Restriction Map of PFK1/YGR240C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

PFK1/YGR240C on chromosome VII from coordinates 973734 to 970771.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 CviRI* | TspDTI | | SmlI | | | Hpy178III* | | | | TfiI | | | | HinfI | | | | | FatI | | | | | |CviAII | | | | | || NlaIII | | | | | || | Tsp4CI* | | | | | || | | Hin4I | | | | | || | | Hin4I | | | | | || | | | BsmI | | | | | || | | | CviRI* | | | | | || | | | | MboI | | | | | || | | | | BglII | | | | | || | | | | XhoII | | | | | || | | | | Hpy188I | | | | | || | | | | | DpnI | | | | | || | | | | | |BstKTI HindIII \ \ \ \ \ \\ \ \ \ \ \ \\ \ ATGCAATCTCAAGATTCATGCTACGGTGTTGCATTCAGATCTATCATCACAAATGATGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTAGAGTTCTAAGTACGATGCCACAACGTAAGTCTAGATAGTAGTGTTTACTACTT / / / // / / / / // / / / CviRI* | | || | | | | || XhoII | SetI TspDTI | | || | | | | || BglII Hin4I | | || | | | | || MboI Hin4I | | || | | | | |DpnI | | || | | | | BstKTI | | || | | | Hpy188I | | || | | CviRI* | | || | BsmI | | || Tsp4CI* | | || Hin4I | | || Hin4I | | |FatI | | CviAII | NlaIII | HinfI | TfiI Hpy178III* SmlI M Q S Q D S C Y G V A F R S I I T N D E C N L K I H A T V L H S D L S S Q M M K A I S R F M L R C C I Q I Y H H K * * S ----:----|----:----|----:----|----:----|----:----|----:----| X C D * S E H * P T A N L D I M V F S S X A I E L N M S R H Q M * I * * * L H H H L R L I * A V T N C E S R D D C I I F AluI BdaI CviJI BdaI Hin4I Hpy178III* | CviRI* Hin4I | BbvII* | | Tsp4CI* | SetI | TspDTI | MboII MaeI | | | XmnI \ \ \ \ \ \ \ \ \ \ \ GCTTTATTCAAGAAGACCATTCACTTTTATCACACTCTAGGATTTGCAACTGTGAAAGAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAATAAGTTCTTCTGGTAAGTGAAAATAGTGTGAGATCCTAAACGTTGACACTTTCTA / / / / / // / / / | | | Hpy178III* BbvII* |BdaI | Tsp4CI* XmnI | | TspDTI MboII |BdaI CviRI* | HindIII MaeI CviJI AluI A L F K K T I H F Y H T L G F A T V K D L Y S R R P F T F I T L * D L Q L * K I F I Q E D H S L L S H S R I C N C E R F ----:----|----:----|----:----|----:----|----:----|----:----| A K N L F V M * K * * V R P N A V T F S L K I * S S W E S K D C E L I Q L Q S L S * E L L G N V K I V S * S K C S H F I FatI |BdaI |BdaI |CviAII || NlaIII || | Eco57I || | Eco57MI || | | AluI || | | MboII TfiI || | | CviJI HinfI ApoI || | | | SetI | BslFI TspEI || | | | HphI | | SmlI \ \\ \ \ \ \ \ \ \ TTCAACAAATTCAAACATGGTGAAAATAGCTTACTATCTTCAGGGACTTCCCAAGATTCC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTGTTTAAGTTTGTACCACTTTTATCGAATGATAGAAGTCCCTGAAGGGTTCTAAGG / // // / //// / | || || | |||HphI HinfI | || || | ||CviJI TfiI | || || | ||AluI | || || | |MboII | || || | SetI | || || Eco57MI | || || Eco57I | || |FatI | || CviAII | |NlaIII | BdaI | BdaI TspEI ApoI F N K F K H G E N S L L S S G T S Q D S S T N S N M V K I A Y Y L Q G L P K I P Q Q I Q T W * K * L T I F R D F P R F L ----:----|----:----|----:----|----:----|----:----|----:----| K L L N L C P S F L K S D E P V E W S E N * C I * V H H F Y S V I K L S K G L N E V F E F M T F I A * * R * P S G L I G TfiI HinfI MnlI NlaIV TsoI | Bce83I* | SfaNI SetI TspGWI | AccI \ \ \ \ \ \ \ \ \ TTGAGAGAAGTTTGGTTAGAATCTTTCAAGTTGAGTGAGGTTGATGCTTCTGGGTTCCGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AACTCTCTTCAAACCAATCTTAGAAAGTTCAACTCACTCCAACTACGAAGACCCAAGGCA / / / / / / / / | SmlI | HinfI MnlI SfaNI TspGWI NlaIV BslFI | TfiI SetI TsoI Bce83I* L R E V W L E S F K L S E V D A S G F R * E K F G * N L S S * V R L M L L G S V E R S L V R I F Q V E * G * C F W V P Y ----:----|----:----|----:----|----:----|----:----|----:----| K L S T Q N S D K L N L S T S A E P N R R S L L K T L I K * T S H P Q H K Q T G Q S F N P * F R E L Q T L N I S R P E T SetI AluI | SduI TfiI BssNAI CviJI | HgiAI* HinfI Hpy166II | SetI CviJI | | MseI | Hin4I \ \ \ \ \ \ \ \ \ ATACCACAACAAGAAGCTACTAACAAGGCTCAAAGTCAAGGTGCTCTATTAAAGATTCGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TATGGTGTTGTTCTTCGATGATTGTTCCGAGTTTCAGTTCCACGAGATAATTTCTAAGCA // / / / / / // / |AccI | CviJI CviJI | HgiAI* || HinfI Hpy166II | AluI | SduI || TfiI BssNAI SetI SetI |Hin4I MseI I P Q Q E A T N K A Q S Q G A L L K I R Y H N K K L L T R L K V K V L Y * R F V T T T R S Y * Q G S K S R C S I K D S F ----:----|----:----|----:----|----:----|----:----|----:----| I G C C S A V L L A * L * P A R N F I R Y V V V L L * * C P E F D L H E I L S E Y W L L F S S V L S L T L T S * * L N T TaqI Hin4I ClaI | TaqI TspDTI AciI \ \ \ \ \ TTAGTGATGTCTGCTCCAATCGATGAAACTTTCGACACCAACGAAACCGCCACAATCACT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AATCACTACAGACGAGGTTAGCTACTTTGAAAGCTGTGGTTGCTTTGGCGGTGTTAGTGA / / / / / | Hin4I | TspDTI AciI ClaI TaqI TaqI L V M S A P I D E T F D T N E T A T I T * * C L L Q S M K L S T P T K P P Q S L S D V C S N R * N F R H Q R N R H N H L ----:----|----:----|----:----|----:----|----:----|----:----| K T I D A G I S S V K S V L S V A V I V N L S T Q E L R H F K R C W R F R W L * * H H R S W D I F S E V G V F G G C D S TaqI |Hpy178III* || ApoI TspEI || TspEI CviJI |BaeI \\ \ \ \\ TATTTCTCTACTGATTTGAACAAGATTGTCGAGAAATTCCCAAAACAAGCCGAAAAATTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAAGAGATGACTAAACTTGTTCTAACAGCTCTTTAAGGGTTTTGTTCGGCTTTTTAAC // / / / / || TspEI | BaeI TspEI || ApoI CviJI |Hpy178III* TaqI Y F S T D L N K I V E K F P K Q A E K L I S L L I * T R L S R N S Q N K P K N C F L Y * F E Q D C R E I P K T S R K I V ----:----|----:----|----:----|----:----|----:----|----:----| * K E V S K F L I T S F N G F C A S F N K N R * Q N S C S Q R S I G L V L R F I I E R S I Q V L N D L F E W F L G F F Q BinI* | MboI | XhoII CviJI Hpy188I | | DpnI |DdeI | DdeI | | |BstKTI SetI |EspI* | |SetI | | || BaeI HphI | DdeI |Hin4II* \ \\ \ \ \\ \ \ \ \ \\ TCCGATACCTTAGTGTTTTTGAAAGATCCAATGGGCAACAACATCACCTTCTCAGGCTTA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCTATGGAATCACAAAAACTTTCTAGGTTACCCGTTGTTGTAGTGGAAGAGTCCGAAT / / / / /// / / / / / // | SetI DdeI | ||| XhoII HphI SetI | | |EspI* Hpy188I | ||| MboI | | |DdeI | ||DpnI | | SetI | |BstKTI | Hin4II* | BaeI | CviJI BinI* DdeI S D T L V F L K D P M G N N I T F S G L P I P * C F * K I Q W A T T S P S Q A * R Y L S V F E R S N G Q Q H H L L R L S ----:----|----:----|----:----|----:----|----:----|----:----| D S V K T N K F S G I P L L M V K E P K T R Y R L T K S L D L P C C C * R R L S G I G * H K Q F I W H A V V D G E * A * AluI CviJI | SetI | |BspCNI | ||BseMII DdeI | ||| CviRI* | MmeI | ||| | TfiI | | AluI | ||| | HinfI | | CviJI | ||| | | AciI | | | SetI | ||| | | | BsrBI | | | | AjuI | ||| | | | | AjuI | | | | |SetI | ||| | | | | | SfaNI | | | | || Hpy188I \ \\\ \ \ \ \ \ \ \ \ \ \ \\ \ GCTAATGCAACCGATTCCGCTCCAACTTCCAAAGATGCTTTCTTAGAAGCTACCTCCGAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTACGTTGGCTAAGGCGAGGTTGAAGGTTTCTACGAAAGAATCTTCGATGGAGGCTT /// / // / / // / / / / ||| CviRI* || BsrBI SfaNI || | | SetI Hpy188I ||BseMII || AciI || | CviJI |BspCNI |AjuI || | AjuI CviJI HinfI || | AluI AluI TfiI || SetI |DdeI MmeI A N A T D S A P T S K D A F L E A T S E L M Q P I P L Q L P K M L S * K L P P K * C N R F R S N F Q R C F L R S Y L R R ----:----|----:----|----:----|----:----|----:----|----:----| A L A V S E A G V E L S A K K S A V E S L * H L R N R E L K W L H K R L L * R R S I C G I G S W S G F I S E * F S G G F MnlI | BbvII* | | MboII | | | XbaI | | | |MaeI | | | |MboII | | | |Hpy178III* | | | || SfaNI | | | || |AluI | | | || |CviJI Hpy188I | | | || || SetI Hpy188I | DdeI MboII CviJI \ \ \ \\ \\ \ \ \ \ \ \ GACGAAATCATCTCTAGAGCTTCTTCCGATGCTTCTGACTTACTAAGACAAACATTGGGC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTTTAGTAGAGATCTCGAAGAAGGCTACGAAGACTGAATGATTCTGTTTGTAACCCG / / / // / / / / / / / / MnlI | | || | | Hpy188I Hpy188I DdeI | | CviJI | | || | SfaNI | HgiJII* | | || CviJI | SduI | | || AluI MboII | | |XbaI | | |SetI | | Hpy178III* | | MaeI | MboII BbvII* MboII D E I I S R A S S D A S D L L R Q T L G T K S S L E L L P M L L T Y * D K H W A R N H L * S F F R C F * L T K T N I G L ----:----|----:----|----:----|----:----|----:----|----:----| S S I M E L A E E S A E S K S L C V N P L R F * R * L K K R H K Q S V L V F M P V F D D R S S R G I S R V * * S L C Q A MboII | MboII | | FatI TfiI | | BspHI HinfI | | |MboII | BssKI | | |CviAII | EcoRII SduI | | |Hpy178III* | | ScrFI HgiJII* | | || NlaIII | | BseBI | SapI | | || | GsuI | | | HphI | Ksp632I* | | || | Eco57MI | | | | SetI \ \ \ \ \\ \ \ \ \ \ \ \ TCTTCTCAAAAGAAGAAGAAGATTGCTGTCATGACTTCTGGTGGTGATTCTCCAGGTATG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGAGTTTTCTTCTTCTTCTAACGACAGTACTGAAGACCACCACTAAGAGGTCCATAC / / / / // / // / Ksp632I* | | | |Eco57MI | || EcoRII SapI | | | |BspHI | || BssKI | | | |FatI | |BseBI | | | |GsuI | |ScrFI | | | Hpy178III* | |HphI | | | CviAII | SetI | | NlaIII HinfI | | MboII TfiI | MboII MboII S S Q K K K K I A V M T S G G D S P G M L L K R R R R L L S * L L V V I L Q V * F S K E E E D C C H D F W W * F S R Y E ----:----|----:----|----:----|----:----|----:----|----:----| E E * F F F F I A T M V E P P S E G P I S K E F S S S S Q Q * S K Q H H N E L Y R R L L L L L N S D H S R T T I R W T H BceAI | AciI | BisI | |BlsI | |BsmI | ||TauI AccI | ||NspBII* SetI | ||| MwoI Csp6I |BssNAI | ||| TspDTI |RsaI |Hpy166II CviJI \ \\\ \ \\ \\ \ AATGCCGCTGTTCGTGCCGTTGTTCGTACAGGTATACATTTCGGCTGTGATGTTTTTGCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGGCGACAAGCACGGCAACAAGCATGTCCATATGTAAAGCCGACACTACAAAAACGA ///// // /// // / / ||||| |TspDTI ||SetI |AccI CviJI Hin4II* ||||| MwoI |Csp6I Hpy166II ||||NspBII* RsaI BssNAI ||||AciI |||BisI ||BlsI |BsmI |TauI BceAI N A A V R A V V R T G I H F G C D V F A M P L F V P L F V Q V Y I S A V M F L L C R C S C R C S Y R Y T F R L * C F C C ----:----|----:----|----:----|----:----|----:----|----:----| F A A T R A T T R V P I C K P Q S T K A S H R Q E H R Q E Y L Y V N R S H H K Q I G S N T G N N T C T Y M E A T I N K S Hin4II* | Hpy166II SetI | | MaeIII |MnlI SspI | | Hin4II* |Hpy166II | MseI | | | SetI || DdeI AciI | |AhaIII* CviJI \ \ \ \ \\ \ \ \ \\ \ GTTTACGAAGGTTACGAAGGTTTACTAAGAGGCGGTAAATATTTAAAGAAAATGGCTTGG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CAAATGCTTCCAATGCTTCCAAATGATTCTCCGCCATTTATAAATTTCTTTTACCGAACC / // / / // / / / // / | || | | || DdeI AciI | |MseI CviJI | || | | |Hpy166II | AhaIII* | || | | MnlI SspI | || | SetI | || MaeIII | |Hin4II* | SetI Hpy166II V Y E G Y E G L L R G G K Y L K K M A W F T K V T K V Y * E A V N I * R K W L G L R R L R R F T K R R * I F K E N G L G ----:----|----:----|----:----|----:----|----:----|----:----| T * S P * S P K S L P P L Y K F F I A Q Q K R L N R L N V L L R Y I N L S F P K N V F T V F T * * S A T F I * L F H S P MnlI | TsoI | | Hpy188I | | | MboII SetI | | | | SetI | Csp6I | | | | | MseI | |RsaI Csp6I | | | | | Hin4II* | || PsrI |RsaI \ \ \ \ \ \ \ \\ \ \\ GAAGATGTCAGAGGTTGGTTAAGTGAAGGTGGTACTTTGATTGGTACTGCTCGTTCTATG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTACAGTCTCCAACCAATTCACTTCCACCATGAAACTAACCATGACGAGCAAGATAC // / // / / / / // // |TsoI | |MboII | MseI SetI | |Csp6I |Csp6I MnlI | SetI Hin4II* | RsaI RsaI Hpy188I PsrI E D V R G W L S E G G T L I G T A R S M K M S E V G * V K V V L * L V L L V L W R C Q R L V K * R W Y F D W Y C S F Y G ----:----|----:----|----:----|----:----|----:----|----:----| S S T L P Q N L S P P V K I P V A R E I P L H * L N T L H L H Y K S Q Y Q E N * F I D S T P * T F T T S Q N T S S T R H AccI |Hpy166II || TseI || AluI || CviJI || |BisI || |SfeI* || ||BlsI || ||SetI || |||CviRI* || |||| PstI || |||| Cac8I ApoI Hpy188I || |||| | TspEI TspEI |PsrI || |||| | | MseI EcoRI ||MnlI BbvI || |||| | | |TspEI SetI \ \\\ \ \\ \\\\ \ \ \\ \ GAATTCAGAAAGCGTGAGGGTCGTAGACAAGCTGCAGGCAATTTAATTTCGCAAGGTATT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAAGTCTTTCGCACTCCCAGCATCTGTTCGACGTCCGTTAAATTAAAGCGTTCCATAA / // / / // / //// / / / / / | || MnlI | || | |||| SfeI* | | | SetI | |Hpy188I | || | |||| Cac8I | | TspEI | EcoRI | || | |||CviRI* | MseI | TspEI | || | |||TseI TspEI | ApoI | || | ||BisI PsrI | || | |BlsI | || | |PstI | || | CviJI | || | AluI | || SetI | |AccI | Hpy166II BbvI E F R K R E G R R Q A A G N L I S Q G I N S E S V R V V D K L Q A I * F R K V L I Q K A * G S * T S C R Q F N F A R Y * ----:----|----:----|----:----|----:----|----:----|----:----| S N L F R S P R L C A A P L K I E C P I P I * F A H P D Y V L Q L C N L K A L Y F E S L T L T T S L S C A I * N R L T N MseI HphI | AgeI | BetI* MboI | Cfr10I | DpnI HgaI BccI | |HpaII | |BstKTI Hpy188I \ \ \ \\ \ \\ \ GACGCTTTGGTTGTTTGTGGTGGTGATGGTTCTTTAACCGGTGCTGATCTTTTCAGACAC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCGAAACCAACAAACACCACCACTACCAAGAAATTGGCCACGACTAGAAAAGTCTGTG / / / / // // / / HgaI BccI | | || || MboI Hpy188I | | || |DpnI | | || BstKTI | | |Cfr10I | | |BetI* | | |AgeI | | HpaII | MseI HphI D A L V V C G G D G S L T G A D L F R H T L W L F V V V M V L * P V L I F S D T R F G C L W W * W F F N R C * S F Q T R ----:----|----:----|----:----|----:----|----:----|----:----| S A K T T Q P P S P E K V P A S R K L C Q R K P Q K H H H H N K L R H Q D K * V V S Q N N T T T I T R * G T S I K E S V Hin4II* | CviRI* CfrI | | TspDTI | BalI | | | SetI | CviJI | | | | TfiI | HaeIII BccI TspEI | | | | HinfI \ \ \ \ \ \ \ \ \ GAATGGCCATCTTTGGTTGATGAATTGGTTGCAGAAGGTAGATTCACTAAAGAAGAAGTC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTACCGGTAGAAACCAACTACTTAACCAACGTCTTCCATCTAAGTGATTTCTTCTTCAG / / / // / / / / | CfrI BccI || | | SetI HinfI HaeIII || | TspDTI TfiI CviJI || CviRI* BalI |Hin4II* TspEI E W P S L V D E L V A E G R F T K E E V N G H L W L M N W L Q K V D S L K K K S M A I F G * * I G C R R * I H * R R S R ----:----|----:----|----:----|----:----|----:----|----:----| S H G D K T S S N T A S P L N V L S S T R I A M K P Q H I P Q L L Y I * * L L L F P W R Q N I F Q N C F T S E S F F F D NlaIV ApoI | TaqI MboII TspEI | ClaI BccI \ \ \ \ \ GCCCCATACAAGAATTTGTCCATTGTTGGTCTTGTCGGTTCCATCGATAATGATATGTCT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CGGGGTATGTTCTTAAACAGGTAACAACCAGAACAGCCAAGGTAGCTATTACTATACAGA / / / / / MboII TspEI NlaIV | BccI ApoI ClaI TaqI A P Y K N L S I V G L V G S I D N D M S P H T R I C P L L V L S V P S I M I C L P I Q E F V H C W S C R F H R * * Y V W ----:----|----:----|----:----|----:----|----:----|----:----| A G Y L F K D M T P R T P E M S L S I D R G M C S N T W Q Q D Q R N W R Y H Y T G W V L I Q G N N T K D T G D I I I H R MlyI PleI |Csp6I SfaNI ||RsaI TfiI HindII ||| HinfI MwoI HinfI Hpy166II \\\ \ \ \ \ GGTACTGACTCTACCATTGGTGCTTATTCTGCTTTGGAAAGAATCTGTGAAATGGTTGAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGACTGAGATGGTAACCACGAATAAGACGAAACCTTTCTTAGACACTTTACCAACTG //// / / / / |||Csp6I HinfI MwoI HinfI Hpy166II ||RsaI TfiI HindII |PleI MlyI G T D S T I G A Y S A L E R I C E M V D V L T L P L V L I L L W K E S V K W L T Y * L Y H W C L F C F G K N L * N G * L ----:----|----:----|----:----|----:----|----:----|----:----| P V S E V M P A * E A K S L I Q S I T S Q Y Q S * W Q H K N Q K P F F R H F P Q T S V R G N T S I R S Q F S D T F H N V OliI AccI AciI MslI |Hpy166II \ \ \\ TACATTGATGCCACCGCTAAATCCCACTCCCGTGCCTTTGTTGTTGAAGTTATGGGTAGA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTAACTACGGTGGCGATTTAGGGTGAGGGCACGGAAACAACAACTTCAATACCCATCT / / / // SfaNI AciI MslI |AccI OliI Hpy166II Y I D A T A K S H S R A F V V E V M G R T L M P P L N P T P V P L L L K L W V D H * C H R * I P L P C L C C * S Y G * T ----:----|----:----|----:----|----:----|----:----|----:----| * M S A V A L D W E R A K T T S T I P L S C Q H W R * I G S G H R Q Q Q L * P Y V N I G G S F G V G T G K N N F N H T S AgeI BccI BetI* |CviJI Cfr10I |HaeIII |HpaII || BglI || MwoI || MwoI || HgiCI* || | CviJI MwoI || | NlaIV \\ \ \ \ \\ \ \ CATTGTGGTTGGTTGGCCTTGATGGCTGGTATTGCTACCGGTGCCGATTACATTTTTATT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GTAACACCAACCAACCGGAACTACCGACCATAACGATGGCCACGGCTAATGTAAAAATAA / / / / / /// / | MwoI | MwoI | ||| HgiCI* | BglI CviJI | ||NlaIV HaeIII | |Cfr10I CviJI | |BetI* BccI | |AgeI | HpaII MwoI H C G W L A L M A G I A T G A D Y I F I I V V G W P * W L V L L P V P I T F L F L W L V G L D G W Y C Y R C R L H F Y S ----:----|----:----|----:----|----:----|----:----|----:----| C Q P Q N A K I A P I A V P A S * M K I V N H N T P R S P Q Y Q * R H R N C K * M T T P Q G Q H S T N S G T G I V N K N Hpy178III* | AluI TspGWI | CviJI |Hin4II* | | SetI MnlI ||TspEI \ \ \ \ \\\ CCAGAAAGAGCTGTTCCTCACGGAAAATGGCAGGACGAATTGAAGGAAGTGTGCCAAAGA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTTTCTCGACAAGGAGTGCCTTTTACCGTCCTGCTTAACTTCCTTCACACGGTTTCT / / / / / / / | | CviJI MnlI | | TspEI | | AluI | Hin4II* | SetI TspGWI Hpy178III* P E R A V P H G K W Q D E L K E V C Q R Q K E L F L T E N G R T N * R K C A K D R K S C S S R K M A G R I E G S V P K T ----:----|----:----|----:----|----:----|----:----|----:----| G S L A T G * P F H C S S N F S T H W L E L F L Q E E R F I A P R I S P L T G F W F S S N R V S F P L V F Q L F H A L S MboI BclI TspEI MwoI | DpnI MboII Hin4II* | SetI | |BstKTI \ \ \ \ \ \\ CACAGAAGTAAGGGTAGAAGAAATAACACAATTATTGTCGCTGAAGGTGCTTTAGATGAT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GTGTCTTCATTCCCATCTTCTTTATTGTGTTAATAACAGCGACTTCCACGAAATCTACTA / / / // /// | | | |SetI ||Eco57MI | | | MwoI ||Eco57I | | Hin4II* |DpnI | TspEI BstKTI MboII H R S K G R R N N T I I V A E G A L D D T E V R V E E I T Q L L S L K V L * M I Q K * G * K K * H N Y C R * R C F R * S ----:----|----:----|----:----|----:----|----:----|----:----| C L L L P L L F L V I I T A S P A K S S V C F Y P Y F F Y C L * Q R Q L H K L H V S T L T S S I V C N N D S F T S * I I SfaNI | AcyI | MaeII TspEI | |ZraI |Eco57I | || SetI XbaI |Eco57MI | || TaiI |MaeI || MseI MaeIII | || AatII TspEI |Hpy178III* \\ \ \ \ \\ \ \ \\ CAATTAAACCCTGTTACTGCCAATGACGTCAAAGATGCTTTGATTGAATTGGGTCTAGAC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAATTTGGGACAATGACGGTTACTGCAGTTTCTACGAAACTAACTTAACCCAGATCTG / // / / // / // | |MseI MaeIII | |MaeII TspEI |XbaI | TspEI | |SfaNI Hpy178III* BclI | |AcyI MaeI MboI | ZraI AatII TaiI SetI Q L N P V T A N D V K D A L I E L G L D N * T L L L P M T S K M L * L N W V * T I K P C Y C Q * R Q R C F D * I G S R H ----:----|----:----|----:----|----:----|----:----|----:----| * N F G T V A L S T L S A K I S N P R S D I L G Q * Q W H R * L H K S Q I P D L L * V R N S G I V D F I S Q N F Q T * V MaeI | MaeIII | Tsp45I SetI | | SetI | Csp6I TsoI | | | MaeII | |RsaI FatI StyI | | | |TsoI | || AluI BspHI SecI* | | | ||MnlI | || CviJI |CviAII | MaeIII | | | |||SetI | || PvuII |Hpy178III* | BstEII | | | |||TaiI | || NspBII* ||BccI | | SetI | | | |||| BaeI | || | SetI ||| NlaIII \ \ \ \ \ \ \\\\ \ \ \\ \ \ \\\ \ ACCAAGGTAACCATTCTAGGTCACGTTCAAAGAGGTGGTACAGCTGTTGCTCATGACAGA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTTCCATTGGTAAGATCCAGTGCAAGTTTCTCCACCATGTCGACAACGAGTACTGTCT / / / // / // / /// / / / // / | | | || | |MaeII SetI ||| | | | || BaeI | | | || | Tsp45I ||| | | | |BspHI | | | || | MaeIII ||| | | | |FatI | | | || | MnlI ||| | | | Hpy178III* | | | || | BaeI ||| | | | CviAII | | | || TsoI ||| | | | BccI | | | || TaiI ||| | | NlaIII | | | || SetI ||| | TsoI | | | |MaeI ||| NspBII* | | | SetI ||| PvuII | | BstEII ||| CviJI | | MaeIII ||| AluI | SecI* ||SetI | StyI |Csp6I SetI RsaI T K V T I L G H V Q R G G T A V A H D R P R * P F * V T F K E V V Q L L L M T D Q G N H S R S R S K R W Y S C C S * Q M ----:----|----:----|----:----|----:----|----:----|----:----| V L T V M R P * T * L P P V A T A * S L C W P L W E L D R E F L H Y L Q Q E H C G L Y G N * T V N L S T T C S N S M V S MseI | MwoI | | CviJI | | HaeIII | | | Hpy178III* AluI SetI | | | | ApoI CviJI |BceAI | | | | TspEI BaeI | SetI SfaNI ||TaqI | | | | | BsaXI \ \ \ \ \\\ \ \ \ \ \ \ TGGTTAGCTACTCTACAAGGTGTCGATGCTGTTAAGGCCGTTCTGGAATTTACCCCTGAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAATCGATGAGATGTTCCACAGCTACGACAATTCCGGCAAGACCTTAAATGGGGACTT / / / / // / / / / / / | CviJI | | |TaqI | | HaeIII | | TspEI | AluI | | BceAI | | CviJI | | ApoI SetI | SfaNI | MseI | BsaXI SetI MwoI Hpy178III* W L A T L Q G V D A V K A V L E F T P E G * L L Y K V S M L L R P F W N L P L K V S Y S T R C R C C * G R S G I Y P * N ----:----|----:----|----:----|----:----|----:----|----:----| H N A V R C P T S A T L A T R S N V G S I T L * E V L H R H Q * P R E P I * G Q P * S S * L T D I S N L G N Q F K G R F MseI VspI |TspEI |Hin4II* || PflMI || BsiYI* TfiI || | BsaXI TspEI BsmI HinfI \\ \ \ \ \ \ ACTCCTTCTCCATTAATTGGTATTTTAGAAAACAAGATAATTAGAATGCCATTGGTTGAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGGAAGAGGTAATTAACCATAAAATCTTTTGTTCTATTAATCTTACGGTAACCAACTT / / / / / | | BsaXI TspEI BsmI | | TspEI | VspI | MseI Hin4II* BsiYI* PflMI T P S P L I G I L E N K I I R M P L V E L L L H * L V F * K T R * L E C H W L N S F S I N W Y F R K Q D N * N A I G * I ----:----|----:----|----:----|----:----|----:----|----:----| V G E G N I P I K S F L I I L I G N T S F E K E M L Q Y K L F C S L * F A M P Q S R R W * N T N * F V L Y N S H W Q N F HindII Hpy166II TaqI | CspCI BtsI TspRI CspCI TspEI \ \ \ \ \ \ TCTGTGAAGTTGACTAAATCTGTTGCCACTGCCATTGAAAACAAAGATTTCGATAAGGCA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AGACACTTCAACTGATTTAGACAACGGTGACGGTAACTTTTGTTTCTAAAGCTATTCCGT / / / / / / HinfI | CspCI TspRI | TaqI TfiI Hpy166II BtsI CspCI HindII S V K L T K S V A T A I E N K D F D K A L * S * L N L L P L P L K T K I S I R Q C E V D * I C C H C H * K Q R F R * G N ----:----|----:----|----:----|----:----|----:----|----:----| D T F N V L D T A V A M S F L S K S L A I Q S T S * I Q Q W Q W Q F C L N R Y P R H L Q S F R N G S G N F V F I E I L C BsmAI ApoI Tsp4CI* | MseI TspEI | MseI \ \ \ \ \ ATTTCTTTAAGAGACACAGAATTTATTGAACTTTACGAAAACTTCTTATCCACTACCGTT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAGAAATTCTCTGTGTCTTAAATAACTTGAAATGCTTTTGAAGAATAGGTGATGGCAA / / / / TspEI BsmAI TspEI Tsp4CI* MseI ApoI I S L R D T E F I E L Y E N F L S T T V F L * E T Q N L L N F T K T S Y P L P L F F K R H R I Y * T L R K L L I H Y R * ----:----|----:----|----:----|----:----|----:----|----:----| I E K L S V S N I S S * S F K K D V V T L K K L L C L I * Q V K R F S R I W * R N R * S V C F K N F K V F V E * G S G N NlaIV | Hpy188I AlwNI FatI BccI | |TspEI BsrI | Hpy188I EcoP15I |CviAII \ \ \\ \ \ \ \ \\ AAAGATGATGGTTCCGAATTATTGCCAGTATCTGACAGACTAAACATTGGTATTGTCCAT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTACTACCAAGGCTTAATAACGGTCATAGACTGTCTGATTTGTAACCATAACAGGTA // / / / / / / / / / |BccI | | | BsrI | Hpy188I EcoP15I | CviAII MseI | | TspEI AlwNI NlaIII | Hpy188I NlaIV K D D G S E L L P V S D R L N I G I V H K M M V P N Y C Q Y L T D * T L V L S M R * W F R I I A S I * Q T K H W Y C P C ----:----|----:----|----:----|----:----|----:----|----:----| L S S P E S N N G T D S L S F M P I T W * L H H N R I I A L I Q C V L C Q Y Q G F I I T G F * Q W Y R V S * V N T N D M NlaIII |MslI ||BbvI |||HgiCI* |||| NlaIV |||| | SduI |||| | BseSI |||| | | MwoI |||| | | | BbvI MwoI |||| | | | |TseI MwoI | AciI |||| | | | ||BisI | TseI | BisI |||| | | | |||BlsI | |BisI | |BlsI |||| | | | |||BccI | ||BlsI | ||TauI Tsp4CI* \\\\ \ \ \ \\\\ \ \\\ \ \\\ \ GTTGGTGCCCCATCTGCTGCTTTGAACGCTGCCACCCGTGCCGCAACTCTATACTGTTTG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CAACCACGGGGTAGACGACGAAACTTGCGACGGTGGGCACGGCGTTGAGATATGACAAAC // //// / /// / /// / //// / || |||| MwoI ||| MwoI ||| MwoI |||AciI Tsp4CI* || |||HgiCI* ||BccI ||TseI ||BisI || ||BbvI ||TseI |BisI |BlsI || |NlaIV ||BbvI BlsI TauI || BseSI |BisI || SduI BlsI |MslI FatI V G A P S A A L N A A T R A A T L Y C L L V P H L L L * T L P P V P Q L Y T V C W C P I C C F E R C H P C R N S I L F V ----:----|----:----|----:----|----:----|----:----|----:----| T P A G D A A K F A A V R A A V R Y Q K H Q H G M Q Q K S R Q W G H R L E I S N N T G W R S S Q V S G G T G C S * V T Q TspDTI | TspRI BdaI | | TfiI BdaI | | HinfI | BceAI | | | BdaI | | FatI | | | BdaI | | BspHI | | | | AgeI BsmAI | | |CviAII | | | | BetI* |CfrI | | |Hpy178III* | | | | Cfr10I || CviJI | | || NlaIII | | | | |HpaII || HaeIII | | || | XmnI | | | | || Hin4II* \\ \ \ \ \\ \ \ \ \ \ \ \\ \ TCTCACGGCCATAAACCATACGCTATCATGAATGGTTTCAGTGGATTGATTCAAACCGGT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGTGCCGGTATTTGGTATGCGATAGTACTTACCAAAGTCACCTAACTAAGTTTGGCCA /// / / / // / / / // // ||CfrI BdaI | | || | | TspDTI |HinfI |Hin4II* |BsmAI BdaI | | || | TspRI |TfiI |Cfr10I HaeIII | | || XmnI BdaI |BetI* CviJI | | |BspHI BdaI |AgeI | | |FatI HpaII | | Hpy178III* | | CviAII | NlaIII BceAI S H G H K P Y A I M N G F S G L I Q T G L T A I N H T L S * M V S V D * F K P V S R P * T I R Y H E W F Q W I D S N R * ----:----|----:----|----:----|----:----|----:----|----:----| D * P W L G Y A I M F P K L P N I * V P T E R G Y V M R * * S H N * H I S E F R R V A M F W V S D H I T E T S Q N L G T FatI |CviAII TaqII NlaIV HphI || NlaIII TaqI | BsrI | Hpy188I \ \\ \ \ \ \ \ \ GAAGTGAAGGAACTATCATGGATTGATGTCGAAAACTGGCATAACTTGGGTGGTTCCGAA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCACTTCCTTGATAGTACCTAACTACAGCTTTTGACCGTATTGAACCCACCAAGGCTT / / // / / / / / HphI | |FatI | | BsrI | Hpy188I | CviAII | TaqII NlaIV NlaIII TaqI E V K E L S W I D V E N W H N L G G S E K * R N Y H G L M S K T G I T W V V P K S E G T I M D * C R K L A * L G W F R N ----:----|----:----|----:----|----:----|----:----|----:----| S T F S S D H I S T S F Q C L K P P E S H L S P V I M S Q H R F S A Y S P H N R F H L F * * P N I D F V P M V Q T T G F Csp6I |RsaI Acc65I || Eco57I HgiCI* || Eco57MI |Csp6I || | MboI ||RsaI || | BglII ||NlaIV || | XhoII |||MboII || | | DpnI ||||KpnI || | | |BstKTI Hpy188I ||||BsrDI \\ \ \ \\ \ \\\\\ ATCGGTACGAACAGATCTGTTGCTTCAGAAGATTTGGGTACCATTGCTTACTACTTCCAA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCCATGCTTGTCTAGACAACGAAGTCTTCTAAACCCATGGTAACGAATGATGAAGGTT // // / / / /// |Csp6I || XhoII Hpy188I | ||HgiCI* Eco57MI || BglII | ||Acc65I Eco57I || MboI | |Csp6I RsaI |DpnI | MboII BstKTI | NlaIV | BsrDI | RsaI KpnI I G T N R S V A S E D L G T I A Y Y F Q S V R T D L L L Q K I W V P L L T T S K R Y E Q I C C F R R F G Y H C L L L P K ----:----|----:----|----:----|----:----|----:----|----:----| I P V F L D T A E S S K P V M A * * K W F R Y S C I Q Q K L L N P Y W Q K S S G D T R V S R N S * F I Q T G N S V V E L AsuI* AvaII AluI DraII CviJI PpuMI |MaeI |BmgT120I ||SetI Tsp4CI* Hin4II* SetI ||SetI \\\ \ \ \ \\\ AAGAACAAGCTAGACGGTTTGATTATTCTTGGTGGTTTTGAAGGTTTCAGGTCCTTGAAG 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTGTTCGATCTGCCAAACTAATAAGAACCACCAAAACTTCCAAAGTCCAGGAACTTC / / / / / / / // | | | Tsp4CI* Hin4II* SetI | |PpuMI | | MaeI | |DraII | CviJI | |AvaII | AluI | |AsuI* SetI | BmgT120I SetI K N K L D G L I I L G G F E G F R S L K R T S * T V * L F L V V L K V S G P * S E Q A R R F D Y S W W F * R F Q V L E A ----:----|----:----|----:----|----:----|----:----|----:----| F F L S S P K I I R P P K S P K L D K F F S C A L R N S * E Q H N Q L N * T R S L V L * V T Q N N K T T K F T E P G Q L MaeIII MfeI Tsp45I TaqII TfiI TspEI | Tsp4CI* MseI | MslI HinfI \ \ \ \ \ \ \ CAATTGCGTGACGGTAGAACCCAACACCCAATCTTTAACATTCCAATGTGTTTGATTCCA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAACGCACTGCCATCTTGGGTTGTGGGTTAGAAATTGTAAGGTTACACAAACTAAGGT / / / / / / / TspEI Tsp4CI* | | MslI | TspRI MfeI Tsp45I | TaqII HinfI MaeIII MseI TfiI Q L R D G R T Q H P I F N I P M C L I P N C V T V E P N T Q S L T F Q C V * F Q I A * R * N P T P N L * H S N V F D S S ----:----|----:----|----:----|----:----|----:----|----:----| C N R S P L V W C G I K L M G I H K I G A I A H R Y F G V G L R * C E L T N S E L Q T V T S G L V W D K V N W H T Q N W AclI MaeII | SetI | TaiI | |BssKI | |EcoRII | || AjuI | || ScrFI | || BseBI CviJI | || | Csp6I | AlwNI | || | |RsaI | | Tsp4CI* | || | |SetI SetI | | | TspRI | || | ||AlwNI DraIII AjuI \ \ \ \ \ \\ \ \\\ \ \ GCCACTGTTTCTAACAACGTTCCAGGTACTGAATACTCACTTGGTGTTGATACCTGTTTG 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTGACAAAGATTGTTGCAAGGTCCATGACTTATGAGTGAACCACAACTATGGACAAAC / / / // ////// / // | Tsp4CI* | || |||||Csp6I DraIII |SetI AlwNI | || ||||RsaI AjuI CviJI | || |||EcoRII | || |||BssKI | || ||AlwNI | || |BseBI | || |ScrFI | || SetI | |MaeII | |AclI | AjuI TaiI SetI A T V S N N V P G T E Y S L G V D T C L P L F L T T F Q V L N T H L V L I P V * H C F * Q R S R Y * I L T W C * Y L F E ----:----|----:----|----:----|----:----|----:----|----:----| A V T E L L T G P V S Y E S P T S V Q K L W Q K * C R E L Y Q I S V Q H Q Y R N G S N R V V N W T S F V * K T N I G T Q Hin4I |Ksp632I* || MboII || BbvII* TspEI TspRI || | HinfI \ \ \\ \ \ AACGCATTAGTCAATTACACTGATGACATCAAACAGAGTGCTTCTGCGACAAGAAGAAGA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCGTAATCAGTTAATGTGACTACTGTAGTTTGTCTCACGAAGACGCTGTTCTTCTTCT // / // / |TspEI Hin4I || BbvII* TspRI |Ksp632I* MboII N A L V N Y T D D I K Q S A S A T R R R T H * S I T L M T S N R V L L R Q E E E R I S Q L H * * H Q T E C F C D K K K S ----:----|----:----|----:----|----:----|----:----|----:----| F A N T L * V S S M L C L A E A V L L L S R M L * N C Q H C * V S H K Q S L F F V C * D I V S I V D F L T S R R C S S S StyI SecI* | Hin4I | |TsoI MboII | ||SetI | PleI | ||BtgZI BsrI | |MlyI | |||MaeIII TspRI | |MboII | |||Tsp45I MaeIII |MseI \ \\ \ \\\\ \ \\ GTCTTCGTCTGTGAAGTCCAAGGTGGTCACTCTGGTTACATCGCTTCTTTCACTGGTTTA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAAGCAGACACTTCAGGTTCCACCAGTGAGACCAATGTAGCGAAGAAAGTGACCAAAT / / // / /// / / / / / / | | |PleI | ||SecI* | Tsp45I MaeIII TspRI BsrI TspRI | | |MlyI | ||StyI | MaeIII MseI | | MboII | |TsoI BtgZI | MboII | SetI HinfI Hin4I V F V C E V Q G G H S G Y I A S F T G L S S S V K S K V V T L V T S L L S L V * L R L * S P R W S L W L H R F F H W F N ----:----|----:----|----:----|----:----|----:----|----:----| T K T Q S T W P P * E P * M A E K V P K L R R R H L G L H D S Q N C R K K * Q N D E D T F D L T T V R T V D S R E S T * TatI Bsp1407I |Csp6I |Hpy166II ||RsaI |||TspRI |||Hpy166II |||| FalI |||| FalI |||| Hpy178III* |||| | MboI |||| | | DpnI |||| | | |TaqI |||| | | |BstKTI |||| | | || DdeI BsrI |||| | | || | MboII TspRI |||| | | || | |AluI Hpy188I | GsuI |||| | | || | |CviJI | FalI | Eco57MI |||| | | || | || SetI | FalI \ \ \\\\ \ \ \\ \ \\ \ \ \ ATCACTGGTGCTGTTTCAGTGTACACTCCAGAAAAGAAGATCGACTTAGCTTCTATCAGA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTGACCACGACAAAGTCACATGTGAGGTCTTTTCTTCTAGCTGAATCGAAGATAGTCT / / / //// / // // /// / / | | TspRI |||| | || || ||CviJI | Hpy188I | Eco57MI |||| | || || ||AluI FalI | GsuI |||| | || || |DdeI FalI BsrI |||| | || || MboII |||| | || || SetI |||| | || |TaqI |||| | || MboI |||| | |DpnI |||| | BstKTI |||| Hpy178III* |||Bsp1407I |||TatI ||Hpy166II ||Csp6I ||FalI ||FalI |RsaI Hpy166II I T G A V S V Y T P E K K I D L A S I R S L V L F Q C T L Q K R R S T * L L S E H W C C F S V H S R K E D R L S F Y Q R ----:----|----:----|----:----|----:----|----:----|----:----| I V P A T E T Y V G S F F I S K A E I L L * Q H Q K L T C E L F S S R S L K * * D S T S N * H V S W F L L D V * S R D S MaeIII HphI MboII Tsp45I | TsoI | MseI | Hpy178III* SetI | Tsp4CI* \ \ \ \ \ \ \ GAAGATATAACTCTATTAAAAGAGAACTTTCGTCACGACAAAGGTGAAAACAGAAACGGT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTATATTGAGATAATTTTCTCTTGAAAGCAGTGCTGTTTCCACTTTTGTCTTTGCCA / / / / / // MboII MseI | SetI | |Tsp4CI* Hpy178III* | TsoI Tsp45I HphI MaeIII E D I T L L K E N F R H D K G E N R N G K I * L Y * K R T F V T T K V K T E T V R Y N S I K R E L S S R Q R * K Q K R * ----:----|----:----|----:----|----:----|----:----|----:----| S S I V R N F S F K R * S L P S F L F P L L Y L E I L L S S E D R C L H F C F R F I Y S * * F L V K T V V F T F V S V T HindIII | AluI AluI | CviJI MfeI CviJI | | SetI TspEI | SetI | | | MaeI MwoI | Hin4I CviJI \ \ \ \ \ \ \ \ \ \ AAGCTATTGGTTAGAAACGAACAAGCTTCTAGCGTATATAGCACTCAATTGTTGGCTGAC 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGATAACCAATCTTTGCTTGTTCGAAGATCGCATATATCGTGAGTTAACAACCGACTG / / / / / / / / / / | CviJI | | | | MwoI Hin4I | CviJI | AluI | | | MaeI TspEI SetI | | HindIII MfeI | CviJI | AluI SetI K L L V R N E Q A S S V Y S T Q L L A D S Y W L E T N K L L A Y I A L N C W L T A I G * K R T S F * R I * H S I V G * H ----:----|----:----|----:----|----:----|----:----|----:----| L S N T L F S C A E L T Y L V * N N A S Y A I P * F R V L K * R I Y C E I T P Q L * Q N S V F L S R A Y I A S L Q Q S V BssKI SecI* EcoRII | ScrFI | BseBI | | CviJI | | HaeIII | | |FatI Hpy188I Eco57I | | ||CviAII | Cac8I Hin4I Eco57MI | | ||| NlaIII \ \ \ \ \ \ \\\ \ ATCATCTCTGAAGCAAGCAAGGGTAAGTTTGGTGTTAGAACTGCTATCCCAGGCCATGTT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTAGAGACTTCGTTCGTTCCCATTCAAACCACAATCTTGACGATAGGGTCCGGTACAA / // / //// // | |Hin4I Eco57MI |||| |FatI | Cac8I Eco57I |||| CviAII Hpy188I |||NlaIII ||EcoRII ||HaeIII ||BssKI ||CviJI |SecI* BseBI ScrFI I I S E A S K G K F G V R T A I P G H V S S L K Q A R V S L V L E L L S Q A M F H L * S K Q G * V W C * N C Y P R P C S ----:----|----:----|----:----|----:----|----:----|----:----| M M E S A L L P L N P T L V A I G P W T C * R Q L L C P Y T Q H * F Q * G L G H D D R F C A L T L K T N S S S D W A M N BccI | HphI | | Tsp4CI* | | Tth111I | | | MaeIII | | | Tsp45I | | | | AciI SetI | | | | Hin4I | MboII | | | | Hin4I Hpy178III* \ \ \ \ \ \ \ \ CAACAAGGTGGTGTTCCATCTTCTAAAGACCGTGTCACCGCTTCCAGATTTGCTGTCAAA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTTCCACCACAAGGTAGAAGATTTCTGGCACAGTGGCGAAGGTCTAAACGACAGTTT / / // / // / / / SetI MboII || | || | AciI Hpy178III* || | || Tsp45I || | || MaeIII || | |Hin4I || | |Hin4I || | Tth111I || Tsp4CI* |HphI BccI Q Q G G V P S S K D R V T A S R F A V K N K V V F H L L K T V S P L P D L L S N T R W C S I F * R P C H R F Q I C C Q M ----:----|----:----|----:----|----:----|----:----|----:----| * C P P T G D E L S R T V A E L N A T L E V L H H E M K * L G H * R K W I Q Q * L L T T N W R R F V T D G S G S K S D F HindIII Hin4I | AluI TspRI Hin4I | CviJI | DdeI | TaqI | | SetI TspDTI | Bpu10I \ \ \ \ \ \ \ \ TGTATCAAGTTTATCGAACAATGGAACAAGAAAAATGAAGCTTCTCCAAACACTGACGCT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| ACATAGTTCAAATAGCTTGTTACCTTGTTCTTTTTACTTCGAAGAGGTTTGTGACTGCGA / / / / / / Hin4I TaqI | | | TspDTI Hin4I | | | TspRI | | HindIII | CviJI | AluI SetI C I K F I E Q W N K K N E A S P N T D A V S S L S N N G T R K M K L L Q T L T L Y Q V Y R T M E Q E K * S F S K H * R * ----:----|----:----|----:----|----:----|----:----|----:----| H I L N I S C H F L F F S A E G F V S A I Y * T * R V I S C S F H L K E L C Q R T D L K D F L P V L F I F S R W V S V S Acc65I HgiCI* |Csp6I |EcoP15I ||RsaI ||SetI SduI ||NlaIV HgiAI* ||| KpnI |BbvI ||| HphI ||MlyI HgaI TfiI ||| EcoP15I ||PleI |SetI HinfI TaqI Tsp4CI* ||| | Tsp4CI* |||MslI \\ \ \ \ \\\ \ \ \\\\ AAGGTTTTGAGATTCAAGTTCGATACTCACGGTGAAAAGGTACCAACTGTTGAGCACGAA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCAAAACTCTAAGTTCAAGCTATGAGTGCCACTTTTCCATGGTTGACAACTCGTGCTT // / / / / / / /// / / / // |Bpu10I HgaI HinfI TaqI | | | ||| | | | |MslI |DdeI TfiI | | | ||| | | | |PleI SetI | | | ||| | | | MlyI | | | ||| | | HgiAI* | | | ||| | | SduI | | | ||| | Tsp4CI* | | | ||| EcoP15I | | | ||HgiCI* | | | ||Acc65I | | | |EcoP15I | | | |Csp6I | | | |HphI | | | NlaIV | | | RsaI | | KpnI | SetI Tsp4CI* K V L R F K F D T H G E K V P T V E H E R F * D S S S I L T V K R Y Q L L S T K G F E I Q V R Y S R * K G T N C * A R R ----:----|----:----|----:----|----:----|----:----|----:----| L T K L N L N S V * P S F T G V T S C S * P K S I * T R Y E R H F P V L Q Q A R L N Q S E L E I S V T F L Y W S N L V F TseI CviJI MboII MaeII | MfeI |BisI | SetI | TspEI HinfI ||BlsI MseI | TaiI | |Hin4II* \ \\\ \ \ \ \ \\ GATGACTCTGCTGCTGTTATCTGTGTTAATGGTTCTCACGTTTCCTTCAAGCCAATTGCT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGAGACGACGACAATAGACACAATTACCAAGAGTGCAAAGGAAGTTCGGTTAACGA / / / /// / / / / / / BbvI | | ||TseI MseI | MaeII | | TspEI | | |BisI TaiI | | MfeI | | BlsI SetI | Hin4II* | MboII CviJI HinfI D D S A A V I C V N G S H V S F K P I A M T L L L L S V L M V L T F P S S Q L L * L C C C Y L C * W F S R F L Q A N C * ----:----|----:----|----:----|----:----|----:----|----:----| S S E A A T I Q T L P E * T E K L G I A L H S Q Q Q * R H * H N E R K R * A L Q I V R S S N D T N I T R V N G E L W N S AclI MaeII | SetI Hpy166II | TaiI | BsrI | | TspEI | CviJI SetI | | | MseI | TspRI \ \ \ \ \ \ \ AACCTTTGGGAAAACGAAACCAACGTTGAATTAAGAAAGGGTTTTGAAGTTCACTGGGCT 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGAAACCCTTTTGCTTTGGTTGCAACTTAATTCTTTCCCAAAACTTCAAGTGACCCGA / / / // / / / / SetI | MaeII |MseI | | | CviJI | AclI TspEI | | BsrI TaiI | Hpy166II SetI TspRI N L W E N E T N V E L R K G F E V H W A T F G K T K P T L N * E R V L K F T G L P L G K R N Q R * I K K G F * S S L G * ----:----|----:----|----:----|----:----|----:----|----:----| L R Q S F S V L T S N L F P K S T * Q A * G K P F R F W R Q I L F P N Q L E S P V K P F V F G V N F * S L T K F N V P S MseI | BseMII | |Hin4I | |Hin4I | |BspCNI | || MnlI | || | AluI | || | CviJI | || | |DdeI | || | |BbvCI | || | |Bpu10I MaeIII | || | ||SetI Tsp45I | || | ||| MwoI | BseGI | || | ||| |SetI BfiI | | Eam1105I | || | ||| || CviJI | FokI | | | HphI | || | ||| || |AciI | | Hin4I | | | BetI* | || | ||| || |BisI | | Hin4I | | | |HpaII | || | ||| || ||BlsI \ \ \ \ \ \ \\ \ \\ \ \\\ \\ \\\ GAATACAACAAGATTGGTGACATCCTGTCCGGTAGATTAAAGTTGAGAGCTGAGGTAGCC 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATGTTGTTCTAACCACTGTAGGACAGGCCATCTAATTTCAACTCTCGACTCCATCGG / / / / / / / // / // / / / // /// | Hin4I FokI | | | | || | || | | | || ||BisI | Hin4I | | | | || | || | | | || |BlsI BfiI | | | | || | || | | | || CviJI | | | | || | || | | | || TauI | | | | || | || | | | |Bpu10I | | | | || | || | | | |BbvCI | | | | || | || | | | |DdeI | | | | || | || | | | MwoI | | | | || | || | | | SetI | | | | || | || | | CviJI | | | | || | || | | AluI | | | | || | || | SetI | | | | || | || MnlI | | | | || | |BspCNI | | | | || | BseMII | | | | || | MseI | | | | || Hin4I | | | | || Hin4I | | | | |BetI* | | | | HpaII | | | HphI | | Eam1105I | Tsp45I | MaeIII BseGI E Y N K I G D I L S G R L K L R A E V A N T T R L V T S C P V D * S * E L R * P I Q Q D W * H P V R * I K V E S * G S R ----:----|----:----|----:----|----:----|----:----|----:----| S Y L L I P S M R D P L N F N L A S T A Q I C C S Q H C G T R Y I L T S L Q P L F V V L N T V D Q G T S * L Q S S L Y G TauI | MwoI | | MwoI | | CviJI | | |AciI | | |BisI | | ||BlsI | | |||TauI | | |||NspBII* \ \ \\\\ GCTTTAGCCGCTGAAAACAAATGA 2950 2960 ----:----|----:----|---- CGAAATCGGCGACTTTTGTTTACT / / //// | | |||NspBII* | | |||AciI | | ||BisI | | |BlsI | | CviJI | | TauI | MwoI MwoI AciI A L A A E N K * L * P L K T N X F S R * K Q M X ----:----|----:----|---- A K A A S F L H R K L R Q F C I S * G S F V F S # Enzymes that cut Frequency Isoschizomers AatII 1 Acc65I 2 Asp718I AccI 4 FblI,XmiI AciI 9 BspACI,SsiI AclI 2 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AgeI 3 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AjuI 2 AluI 16 AluBI AlwNI 3 CaiI ApoI 6 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 2 BalI 1 MlsI,MluNI,MscI,Msp20I BbvCI 1 BbvI 4 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 8 Bce83I* 1 BpuEI BceAI 3 BclI 1 FbaI,Ksp22I BdaI 4 BetI* 4 BsaWI BfiI 1 BmrI,BmuI BglI 1 BglII 2 BinI* 1 AlwI,BspPI,AclWI BisI 8 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 8 BmgT120I 1 Bpu10I 2 BsaXI 1 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 2 BseSI 1 BaeGI,BstSLI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 2 BspHI 3 CciI,PagI,RcaI BsrBI 1 AccBSI,MbiI BsrDI 1 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BssNAI 2 Bst1107I,BstZ17I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 6 BtgZI 1 BtsI 1 Cac8I 2 BstC8I Cfr10I 3 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 10 CviQI,RsaNI CspCI 1 CviAII 8 CviJI 34 CviKI-1 CviRI* 6 HpyCH4V DdeI 9 BstDEI,HpyF3I DpnI 6 MalI DraII 1 EcoO109I DraIII 1 AdeI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco57I 4 AcuI Eco57MI 6 EcoP15I 3 EcoRI 1 EcoRII 3 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 8 FokI 1 GsuI 2 BpmI HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 4 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4I 9 Hin4II* 11 HpyAV HindII 2 HincII HindIII 3 HinfI 15 HpaII 4 HapII,BsiSI,MspI HphI 9 AsuHPI Hpy166II 11 Hpy8I Hpy178III* 13 Hpy188III Hpy188I 14 KpnI 2 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 6 FspBI,BfaI,XspI MaeII 5 HpyCH4IV MaeIII 10 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 19 MfeI 3 MunI MlyI 3 SchI MmeI 1 MnlI 8 MseI 16 Tru1I,Tru9I MslI 4 RseI,SmiMI MwoI 14 HpyF10VI,BstMWI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 8 BspLI,BmiI,PspN4I NspBII* 3 MspA1I OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PleI 3 PpsI PpuMI 1 Psp5II,PspPPI PsrI 1 PstI 1 PvuII 1 RsaI 10 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 50 SfaNI 6 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 2 SmoI SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 5 TaqI 10 TaqII 2 TatI 1 TauI 4 TfiI 12 PfeI TseI 4 ApeKI TsoI 6 Tsp45I 6 NmuCI Tsp4CI* 11 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 23 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 9 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XbaI 2 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI AflII AflIII AlfI AloI ApaI ApaLI AscI AsuII AvaI AvrII BamHI BarI BcgI BciVI BmeT110I BmtI BplI BsaAI BsaBI BsePI BseRI BseYI BsgI BsiI* Bsp120I BspLU11I* BspMI BspMII* BspOI BstAPI BstXI BtrI CauII* Cfr9I DinI DrdI DsaI* EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I FauI FnuDII* FseI FspAI GlaI GsaI HaeII HhaI Hin6I HinP1I HpaI Hpy99I HspAI KasI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI PacI PasI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PvuI RsrII SacI SacII SalI SanDI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI TstI XcmI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769