Restriction Map of KEL2/YGR238C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

KEL2/YGR238C on chromosome VII from coordinates 968687 to 966039.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.32530

EMBOSS_001 AsuI* AvaII DraII Acc65I PpuMI Acc65I HgiCI* |NlaIV HgiCI* |Csp6I |BmgT120I |Csp6I ||RsaI || SetI ||RsaI ||SetI || |TspGWI ||NlaIV AluI ||NlaIV || || Hpy188I ||| KpnI CviJI ||| KpnI || || | BslFI ||| | SetI | SetI ||| | SetI || || | Hin4II* \\\ \ \ \ \ \\\ \ \ \\ \\ \ \ ATGGTACCTTTCAAGCTGACAAATAAGGTACCTACGGACACGGGACCTTCTCTGATTTCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCATGGAAAGTTCGACTGTTTATTCCATGGATGCCTGTGCCCTGGAAGAGACTAAAGT / /// / / / / /// //// / / / | ||| | CviJI | | ||HgiCI* |||| | | BslFI | ||| | AluI | | ||Acc65I |||| | Hin4II* | ||| SetI | | |Csp6I |||| Hpy188I | ||HgiCI* | | NlaIV |||TspGWI | ||Acc65I | | RsaI ||PpuMI | |Csp6I | | SetI ||DraII | NlaIV | KpnI ||AvaII | RsaI SetI ||AsuI* | SetI |BmgT120I KpnI NlaIV SetI M V P F K L T N K V P T D T G P S L I S W Y L S S * Q I R Y L R T R D L L * F Q G T F Q A D K * G T Y G H G T F S D F S ----:----|----:----|----:----|----:----|----:----|----:----| X T G K L S V F L T G V S V P G E R I E X P V K * A S L Y P V * P C P V K E S K H Y R E L Q C I L Y R R V R S R R Q N * Hin6I Csp6I FnuDII* |GlaI Hpy166II | BsaXI ||HhaI |RsaI TaqI | MaeIII \\\ \\ \ \ \ GCGCAAAGTGTACCCAGACCAATAGTTTTTATGGATAATCGAAACAATACGCGAATAGTA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGCGTTTCACATGGGTCTGGTTATCAAAAATACCTATTAGCTTTGTTATGCGCTTATCAT /// /// / / / ||Hin6I ||Csp6I TaqI | BsaXI |GlaI |RsaI FnuDII* HhaI Hpy166II A Q S V P R P I V F M D N R N N T R I V R K V Y P D Q * F L W I I E T I R E * * A K C T Q T N S F Y G * S K Q Y A N S N ----:----|----:----|----:----|----:----|----:----|----:----| A C L T G L G I T K I S L R F L V R I T L A F H V W V L L K * P Y D F C Y A F L R L T Y G S W Y N K H I I S V I R S Y Y MwoI | Hin6I | |GlaI | ||HhaI | ||FnuDII* | ||| SalI | ||| |TaqI | ||| |AccI | ||| |MboII BssKI | ||| ||HindII SecI* | ||| ||Hpy166II EcoRII MnlI | ||| |||Hpy99I |SapI |MnlI | ||| ||||MwoI |Ksp632I* || BsaXI | ||| |||||GsuI ||ScrFI SetI SetI || | HgaI | ||| |||||Eco57MI ||BseBI \ \ \\ \ \ \ \\\ \\\\\\ \\\ ACACCTACGCTACCTCCAAACCAGCATAGAGGCATATCAGGCGCGTCGACTGCTCTTCCC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGATGCGATGGAGGTTTGGTCGTATCTCCGTATAGTCCGCGCAGCTGACGAGAAGGG / / // / / / /// ///// MaeIII SetI || BsaXI | | ||| ||||SalI SetI |MnlI | | ||| |||Eco57MI MnlI | | ||| |||AccI | | ||| |||TaqI | | ||| |||GsuI | | ||| ||Hpy166II | | ||| ||HindII | | ||| |MwoI | | ||| MboII | | ||FnuDII* | | ||Hpy99I | | ||Hin6I | | |GlaI | | HhaI | HgaI MwoI T P T L P P N Q H R G I S G A S T A L P H L R Y L Q T S I E A Y Q A R R L L F P T Y A T S K P A * R H I R R V D C S S L ----:----|----:----|----:----|----:----|----:----|----:----| V G V S G G F W C L P M D P A D V A R G L V * A V E L G A Y L C I L R T S Q E E C R R * R W V L M S A Y * A R R S S K G Hpy178III* |BsmAI |Eco31I TspGWI \\ \ TGGTCTCCAGAGAGTAAGAATACAGGGAAGTATATTTGGAATAGGGTCAAACTAAAAAAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| ACCAGAGGTCTCTCATTCTTATGTCCCTTCATATAAACCTTATCCCAGTTTGATTTTTTG /// / / / ||| | Eco31I TspGWI ||| | BsmAI ||| Hpy178III* ||EcoRII ||BssKI |Ksp632I* |SecI* |SapI BseBI ScrFI W S P E S K N T G K Y I W N R V K L K N G L Q R V R I Q G S I F G I G S N * K T V S R E * E Y R E V Y L E * G Q T K K L ----:----|----:----|----:----|----:----|----:----|----:----| Q D G S L L F V P F Y I Q F L T L S F F R T E L S Y S Y L S T Y K S Y P * V L F P R W L T L I C P L I N P I P D F * F V MboII MnlI |TaqI Ksp632I* MaeIII \\ \ \ TCTCCGTTTCCCCGTTATCGACACTCTTCCTCATTTATTGTTACGAATGATAACAGGATT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGCAAAGGGGCAATAGCTGTGAGAAGGAGTAAATAACAATGCTTACTATTGTCCTAA / / / / / | TaqI | MnlI MaeIII MboII Ksp632I* S P F P R Y R H S S S F I V T N D N R I L R F P V I D T L P H L L L R M I T G F S V S P L S T L F L I Y C Y E * * Q D F ----:----|----:----|----:----|----:----|----:----|----:----| E G N G R * R C E E E N I T V F S L L I S E T E G N D V S K R M * Q * S H Y C S R R K G T I S V R G * K N N R I I V P N MaeIII Tsp45I | AgeI | BetI* | Cfr10I | |HpaII FokI | || Hpy166II | CviJI | || | Hpy178III* | |AciI | || | | MboI | |BisI | || | | | DpnI | ||BlsI | || | | | |BstKTI BseGI | |||TauI \ \\ \ \ \ \\ \ \ \\\\ TTTGTGACCGGTGGACTTCACGATCAATCGGTATATGGGGATGTCTGGCAAATAGCCGCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AAACACTGGCCACCTGAAGTGCTAGTTAGCCATATACCCCTACAGACCGTTTATCGGCGA / // / /// / / //// | || | ||| MboI BseGI |||MwoI | || | ||DpnI |||AciI | || | |BstKTI ||BisI | || | Hpy178III* |FokI | || Hpy166II |BlsI | |Cfr10I CviJI | |BetI* TauI | |AgeI | HpaII Tsp45I MaeIII F V T G G L H D Q S V Y G D V W Q I A A L * P V D F T I N R Y M G M S G K * P L C D R W T S R S I G I W G C L A N S R * ----:----|----:----|----:----|----:----|----:----|----:----| K T V P P S * S * D T Y P S T Q C I A A K Q S R H V E R D I P I H P H R A F L R K H G T S K V I L R Y I P I D P L Y G S BccI MwoI | AciI | FnuDII* | | Csp6I | | |RsaI | | |BseGI BsaBI | | || AluI TfiI |MboI | | || CviJI HinfI |BclI | | || | SetI | TaqI || DpnI | | || | FokI | ClaI || |BstKTI SetI \ \ \\ \ \ \ \ \\ \\ \ AACGCGGATGGTACGAGCTTTACTTCCAAGAGAATCGATATTGATCAAAATACACCTCCC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCGCCTACCATGCTCGAAATGAAGGTTCTCTTAGCTATAACTAGTTTTATGTGGAGGG / / / / // / / / / / / // / / | | | | || | CviJI FokI | | | || BclI SetI | | | | || | AluI | | | || MboI | | | | || SetI | | | |DpnI | | | | |Csp6I | | | BstKTI | | | | RsaI | | BsaBI | | | BseGI | ClaI | | AciI | TaqI | FnuDII* HinfI BccI TfiI N A D G T S F T S K R I D I D Q N T P P T R M V R A L L P R E S I L I K I H L P R G W Y E L Y F Q E N R Y * S K Y T S P ----:----|----:----|----:----|----:----|----:----|----:----| L A S P V L K V E L L I S I S * F V G G * R P H Y S S * K W S F R Y Q D F Y V E V R I T R A K S G L S D I N I L I C R G MnlI |BsiYI* ||BsiYI* ||| FatI ||| |CviAII BslFI ||| || NspI | MnlI ||| || NlaIII | | AciI \\\ \\ \ \ \ \ CCAAGAGTGGGACATGCCTCTACTATATGCGGTAATGCCTATGTTGTGTTTGGTGGCGAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTCTCACCCTGTACGGAGATGATATACGCCATTACGGATACAACACAAACCACCGCTG // / // // / |BsiYI* | |FatI || AciI |MnlI | CviAII |BslFI BsiYI* NlaIII MnlI NspI P R V G H A S T I C G N A Y V V F G G D Q E W D M P L L Y A V M P M L C L V A T K S G T C L Y Y M R * C L C C V W W R H ----:----|----:----|----:----|----:----|----:----|----:----| G L T P C A E V I H P L A * T T N P P S G L L P V H R * * I R Y H R H Q T Q H R W S H S M G R S Y A T I G I N H K T A V BsaBI TspGWI |MboI |BseGI MmeI || DpnI |AluI || |BstKTI SspI |CviJI || || BsaBI | MseI ||AjuI || || |AjuI | VspI |||SetI Tsp4CI* || || ||FokI | |TspEI \\\\ \ \\ \\ \\\ \ \\ ACACACAAGCTGAATAAGAACGGACTGTTGGATGATGATCTTTATCTTTTCAATATTAAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGTGTTCGACTTATTCTTGCCTGACAACCTACTACTAGAAATAGAAAAGTTATAATTA /// / / /// // // / / / ||| CviJI Tsp4CI* ||| || |BsaBI FokI | VspI ||| AluI ||| || MboI | MseI ||SetI ||| |DpnI SspI |MmeI ||| BstKTI AjuI ||| AjuI ||BsaBI |BseGI TspGWI T H K L N K N G L L D D D L Y L F N I N H T S * I R T D C W M M I F I F S I L I T Q A E * E R T V G * * S L S F Q Y * F ----:----|----:----|----:----|----:----|----:----|----:----| V C L S F L F P S N S S S R * R K L I L C V C A S Y S R V T P H H D K D K * Y * C V L Q I L V S Q Q I I I K I K E I N I BceAI | SetI | | CfrI | | XmaIII* Csp6I | | | CviJI |RsaI AsuI* | | | HaeIII |SetI AvaII | | | |McrI* ||MwoI Hpy166II | | | || BspMI |||CfrI |BmgT120I | | | || |CviJI |||| CviJI PsiI || BceAI | | | || |HaeIII |||| HaeIII \ \\ \ \ \ \ \\ \\ \\\\ \ TCTTATAAGTGGACCATACCACAACCTATCGGCCGTAGGCCGTTGGGCAGGTACGGCCAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGAATATTCACCTGGTATGGTGTTGGATAGCCGGCATCCGGCAACCCGTCCATGCCGGTA / / / // / / / // / / / / / // / / | PsiI | || | | | || | | BspMI | | || | CfrI TspEI | || | | | || | HaeIII | | || HaeIII | || | | | || | CviJI | | || CviJI | || | | | || XmaIII* | | |Csp6I | || | | | || CfrI | | RsaI | || | | | |HaeIII | MwoI | || | | | |CviJI SetI | || | | | McrI* | || | | BceAI | || | SetI | || BceAI | |AvaII | |AsuI* | BmgT120I Hpy166II S Y K W T I P Q P I G R R P L G R Y G H L I S G P Y H N L S A V G R W A G T A I L * V D H T T T Y R P * A V G Q V R P * ----:----|----:----|----:----|----:----|----:----|----:----| E * L H V M G C G I P R L G N P L Y P W N K Y T S W V V V * R G Y A T P C T R G R I L P G Y W L R D A T P R Q A P V A M AlfI AlfI BceAI | TspEI | | NheI | | |MaeI ApoI | | ||Cac8I AlfI TspEI | | ||| BmtI CviRI* AlfI AciI \ \ \ \\\ \ \ \ \ AAAATTTCTATAATTGCTAGCAACCCTATGCAAACTAAACTATATCTTTTTGGCGGACAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAAAGATATTAACGATCGTTGGGATACGTTTGATTTGATATAGAAAAACCGCCTGTT // / // /// / / / || | || ||NheI CviRI* AlfI AciI || | || |MaeI AlfI || | || Cac8I || | |BmtI || | TspEI || BceAI |AlfI |AlfI TspEI ApoI K I S I I A S N P M Q T K L Y L F G G Q K F L * L L A T L C K L N Y I F L A D K N F Y N C * Q P Y A N * T I S F W R T S ----:----|----:----|----:----|----:----|----:----|----:----| L I E I I A L L G I C V L S Y R K P P C Y F K * L Q * C G * A F * V I D K Q R V F N R Y N S A V R H L S F * I K K A S L MseI CviJI | TspDTI HaeIII | |MboI | ApoI | || DpnI | TspEI | || |BstKTI | EcoRI | || || Hin4I | Hin4I EciI | || || Hin4I TspGWI | Hin4I \ \ \\ \\ \ \ \ \ GTAGATGAAACTTATTTTAACGATCTGGTCGTCTTTGATTTATCATCATTCCGTAGGCCG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CATCTACTTTGAATAAAATTGCTAGACCAGCAGAAACTAAATAGTAGTAAGGCATCCGGC / // // / / / / EciI || || MboI TspGWI | HaeIII || |Hin4I | CviJI || |Hin4I Hin4I || |DpnI Hin4I || BstKTI |MseI TspDTI V D E T Y F N D L V V F D L S S F R R P * M K L I L T I W S S L I Y H H S V G R R * N L F * R S G R L * F I I I P * A E ----:----|----:----|----:----|----:----|----:----|----:----| T S S V * K L S R T T K S K D D N R L G L L H F K N * R D P R R Q N I M M G Y A Y I F S I K V I Q D D K I * * * E T P R BspMI | MseI ApoI | |MnlI TspEI CviJI BseRI SetI | || MnlI \ \ \ \ \ \\ \ AATTCTCATTGGGAATTTTTAGAGCCTGTCGGCGACCTGCCTCCTCCTTTAACAAATCAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGAGTAACCCTTAAAAATCTCGGACAGCCGCTGGACGGAGGAGGAAATTGTTTAGTA / / / / / // // EcoRI TspEI CviJI | SetI || |MnlI TspEI ApoI BseRI || MseI ApoI |MnlI BspMI N S H W E F L E P V G D L P P P L T N H I L I G N F * S L S A T C L L L * Q I I F S L G I F R A C R R P A S S F N K S Y ----:----|----:----|----:----|----:----|----:----|----:----| F E * Q S N K S G T P S R G G G K V F * S N E N P I K L A Q R R G A E E K L L D I R M P F K * L R D A V Q R R R * C I M NdeI TspEI FauI AciI \ \ \ \ ACAATGGTGGCATATGACAACAAATTATGGGTATTCGGCGGGGAAACTCCCAAGACAATA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTACCACCGTATACTGTTGTTTAATACCCATAAGCCGCCCCTTTGAGGGTTCTGTTAT / / / / NdeI TspEI FauI AciI T M V A Y D N K L W V F G G E T P K T I Q W W H M T T N Y G Y S A G K L P R Q * N G G I * Q Q I M G I R R G N S Q D N K ----:----|----:----|----:----|----:----|----:----|----:----| V I T A Y S L L N H T N P P S V G L V I Y L P P M H C C I I P I R R P F E W S L C H H C I V V F * P Y E A P F S G L C Y AciI |BinI* || CspCI || | MboI || | | DpnI MseI BsrDI || | | |BstKTI DraIII | CspCI \ \\ \ \ \\ \ \ \ AGCAATGATACATACCGCTACGATCCAGCACAAAGTGAGTGGTCTAAAGTTAAAACCACA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTTACTATGTATGGCGATGCTAGGTCGTGTTTCACTCACCAGATTTCAATTTTGGTGT / / // / / / / BsrDI | || MboI DraIII CspCI EciI | |DpnI MseI | BstKTI BinI* CspCI AciI S N D T Y R Y D P A Q S E W S K V K T T A M I H T A T I Q H K V S G L K L K P Q Q * Y I P L R S S T K * V V * S * N H R ----:----|----:----|----:----|----:----|----:----|----:----| L L S V Y R * S G A C L S H D L T L V V L C H Y M G S R D L V F H T T * L * F W A I I C V A V I W C L T L P R F N F G C FatI |CviAII ||Cac8I ||| SphI ||| NspI ||| NlaIII CviJI ||| |MaeI EciI | AciI MnlI ||| |MslI MseI \ \ \ \ \\\ \\ \ GGAGAAAAGCCTCCGCCAATACAAGAGCATGCTAGTGTGGTGTATAAACATTTAATGTGT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CCTCTTTTCGGAGGCGGTTATGTTCTCGTACGATCACACCACATATTTGTAAATTACACA / / / / //// / / CviJI | MnlI | |||| MaeI MseI AciI | |||MslI | ||FatI | |CviAII | Cac8I NlaIII NspI SphI G E K P P P I Q E H A S V V Y K H L M C E K S L R Q Y K S M L V W C I N I * C V R K A S A N T R A C * C G V * T F N V C ----:----|----:----|----:----|----:----|----:----|----:----| P S F G G G I C S C A L T T Y L C K I H L L F A E A L V L A H * H P T Y V N L T S F L R R W Y L L M S T H H I F M * H T MseI AciI |AhaIII* |BciVI || MmeI \\ \\ \ GTGTTAGGCGGTAAGGATACCCATAACGCATATTCCAACGATGTCTATTTTTTAAACTTA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CACAATCCGCCATTCCTATGGGTATTGCGTATAAGGTTGCTACAGATAAAAAATTTGAAT / / // / | AciI || MmeI BciVI |MseI AhaIII* V L G G K D T H N A Y S N D V Y F L N L C * A V R I P I T H I P T M S I F * T Y V R R * G Y P * R I F Q R C L F F K L I ----:----|----:----|----:----|----:----|----:----|----:----| T N P P L S V W L A Y E L S T * K K F K H T L R Y P Y G Y R M N W R H R N K L S H * A T L I G M V C I G V I D I K * V * HindIII | AluI | CviJI TspDTI | | SetI |SmlI | | | Hin4II* ||SetI | | | | MnlI |||Hpy178III* | | | | | Bce83I* |||| MnlI | | | | | |BsiYI* |||| | Hpy178III* \ \ \ \ \ \\ \\\\ \ \ TTATCGCTAAAATGGTATAAGCTTCCCCGTATGAAGGAGGGCATACCTCAAGAACGCTCT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGCGATTTTACCATATTCGAAGGGGCATACTTCCTCCCGTATGGAGTTCTTGCGAGA / / / / // / / / | | | | |Bce83I* TspDTI | MnlI | | | | |BsiYI* SetI Hpy178III* | | | | MnlI SmlI | | | Hin4II* | | HindIII | CviJI | AluI SetI L S L K W Y K L P R M K E G I P Q E R S Y R * N G I S F P V * R R A Y L K N A L I A K M V * A S P Y E G G H T S R T L W ----:----|----:----|----:----|----:----|----:----|----:----| N D S F H Y L S G R I F S P M G * S R E I I A L I T Y A E G Y S P P C V E L V S * R * F P I L K G T H L L A Y R L F A R HindIII | AluI | CviJI | MboII | |TaqII FatI MseI | |TspDTI |CviAII MseI SetI | ||SetI || NlaIII \ \ \ \\\ \\ \ GGACATTCTTTAACCTTAATGAAGAATGAGAAGCTTCTTATCATGGGTGGCGACAAAACT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CCTGTAAGAAATTGGAATTACTTCTTACTCTTCGAAGAATAGTACCCACCGCTGTTTTGA / / / /// / / // Hpy178III* MseI MseI ||| | | |FatI SetI ||| | | CviAII ||| | NlaIII ||| HindIII ||CviJI ||AluI |TspDTI |MboII |TaqII SetI G H S L T L M K N E K L L I M G G D K T D I L * P * * R M R S F L S W V A T K L T F F N L N E E * E A S Y H G W R Q N * ----:----|----:----|----:----|----:----|----:----|----:----| P C E K V K I F F S F S R I M P P S L V Q V N K L R L S S H S A E * * P H R C F S M R * G * H L I L L K K D H T A V F S SspI | Eco57I Hpy188I | Eco57MI | AlwNI | | Hpy178III* | | BarI | | | MboI | | |StyI Cac8I | | | | DpnI | | |SecI* | CviJI | | | | |BstKTI | | ||Hin4II* \ \ \ \ \ \ \\ \ \ \\\ GACTATGCCAGCCCAAATATTCACGATCTACAAACTTCAGAAACTGACCAAGGCGAAGGA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTGATACGGTCGGGTTTATAAGTGCTAGATGTTTGAAGTCTTTGACTGGTTCCGCTTCCT / / / /// / / / / / / | CviJI | ||| MboI | | BarI | SecI* Cac8I | ||DpnI | AlwNI | StyI | |BstKTI Hpy188I Hin4II* | Hpy178III* Eco57MI Eco57I SspI D Y A S P N I H D L Q T S E T D Q G E G T M P A Q I F T I Y K L Q K L T K A K E L C Q P K Y S R S T N F R N * P R R R N ----:----|----:----|----:----|----:----|----:----|----:----| S * A L G F I * S R C V E S V S W P S P Q S H W G L Y E R D V F K L F Q G L R L V I G A W I N V I * L S * F S V L A F S AluI Tsp4CI* CviJI | AccI | SetI | Hin4I | |Hin4I | Hin4I | |Hin4I | |BssNAI | || BssKI | |Hpy166II | || SecI* | || DdeI | || EcoRII | || |SetI | || | ScrFI | || || BarI | || | BseBI \ \\ \\ \ \ \\ \ \ ACTTTACTGTATACCTTAGATTTATCATCTTTGAATGAGCTATGCCCAGGAATAATGTGT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAATGACATATGGAATCTAAATAGTAGAAACTTACTCGATACGGGTCCTTATTACACA / / // / / / / /// | | || | DdeI | CviJI ||EcoRII | | || BarI | AluI ||BssKI | | |AccI Hin4I |SecI* | | |SetI Hin4I BseBI | | Hpy166II SetI ScrFI | | BssNAI | Tsp4CI* Hin4I Hin4I T L L Y T L D L S S L N E L C P G I M C L Y C I P * I Y H L * M S Y A Q E * C V F T V Y L R F I I F E * A M P R N N V * ----:----|----:----|----:----|----:----|----:----|----:----| V K S Y V K S K D D K F S S H G P I I H F K V T Y R L N I M K S H A I G L F L T S * Q I G * I * * R Q I L * A W S Y H T BssKI FatI |SecI* |CviAII |HpaII || NspI ||ScrFI TfiI || CviRI* ||CauII* HinfI || NlaIII ||| CviJI DdeI \ \\ \ \\\ \ \ GAATCACTACATGCAGGAGAAAGTTTTTCTAATAGTCTTTCCGGGGGCTTTACACCCTCT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGTGATGTACGTCCTCTTTCAAAAAGATTATCAGAAAGGCCCCCGAAATGTGGGAGA / / // / / / | | |CviRI* | | CviJI | | |FatI | BssKI | | CviAII | SecI* | NlaIII CauII* | NspI HpaII HinfI ScrFI TfiI E S L H A G E S F S N S L S G G F T P S N H Y M Q E K V F L I V F P G A L H P L I T T C R R K F F * * S F R G L Y T L * ----:----|----:----|----:----|----:----|----:----|----:----| S D S C A P S L K E L L R E P P K V G E H I V V H L L F N K * Y D K R P S * V R F * * M C S F T K R I T K G P A K C G R AccI |Hpy166II ||MnlI Hpy178III* \\\ \ AAGTCTACCGAAAGTGAAAATCAAGAGATAATAAACATTCTTACACCAAGATTGCCTGAT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGATGGCTTTCACTTTTAGTTCTCTATTATTTGTAAGAATGTGGTTCTAACGGACTA / // / | |AccI Hpy178III* | Hpy166II | MnlI DdeI K S T E S E N Q E I I N I L T P R L P D S L P K V K I K R * * T F L H Q D C L I V Y R K * K S R D N K H S Y T K I A * * ----:----|----:----|----:----|----:----|----:----|----:----| L D V S L S F * S I I F M R V G L N G S * T * R F H F D L S L L C E * V L I A Q L R G F T F I L L Y Y V N K C W S Q R I Hin6I |GlaI |Eco47III GsuI ||HhaI Eco57MI MaeIII |||HaeII PsiI Hin4II* | CviJI |TspDTI ||||BstXI \ \ \ \ \\ \\\\\ AGCAAAGTTTTGAGTTATAATGATATTGATGAAGGGGCTGGAAGTTACTCCAGCGCTTTG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTTTCAAAACTCAATATTACTATAACTACTTCCCCGACCTTCAATGAGGTCGCGAAAC / / / / / / //// PsiI | | | | | |||Hin6I | | | | | ||Eco47III | | | | | ||GlaI | | | | | |BstXI | | | | | |HhaI | | | | | HaeII | | | | MaeIII | | | TspDTI | | CviJI | Eco57MI | GsuI Hin4II* S K V L S Y N D I D E G A G S Y S S A L A K F * V I M I L M K G L E V T P A L W Q S F E L * * Y * * R G W K L L Q R F G ----:----|----:----|----:----|----:----|----:----|----:----| L L T K L * L S I S S P A P L * E L A K Y C L K S N Y H Y Q H L P Q F N S W R K A F N Q T I I I N I F P S S T V G A S Q MnlI BseGI FokI Hpy188I MboII \ \ \ \ GATGATAAGGCATTTGAACGAAAATCAGATAGGGAGGAAAAGAAACCCCAATCTTCCAAA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTATTCCGTAAACTTGCTTTTAGTCTATCCCTCCTTTTCTTTGGGGTTAGAAGGTTT / / / / BseGI FokI Hpy188I MboII MnlI D D K A F E R K S D R E E K K P Q S S K M I R H L N E N Q I G R K R N P N L P K * * G I * T K I R * G G K E T P I F Q S ----:----|----:----|----:----|----:----|----:----|----:----| S S L A N S R F D S L S S F F G W D E L P H Y P M Q V F I L Y P P F S V G I K W I I L C K F S F * I P L F L F G L R G F PfoI BssKI |HpaII ||ScrFI ||CauII* TfiI ||| BsiYI* ApoI HinfI SfaNI ||| | BsrI TspEI \ \ \\\ \ \ \ GTTGATTCAAGCATCAATAAGGAAAGTCCGGGAACTGGTATCAAAGTATCTAAAAAAAAT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTAAGTTCGTAGTTATTCCTTTCAGGCCCTTGACCATAGTTTCATAGATTTTTTTTA / / /// / HinfI SfaNI ||| BsrI TfiI ||BssKI ||PfoI |BsiYI* CauII* HpaII ScrFI V D S S I N K E S P G T G I K V S K K N L I Q A S I R K V R E L V S K Y L K K I * F K H Q * G K S G N W Y Q S I * K K F ----:----|----:----|----:----|----:----|----:----|----:----| T S E L M L L S L G P V P I L T D L F F L Q N L C * Y P F D P F Q Y * L I * F F N I * A D I L F T R S S T D F Y R F F I Tsp4CI* | BplI | BplI | TfiI | HinfI | |TspRI | |Ksp632I* | || Hpy188I | || | MboII | || | | TstI | || | | |MboII | || | | |TspDTI | || | | || CviJI | || | | || | MboII MnlI | || | | || | | SapI BplI |TstI | || | | || | | Ksp632I* BplI \\ \ \\ \ \ \\ \ \ \ \ TTCCCTGTTCTACGAGGACTAACAGTGGATTCAGAAGAGTATGGCTCTTCTTCATATAAG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGGACAAGATGCTCCTGATTGTCACCTAAGTCTTCTCATACCGAGAAGAAGTATATTC / / / / / // / / // // // | | MnlI | Tsp4CI* || | | || |MboII |BplI | TstI | BplI || | | || CviJI |BplI TspEI | BplI || | | |MboII Ksp632I* ApoI TspRI || | | TspDTI SapI || | MboII || TstI |Ksp632I* |Hpy188I HinfI TfiI F P V L R G L T V D S E E Y G S S S Y K S L F Y E D * Q W I Q K S M A L L H I R P C S T R T N S G F R R V W L F F I * G ----:----|----:----|----:----|----:----|----:----|----:----| K G T R R P S V T S E S S Y P E E E Y L N G Q E V L V L L P N L L T H S K K M Y E R N * S S * C H I * F L I A R R * I L FatI ApoI MseI |CviAII TspEI |AhaIII* || NlaIII EcoRI || SetI SetI \\ \ \ \\ \ \ GACACATCATGTCAAAAAGGAATTCCCAAAAATCTTTTTGATGATTTAAACCTGAACCTA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTGTAGTACAGTTTTTCCTTAAGGGTTTTTAGAAAAACTACTAAATTTGGACTTGGAT / // / /// / | |FatI EcoRI ||SetI SetI | CviAII TspEI |MseI NlaIII ApoI AhaIII* D T S C Q K G I P K N L F D D L N L N L T H H V K K E F P K I F L M I * T * T Y H I M S K R N S Q K S F * * F K P E P T ----:----|----:----|----:----|----:----|----:----|----:----| S V D H * F P I G L F R K S S K F R F R P C M M D F L F E W F D K Q H N L G S G V C * T L F S N G F I K K I I * V Q V * MaeII | SetI | TaiI | |Hpy178III* | ||TaqI | ||| BsmAI | ||| Esp3I | ||| | AluI | ||| | CviJI | ||| | | SetI MaeI TspEI \ \\\ \ \ \ \ \ CAAACATTACGTCTCGAAGCTCAACAAAAGGAACTTGAAACTGCTAGACATATTTCACAA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTGTAATGCAGAGCTTCGAGTTGTTTTCCTTGAACTTTGACGATCTGTATAAAGTGTT / / /// // / | | ||| |Esp3I MaeI | | ||| |BsmAI | | ||| CviJI | | ||| AluI | | ||SetI | | |TaqI | | Hpy178III* | MaeII TaiI SetI Q T L R L E A Q Q K E L E T A R H I S Q K H Y V S K L N K R N L K L L D I F H N N I T S R S S T K G T * N C * T Y F T I ----:----|----:----|----:----|----:----|----:----|----:----| C V N R R S A * C F S S S V A L C I E C V F M V D R L E V F P V Q F Q * V Y K V L C * T E F S L L L F K F S S S M N * L BsmAI | MlyI | PleI | |Hpy178III* | || HinfI HindIII TfiI | || | FatI | AluI HinfI | || | |CviAII | CviJI | ApoI | || | || NlaIII | | SetI | TspEI \ \\ \ \\ \ \ \ \ \ \ TTAGAAAAGGAAGTCCAGAGACTCATGGTAATAAAAGAAGCTTCAAAAGATTCAAATTTT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTTTTCCTTCAGGTCTCTGAGTACCATTATTTTCTTCGAAGTTTTCTAAGTTTAAAA / //// / // / / / / / TspEI |||| | |FatI | | HindIII HinfI TspEI |||| | CviAII | CviJI TfiI ApoI |||| NlaIII | AluI |||| HinfI SetI |||Hpy178III* ||BsmAI |PleI MlyI L E K E V Q R L M V I K E A S K D S N F * K R K S R D S W * * K K L Q K I Q I F R K G S P E T H G N K R S F K R F K F S ----:----|----:----|----:----|----:----|----:----|----:----| N S F S T W L S M T I F S A E F S E F K I L F P L G S V * P L L L L K L L N L N * F L F D L S E H Y Y F F S * F I * I K TfiI HinfI XbaI | XbaI |MaeI | |MaeI |Hpy178III* | |Hpy178III* || BceAI | || TspEI CviJI || |ApoI | || | MseI | MseI || |TspEI Hpy188I SetI | || | VspI \ \ \\ \\ \ \ \ \\ \ \ CAAACAGCACGGCTTAAAAATCTAGAAATTCAGAAAACCTTTTTAGAATCTAGAATTAAT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTGTCGTGCCGAATTTTTAGATCTTTAAGTCTTTTGGAAAAATCTTAGATCTTAATTA / / // / // / / // // | MseI || | || SetI | || |VspI CviJI || | |Hpy188I | || |MseI || | TspEI | || TspEI || | ApoI | |XbaI || BceAI | Hpy178III* |XbaI | MaeI Hpy178III* HinfI MaeI TfiI Q T A R L K N L E I Q K T F L E S R I N K Q H G L K I * K F R K P F * N L E L M N S T A * K S R N S E N L F R I * N * * ----:----|----:----|----:----|----:----|----:----|----:----| * V A R S L F R S I * F V K K S D L I L E F L V A * F D L F E S F R K L I * F * L C C P K F I * F N L F G K * F R S N I Hpy166II MseI | BspCNI |AhaIII* | |BseMII || ApoI | ||AjuI || TspEI | ||| MaeIII || | BccI TspEI DdeI | ||| Tsp45I TspEI \\ \ \ \ \ \ \\\ \ \ GATTTAAAAAATTTATTGATGGTCAAATTATCTCAGGCAAGTAAACTCTGTGACCAAATT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAATTTTTTAAATAACTACCAGTTTAATAGAGTCCGTTCATTTGAGACACTGGTTTAA // / / / /// / / |MseI TspEI TspEI DdeI ||BseMII | TspEI AhaIII* ApoI |Hpy166II Tsp45I BccI |BspCNI MaeIII AjuI D L K N L L M V K L S Q A S K L C D Q I I * K I Y * W S N Y L R Q V N S V T K L F K K F I D G Q I I S G K * T L * P N Y ----:----|----:----|----:----|----:----|----:----|----:----| S K F F K N I T L N D * A L L S Q S W I H N L F N I S P * I I E P L Y V R H G F I * F I * Q H D F * R L C T F E T V L N FatI |CviAII || NspI || NlaIII || | Hpy188I || | | FatI || | | AflIII || | | BspLU11I* || | | |CviAII || | | || MaeIII || | | || Tsp45I TfiI AjuI || | | || |NspI HinfI |MseI || | | || |NlaIII MseI EcoRV \ \\ \\ \ \ \\ \\ \ \ ACGATTCAAAATAATGGACTTAAAACATGCTCCGAACATGTCACTATTAAAAGGGATATC 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTAAGTTTTATTACCTGAATTTTGTACGAGGCTTGTACAGTGATAATTTTCCCTATAG / / / / // / / // / / / HinfI AjuI | | || | | || | MseI EcoRV TfiI | | || | | || Tsp45I | | || | | || MaeIII | | || | | |BspLU11I* | | || | | |AflIII | | || | | |FatI | | || | | CviAII | | || | NlaIII | | || | NspI | | || Hpy188I | | |FatI | | CviAII | NlaIII | NspI MseI T I Q N N G L K T C S E H V T I K R D I R F K I M D L K H A P N M S L L K G I S D S K * W T * N M L R T C H Y * K G Y H ----:----|----:----|----:----|----:----|----:----|----:----| V I * F L P S L V H E S C T V I L L S I * S E F Y H V * F M S R V H * * * F P Y R N L I I S K F C A G F M D S N F P I D TaqI ClaI |MboI Bce83I* || DpnI | Hin6I || |BstKTI | |GlaI || ||SmlI | ||HhaI || ||Hpy178III* | |||HaeII \\ \\\ \ \\\\ ATCGATCTTGAGAATAAATGTGATGTTTTGAAGCGCCAGAACGAAATACTTGTAAATAAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTAGAACTCTTATTTACACTACAAAACTTCGCGGTCTTGCTTTATGAACATTTATTA // / / / / //// || | | SmlI | |||Hin6I || | Hpy178III* | ||GlaI || MboI | |HhaI |DpnI | HaeII BstKTI Bce83I* ClaI TaqI I D L E N K C D V L K R Q N E I L V N N S I L R I N V M F * S A R T K Y L * I I R S * E * M * C F E A P E R N T C K * Y ----:----|----:----|----:----|----:----|----:----|----:----| M S R S F L H S T K F R W F S I S T F L * R D Q S Y I H H K S A G S R F V Q L Y D I K L I F T I N Q L A L V F Y K Y I I AloI TfiI CviRI* TspDTI | SetI HinfI AloI \ \ \ \ \ \ ATGCAAAAAATAACCCCCGAACTTCATACCTATTTGAACGAATCGTCCTGCTATCTGGGT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTTTTTATTGGGGGCTTGAAGTATGGATAAACTTGCTTAGCAGGACGATAGACCCA / / / / / / CviRI* TspDTI | SetI HinfI AloI AloI TfiI M Q K I T P E L H T Y L N E S S C Y L G C K K * P P N F I P I * T N R P A I W V A K N N P R T S Y L F E R I V L L S G * ----:----|----:----|----:----|----:----|----:----|----:----| I C F I V G S S * V * K F S D D Q * R P Y A F F L G R V E Y R N S R I T R S D P H L F Y G G F K M G I Q V F R G A I Q T BsrI | ApaLI | | CviRI* | | Hpy166II | | |BsiYI* | | ||SduI | | ||BseSI | | ||TspRI | | ||HgiAI* | | |||CfrI AluI | | |||| CviJI CviJI | | |||| HaeIII BceAI TspEI MseI | SetI | | |||| | SetI |Hin4II* \ \ \ \ \ \ \\\\ \ \ \\ AAATTATTAAAAAGCTATCCTACCAGTGCACGGCCACCTTCAAGTGAGAAAGATAATCAA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAATAATTTTTCGATAGGATGGTCACGTGCCGGTGGAAGTTCACTCTTTCTATTAGTT / / / / / / / / / / / / | | | CviJI | | | | | CfrI | BceAI | | | AluI | | | | | SetI Hin4II* | | SetI | | | | HaeIII | MseI | | | | CviJI TspEI | | | ApaLI | | Hpy166II | | CviRI* | BsiYI* | HgiAI* | BseSI | SduI TspRI BsrI K L L K S Y P T S A R P P S S E K D N Q N Y * K A I L P V H G H L Q V R K I I K I I K K L S Y Q C T A T F K * E R * S N ----:----|----:----|----:----|----:----|----:----|----:----| L N N F L * G V L A R G G E L S F S L * Y I I L F S D * W H V A V K L H S L Y D F * * F A I R G T C P W R * T L F I I L TfiI TspDTI HinfI CviRI* |Tsp4CI* \ \ \\ ATATATGAGAAAGATTCGCTGAACAAAATAGAAAAAGTAATAAATGAAATGCACGAAACC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TATATACTCTTTCTAAGCGACTTGTTTTATCTTTTTCATTATTTACTTTACGTGCTTTGG / / / / HinfI | | Tsp4CI* TfiI | TspDTI CviRI* I Y E K D S L N K I E K V I N E M H E T Y M R K I R * T K * K K * * M K C T K P I * E R F A E Q N R K S N K * N A R N R ----:----|----:----|----:----|----:----|----:----|----:----| I Y S F S E S F L I S F T I F S I C S V F I H S L N A S C F L F L L L H F A R F Y I L F I R Q V F Y F F Y Y I F H V F G DdeI | Hpy188I | | HindIII | | | AluI | | | CviJI | | | | MseI | | | | SetI | | | | |FalI TspEI | | | | |FalI TfiI | CviRI* | | | | || BspCNI HinfI Cac8I | | SetI | | | | || |BseMII |FauI \ \ \ \ \ \ \ \ \\ \\ \\ GTGCGTGCTAAAGAGAAATTGCACCTTGAAACTCAGAAGCTTAATGATGAAAGAGATTCT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CACGCACGATTTCTCTTTAACGTGGAACTTTGAGTCTTCGAATTACTACTTTCTCTAAGA / /// // / / / // / / Cac8I ||SetI || | | | |BseMII | TspDTI |CviRI* || | | | BspCNI HinfI TspEI || | | | MseI TfiI || | | HindIII FauI || | CviJI || | AluI || SetI || FalI || FalI |DdeI Hpy188I V R A K E K L H L E T Q K L N D E R D S C V L K R N C T L K L R S L M M K E I L A C * R E I A P * N S E A * * * K R F F ----:----|----:----|----:----|----:----|----:----|----:----| T R A L S F N C R S V * F S L S S L S E R A H * L S I A G Q F E S A * H H F L N H T S F L F Q V K F S L L K I I F S I R TspDTI |AciI || Cac8I || | CviJI || | | TspEI Hin6I || | | | MmeI |GlaI || | | | FalI ||HhaI FokI || | | | FalI ||BseGI Hin4I || | | | | TaqI SfaNI |||DdeI | BccI Hpy188I \\ \ \ \ \ \ \ \\\\ \ \ \ TTGCGGGCTAATTTACTCGACAATAACAACAAGTTGGATGCGCTAAGAAAACTCTCTGAT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| AACGCCCGATTAAATGAGCTGTTATTGTTGTTCAACCTACGCGATTCTTTTGAGAGACTA / / / // / / /// / / / / | | | |TspEI TaqI SfaNI ||| | DdeI | Hpy188I | | | MmeI ||| Hin4I FokI | | FalI ||Hin6I BccI | | FalI |GlaI | CviJI BseGI Cac8I HhaI AciI L R A N L L D N N N K L D A L R K L S D C G L I Y S T I T T S W M R * E N S L M A G * F T R Q * Q Q V G C A K K T L * W ----:----|----:----|----:----|----:----|----:----|----:----| K R A L K S S L L L L N S A S L F S E S K A P * N V R C Y C C T P H A L F V R Q Q P S I * E V I V V L Q I R * S F E R I Hpy188I | AluI AsuI* | CviJI AvaII | Ecl136II |BmgT120I | | TaqI || Hin4I | | SetI AluI || | SetI | | SduI CviJI || | |Hin4II* | | SacI | TaqI || | || HphI | | HgiAI* | SetI || | || | CviJI SetI | | HgiJII* \ \ \\ \ \\ \ \ \ \ \ \ GGAAGCTCGAAGTCTATGGACCTAACAAAGAAGGCTATTCACCTATCACAATCCGAGCTC 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTCGAGCTTCAGATACCTGGATTGTTTCTTCCGATAAGTGGATAGTGTTAGGCTCGAG / / / / /// / / / / / / / | | TaqI | ||| | | CviJI SetI | | Ecl136II | CviJI | ||| | HphI | | CviJI | AluI | ||| Hin4II* | | AluI SetI | ||AvaII | HgiJII* | ||AsuI* | HgiAI* | |BmgT120I | SacI | SetI | SduI Hin4I | SetI Hpy188I G S S K S M D L T K K A I H L S Q S E L E A R S L W T * Q R R L F T Y H N P S S K L E V Y G P N K E G Y S P I T I R A R ----:----|----:----|----:----|----:----|----:----|----:----| P L E F D I S R V F F A I * R D C D S S H F S S T * P G L L S P * E G I V I R A S A R L R H V * C L L S N V * * L G L E Hpy99I TspEI | Hin4II* | MseI \ \ \ \ GAAAAATATCGTAAAAACAACGACGATTTACAGAAGGAGATTGATAGAATTAAAACTGAA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTATAGCATTTTTGTTGCTGCTAAATGTCTTCCTCTAACTATCTTAATTTTGACTT / / / // TaqI | Hin4II* |MseI Hpy99I TspEI E K Y R K N N D D L Q K E I D R I K T E K N I V K T T T I Y R R R L I E L K L N K I S * K Q R R F T E G D * * N * N * T ----:----|----:----|----:----|----:----|----:----|----:----| S F Y R L F L S S K C F S I S L I L V S R F I D Y F C R R N V S P S Q Y F * F Q F F I T F V V V I * L L L N I S N F S F KasI HgiCI* |AcyI |NarI FatI |Hin6I |BccI ||GlaI |CviAII ||DinI || SfaNI AluI ||NlaIV || |NlaIII CviJI FokI |||HhaI || || ApoI | SetI BseGI | MwoI ||||HaeII || || TspEI \ \ \ \ \ \\\\\ \\ \\ \ CAAGCTGAACAGGATGACAAGCAGGAACAGCGTGGCGCCATCACTCATGGAAATTTTGAT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGACTTGTCCTACTGTTCGTCCTTGTCGCACCGCGGTAGTGAGTACCTTTAAAACTA / / / / / ///// / /// / / | CviJI BseGI MwoI FokI ||||HgiCI* | ||| | TspEI | AluI ||||KasI | ||| | ApoI SetI |||Hin6I | ||| SfaNI |||NarI | ||FatI |||AcyI | |CviAII ||NlaIV | BccI ||DinI NlaIII ||GlaI |HhaI HaeII Q A E Q D D K Q E Q R G A I T H G N F D K L N R M T S R N S V A P S L M E I L M S * T G * Q A G T A W R H H S W K F * C ----:----|----:----|----:----|----:----|----:----|----:----| C A S C S S L C S C R P A M V * P F K S V L Q V P H C A P V A H R W * E H F N Q L S F L I V L L F L T A G D S M S I K I TaqI TspDTI | BplI |Hpy188I | BplI || AciI Tsp4CI* | | Bce83I* \\ \ \ \ \ \ GCGTTCCACAGAATGAAAATCAACAATCTGAAAGCGGAACTGTATATGTCGAAAGAAAAT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CGCAAGGTGTCTTACTTTTAGTTGTTAGACTTTCGCCTTGACATATACAGCTTTCTTTTA / / / / / / / | Hpy188I | Tsp4CI* | | Bce83I* TspDTI AciI | TaqI BplI BplI A F H R M K I N N L K A E L Y M S K E N R S T E * K S T I * K R N C I C R K K I V P Q N E N Q Q S E S G T V Y V E R K * ----:----|----:----|----:----|----:----|----:----|----:----| A N W L I F I L L R F A S S Y I D F S F H T G C F S F * C D S L P V T Y T S L F R E V S H F D V I Q F R F Q I H R F F I NheI |MaeI |BplI |BplI ||Cac8I ||| AluI ||| BmtI ||| CviJI ||| | SetI TfiI ||| | |MseI Hpy178III* HinfI SmlI MnlI ||| | ||AhaIII* |TaqI \ \ \ \\\ \ \\\ \\ AGAGATTCCCTCAAGGACGAACTGCTAGCTTTAAAAAAAAAACTATATACTCTCGAACAA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTAAGGGAGTTCCTGCTTGACGATCGAAATTTTTTTTTTGATATATGAGAGCTTGTT / / / / / /// // // HinfI | | | | ||| |MseI |TaqI TfiI | | | | ||| AhaIII* Hpy178III* | | | | ||CviJI | | | | ||NheI | | | | ||AluI | | | | |MaeI | | | | Cac8I | | | | SetI | | | BmtI | | BplI | | BplI | MnlI SmlI R D S L K D E L L A L K K K L Y T L E Q E I P S R T N C * L * K K N Y I L S N K R F P Q G R T A S F K K K T I Y S R T K ----:----|----:----|----:----|----:----|----:----|----:----| L S E R L S S S S A K F F F S Y V R S C Y L N G * P R V A L K L F F V I Y E R V S I G E L V F Q * S * F F F * I S E F L AAAAAATAG ----:---- TTTTTTATC K K * K N X K I X ----:---- F F Y F F I F F L # Enzymes that cut Frequency Isoschizomers Acc65I 2 Asp718I AccI 3 FblI,XmiI AciI 10 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 4 DraI AjuI 2 AlfI 2 AloI 1 AluI 14 AluBI AlwNI 1 CaiI ApaLI 1 Alw44I,VneI ApoI 9 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BccI 4 Bce83I* 3 BpuEI BceAI 5 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 3 BmtI 2 BspOI BplI 4 BsaBI 3 Bse8I,BseJI BsaXI 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 6 BstF5I,BtsCI BseMII 2 BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BspCNI 2 BspLU11I* 1 PscI,PciI BspMI 2 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 7 BstXI 1 Cac8I 6 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 3 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 5 CviQI,RsaNI CspCI 1 CviAII 9 CviJI 29 CviKI-1 CviRI* 6 HpyCH4V DdeI 5 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 7 MalI DraII 1 EcoO109I DraIII 1 AdeI EciI 2 Ecl136II 1 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI Eco47III 1 Aor51HI,AfeI Eco57I 1 AcuI Eco57MI 3 EcoRI 2 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 1 Eco32I Esp3I 1 BsmBI FalI 2 FatI 9 FauI 2 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 6 GsuI 2 BpmI HaeII 3 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 3 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 6 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 7 HpyAV Hin6I 6 HinP1I,HspAI HindII 1 HincII HindIII 4 HinfI 12 HpaII 3 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 12 Hpy188III Hpy188I 10 Hpy99I 2 KasI 1 KpnI 2 Ksp632I* 4 Eam1104I,EarI,Bst6I MaeI 6 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 6 MboI 7 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 1 SchI MmeI 3 MnlI 14 MseI 18 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NarI 1 Mly113I NdeI 1 FauNDI NheI 2 AsuNHI NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspI 5 BstNSI,XceI PfoI 1 PleI 1 PpsI PpuMI 1 Psp5II,PspPPI PsiI 2 AanI RsaI 5 AfaI SacI 1 Psp124BI,SstI SalI 1 SapI 2 LguI,PciSI,BspQI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 36 SfaNI 3 LweI SmlI 3 SmoI SphI 1 PaeI,BbuI SspI 2 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 11 TaqII 1 TauI 1 TfiI 11 PfeI Tsp45I 3 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 9 TspEI 20 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 2 TscAI TstI 1 VspI 2 PshBI,AseI XbaI 2 XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AflII ApaI AscI AsuII AvaI AvrII BaeI BalI BamHI BbvCI BbvI BbvII* BcgI BdaI BfiI BglI BglII BmeT110I Bpu10I BsaAI BsePI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspHI BspMII* BsrBI BstAPI BstEII BtgZI BtrI BtsI Cfr9I DrdI DsaI* Eam1105I EcoNI EcoP15I EcoT22I EspI* FseI FspAI GsaI HpaI MauBI MfeI MluI Mph1103I MroNI MstI* NaeI NcoI NgoMIV NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacII SanDI SauI* ScaI SexAI SfeI* SfiI SgfI SgrAI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I StuI SwaI TatI TseI TsoI TspMI Tth111I XcmI XhoI XhoII XmaCI XmaI XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769