Restriction Map of SPG1/YGR236C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SPG1/YGR236C on chromosome VII from coordinates 962817 to 962530.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.6516

EMBOSS_001 TfiI HinfI | Hpy178III* | | TspDTI | | | MnlI | | | | DdeI BspCNI | | | | | Hpy188I |BseMII \ \ \ \ \ \ \\ ATGAAGTTAGATTCAGGAATATACTCAGAGGCACAAAGAGTTGTGAGAACTCCAAAGTTT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCAATCTAAGTCCTTATATGAGTCTCCGTGTTTCTCAACACTCTTGAGGTTTCAAA // / / // // || | MnlI |DdeI |BseMII || | Hpy188I BspCNI || Hpy178III* |TspDTI HinfI TfiI M K L D S G I Y S E A Q R V V R T P K F * S * I Q E Y T Q R H K E L * E L Q S L E V R F R N I L R G T K S C E N S K V * ----:----|----:----|----:----|----:----|----:----|----:----| X F N S E P I Y E S A C L T T L V G F N X S T L N L F I S L P V F L Q S F E L T H L * I * S Y V * L C L S N H S S W L K Acc65I HgiCI* |Csp6I ||RsaI ||NlaIV ||| KpnI ||| | AciI Hin6I ||| | McrI* |GlaI ||| | | MnlI ||TseI ||| | | | FatI ||HhaI ||| | | | |CviAII |||BisI ||| | | | ||MnlI BbvI |||HaeII ||| | | | ||| NlaIII EcoP15I | CviJI ||||BlsI ||| | | | ||| | BsgI \ \ \ \\\\\ \\\ \ \ \ \\\ \ \ AGATATATTATGTTAGGGCTGGTGGGCGCTGCTGTGGTACCGACCGCATACATGAGGAGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TCTATATAATACAATCCCGACCACCCGCGACGACACCATGGCTGGCGTATGTACTCCTCT / // /////// / /// / / // // / EcoP15I |BbvI ||||||TseI | ||| | | || || BsgI CviJI |||||BisI | ||| | | || |FatI ||||BlsI | ||| | | || CviAII |||Hin6I | ||| | | |MnlI ||GlaI | ||| | | NlaIII |HhaI | ||| | AciI HaeII | ||| | MnlI | ||| McrI* | ||HgiCI* | ||Acc65I | |Csp6I | NlaIV | RsaI KpnI R Y I M L G L V G A A V V P T A Y M R R D I L C * G W W A L L W Y R P H T * G E I Y Y V R A G G R C C G T D R I H E E R ----:----|----:----|----:----|----:----|----:----|----:----| L Y I I N P S T P A A T T G V A Y M L L * I Y * T L A P P R Q Q P V S R M C S S S I N H * P Q H A S S H Y R G C V H P S AccI BseRI AluI |Hpy166II Tsp4CI* CviJI || DdeI | NlaIV |DdeI || |BceAI CviJI | | CviRI* ||SetI || HgaI || AcyI \ \ \ \ \\\ \\ \ \\ \ GGCTATACGGTTCCTGCACATAGCTTAGACAACATCAACGGCGTAGACACAACTAAGGCG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CCGATATGCCAAGGACGTGTATCGAATCTGTTGTAGTTGCCGCATCTGTGTTGATTCCGC / // / / / / / // / / / | || | | | | DdeI |AccI | | AcyI | || | | | CviJI | | BceAI | || | | | AluI | | DdeI | || | | SetI | HgaI | || | CviRI* Hpy166II | || NlaIV | |Tsp4CI* | BseRI CviJI G Y T V P A H S L D N I N G V D T T K A A I R F L H I A * T T S T A * T Q L R R L Y G S C T * L R Q H Q R R R H N * G V ----:----|----:----|----:----|----:----|----:----|----:----| P * V T G A C L K S L M L P T S V V L A L S Y P E Q V Y S L C C * R R L C L * P A I R N R C M A * V V D V A Y V C S L R TseI |BisI ||BlsI |||AluI |||CviJI |||| SetI Csp6I |||| Hin4II* Hpy166II |RsaI |||| | BbvI | BccI \\ \\\\ \ \ \ \ TCTGTTATGGGTACAGAACAGAGAGCAGCTATGACGAAGGGTAAGAGTTTACAAGAGATG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGACAATACCCATGTCTTGTCTCTCGTCGATACTGCTTCCCATTCTCAAATGTTCTCTAC // //// / / / |Csp6I |||Hin4II* BbvI | BccI RsaI ||CviJI Hpy166II ||TseI ||AluI |BisI BlsI SetI S V M G T E Q R A A M T K G K S L Q E M L L W V Q N R E Q L * R R V R V Y K R * C Y G Y R T E S S Y D E G * E F T R D D ----:----|----:----|----:----|----:----|----:----|----:----| D T I P V S C L A A I V F P L L K C S I T Q * P Y L V S L L * S S P Y S N V L S R N H T C F L S C S H R L T L T * L L H BseGI | PsrI | | MaeIII | | |FokI | | || MaeII Ksp632I* | | || | SetI | FatI | | || | TaiI | |CviAII | | || | | MboII | || PsrI | | || | | TspDTI | || NlaIII \ \ \\ \ \ \ \ \\ \ ATGGATGATGATGAAGTAACGTATTTGATGTTCTCTTCAATCATGTAA 250 260 270 280 ----:----|----:----|----:----|----:----|----:--- TACCTACTACTACTTCATTGCATAAACTACAAGAGAAGTTAGTACATT // / // // /// // |PsrI | || |MboII ||| |FatI BseGI | || TspDTI ||| CviAII | |MaeII ||Ksp632I* | MaeIII |NlaIII | FokI PsrI TaiI SetI M D D D E V T Y L M F S S I M * W M M M K * R I * C S L Q S C X G * * * S N V F D V L F N H V X ----:----|----:----|----:----|----:----|----:--- I S S S S T V Y K I N E E I M Y S P H H H L L T N S T R K L * T H I I I F Y R I Q H E R * D H L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AluI 2 AluBI BbvI 2 BseXI,BstV1I,Lsp1109I BccI 1 BceAI 1 BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BseGI 1 BstF5I,BtsCI BseMII 1 BseRI 1 BsgI 1 BspCNI 1 Csp6I 2 CviQI,RsaNI CviAII 2 CviJI 4 CviKI-1 CviRI* 1 HpyCH4V DdeI 3 BstDEI,HpyF3I EcoP15I 1 FatI 2 FokI 1 GlaI 1 HaeII 1 BstH2I HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HinfI 1 Hpy166II 2 Hpy8I Hpy178III* 1 Hpy188III Hpy188I 1 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeII 1 HpyCH4IV MaeIII 1 MboII 1 McrI* 1 BsiEI,BstMCI,Bsh1285I MnlI 3 NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I PsrI 1 RsaI 2 AfaI SetI 3 TaiI 1 TfiI 1 PfeI TseI 2 ApeKI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 2 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BsePI BseSI BseYI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstKTI BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DpnI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GsaI GsuI HaeIII HgiAI* HgiJII* Hin4I HindII HindIII HpaI HpaII HphI Hpy99I KasI MaeI MauBI MboI MfeI MluI MlyI MmeI Mph1103I MroNI MseI MslI MstI* MvaI MwoI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SduI SecI* SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaqI TaqII TatI TauI TsoI Tsp45I TspEI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769