N I L S C C I D S S P L S * I H H W I P T * L A V F I L L H F V E Y I I G S Q H K TatI Bsp1407I MaeII |Csp6I | SetI CviJI MfeI ||RsaI | TaiI |MaeI TspEI ||Hin4I | | Hpy99I Hin4I || MboII \ \\\ \ \ \ \ \\ \ AACAATTGCCGAATGTACAATGGCGAGAATACGTCGTATTACAAGTATGCTAATAGGCTA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTAACGGCTTACATGTTACCGCTCTTATGCAGCATAATGTTCATACGATTATCCGAT / / / /// // / / / // MseI | | ||Bsp1407I || MaeII Hin4I | |MaeI | | ||TatI |Hpy99I | MboII | | |Csp6I TaiI CviJI | | RsaI SetI | Hin4I TspEI MfeI N N C R M Y N G E N T S Y Y K Y A N R L T I A E C T M A R I R R I T S M L I G * Q L P N V Q W R E Y V V L Q V C * * A R ----:----|----:----|----:----|----:----|----:----|----:----| L L Q R I Y L P S F V D Y * L Y A L L S * C N G F T C H R S Y T T N C T H * Y A V I A S H V I A L I R R I V L I S I P * ApoI SetI MseI TspEI BdaI |HphI | BdaI | XmnI BdaI || SspI SetI | BdaI \ \ \ \\ \ \ \ \ GAGAAATTCTTCAATAATAAAGTAAAAGAAATACCTGAATATTCTCACCTTATTGATTAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTTAAGAAGTTATTATTTCATTTTCTTTATGGACTTATAAGAGTGGAATAACTAATT // / / / / / / / |TspEI BdaI | | SspI SetI | MseI |ApoI BdaI | HphI BdaI XmnI SetI BdaI E K F F N N K V K E I P E Y S H L I D * R N S S I I K * K K Y L N I L T L L I X E I L Q * * S K R N T * I F S P Y * L X ----:----|----:----|----:----|----:----|----:----|----:----| S F N K L L L T F S I G S Y E * R I S * L S I R * Y Y L L L F V Q I N E G * Q N L F E E I I F Y F F Y R F I R V K N I L # Enzymes that cut Frequency Isoschizomers AciI 2 BspACI,SsiI AclI 1 Psp1406I AhaIII* 1 DraI AluI 3 AluBI ApoI 4 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BamHI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 7 Bce83I* 1 BpuEI BcgI 1 BciVI 1 BfuI BdaI 6 BfiI 1 BmrI,BmuI BinI* 5 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmeT110I 1 BmgT120I 5 Bpu10I 1 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 3 BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 3 BspMI 1 BfuAI,Acc36I,BveI BsrDI 2 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstKTI 5 Cac8I 2 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 3 CviQI,RsaNI CviAII 4 CviJI 15 CviKI-1 CviRI* 4 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 5 MalI DraII 1 EcoO109I DsaI* 2 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco31I 2 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 1 EcoP15I 1 EcoRI 1 EcoRII 3 AjnI,Psp6I,PspGI FalI 2 FatI 4 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 FspAI 1 GlaI 1 HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 3 HpyAV Hin6I 1 HinP1I,HspAI HinfI 3 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 3 Hpy188III Hpy188I 3 Hpy99I 3 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 3 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 MfeI 1 MunI MlyI 1 SchI MmeI 1 MnlI 7 MroNI 1 NgoMIV MseI 9 Tru1I,Tru9I MslI 1 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I NaeI 1 PdiI NcoI 2 Bsp19I NdeI 1 FauNDI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I PleI 1 PpsI PpuMI 1 Psp5II,PspPPI RsaI 3 AfaI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 19 SfaNI 5 LweI SmlI 1 SmoI SspI 2 StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 7 TatI 1 TauI 1 TfiI 2 PfeI TseI 3 ApeKI TsoI 1 Tsp45I 1 NmuCI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 13 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI TstI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AflIII AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvrII BaeI BalI BarI BbvCI BceAI BclI BetI* BglI BglII BmtI BplI BsaAI BsaBI BsaXI BsePI BseYI BsgI BsiI* BsmI Bsp120I BspHI BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I CfrI ClaI CspCI DinI DraIII DrdI EciI Ecl136II Eco47III EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FauI FseI GsaI GsuI HaeII HgiJII* HindII HindIII HpaI KasI KpnI MauBI McrI* MluI Mph1103I MwoI NarI NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TaqII TspMI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769