Restriction Map of THI4/YGR144W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

THI4/YGR144W on chromosome VII from coordinates 780399 to 781379.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.15088

MfeI TspEI | GsuI | Eco57MI | |MnlI | |CviRI* SetI MnlI | || MseI \ \ \ \\ \ ATGTCTGCTACCTCTACTGCTACTTCCACAAGTGCCTCTCAATTGCACTTAAACTCTACT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGACGATGGAGATGACGATGAAGGTGTTCACGGAGAGTTAACGTGAATTTGAGATGA / / / // / / SetI MnlI | || MseI BsrI | |CviRI* | TspEI | MnlI | MfeI Eco57MI GsuI M S A T S T A T S T S A S Q L H L N S T C L L P L L L L P Q V P L N C T * T L L V C Y L Y C Y F H K C L S I A L K L Y S ----:----|----:----|----:----|----:----|----:----|----:----| X D A V E V A V E V L A E * N C K F E V X T Q * R * Q * K W L H R E I A S L S * H R S G R S S S G C T G R L Q V * V R S Hpy188I |MboII || FokI || |MseI BsrI || ||AhaIII* | MaeIII TspRI || |||ApoI | | BtsI | Hpy188I MseI || |||TspEI \ \ \ \ \ \ \\ \\\\ CCAGTTACTCACTGCTTATCTGACATCGTTAAGAAAGAAGATTGGTCTGACTTTAAATTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCAATGAGTGACGAATAGACTGTAGCAATTCTTTCTTCTAACCAGACTGAAATTTAAA // / / // /// / |MaeIII Hpy188I MseI |MboII ||| TspEI TspRI | ||| ApoI BtsI | ||FokI | |MseI | AhaIII* Hpy188I P V T H C L S D I V K K E D W S D F K F Q L L T A Y L T S L R K K I G L T L N L S Y S L L I * H R * E R R L V * L * I C ----:----|----:----|----:----|----:----|----:----|----:----| G T V * Q K D S M T L F S S Q D S K L N E L * E S S I Q C R * S L L N T Q S * I W N S V A * R V D N L F F I P R V K F K BseGI MboI | AciI XhoII | | FnuDII* Tsp4CI* |BceAI | | | TfiI | TspRI ||DpnI | | | BccI | | BsiI* |||BstKTI | | | HinfI | | |BsmAI ||||Hpy178III* \ \ \ \ \ \ \\ \\\\\ GCTCCCATCCGCGAATCCACTGTCTCTCGTGCTATGACTTCTCGTTATTTCAAGGATCTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGGGTAGGCGCTTAGGTGACAGAGAGCACGATACTGAAGAGCAATAAAGTTCCTAGAA / / /// / // //// / BseGI | ||| Tsp4CI* |BsmAI |||| Hpy178III* | ||HinfI BsiI* |||XhoII | ||TfiI |||MboI | |TspRI ||BceAI | BccI |DpnI FnuDII* BstKTI AciI A P I R E S T V S R A M T S R Y F K D L L P S A N P L S L V L * L L V I S R I L S H P R I H C L S C Y D F S L F Q G S * ----:----|----:----|----:----|----:----|----:----|----:----| A G M R S D V T E R A I V E R * K L S R Q E W G R I W Q R E H * S K E N N * P D S G D A F G S D R T S H S R T I E L I K Eco57I Eco57MI | MboII | | AciI | | | Cac8I | | | | CviJI | | | | | SduI | | | | | HgiJII* | | | | | | EciI | | | | | | | SapI | | | | | | | Ksp632I* | | | | | | | | SetI Hpy188I | | | | | | | | | BtgZI | MaeII | | | | | | | | | | AciI | |BtrI | | | | | | | | | | | AciI | || SetI | | | | | | | | | | | BisI BinI* | || TaiI |FauI | | | | | | | | | | |BlsI \ \ \\ \ \\ \ \ \ \ \ \ \ \ \ \ \\ GACAAGTTTGCCGTTTCTGACGTGATTATTGTCGGTGCGGGCTCTTCAGGTTTATCCGCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTCAAACGGCAAAGACTGCACTAATAACAGCCACGCCCGAGAAGTCCAAATAGGCGG / / / // / / / / / / / / /// BinI* | | || | | | | | | | | ||BisI | | || | | | | | | | | |BlsI | | || | | | | | | | | BtgZI | | || | | | | | | | | AciI | | || | | | | | | | | TauI | | || | | | | | | | Ksp632I* | | || | | | | | | | SapI | | || | | | | | | SetI | | || | | | | | EciI | | || | | | | CviJI | | || | | | HgiJII* | | || | | | Cac8I | | || | | | SduI | | || | | | AciI | | || | | MboII | | || | FauI | | || Eco57MI | | || Eco57I | | |MaeII | | BtrI | TaiI | SetI Hpy188I D K F A V S D V I I V G A G S S G L S A T S L P F L T * L L S V R A L Q V Y P P Q V C R F * R D Y C R C G L F R F I R R ----:----|----:----|----:----|----:----|----:----|----:----| S L N A T E S T I I T P A P E E P K D A Q C T Q R K Q R S * Q R H P S K L N I R V L K G N R V H N N D T R A R * T * G G TauI | MaeII | | SetI | | TaiI Hin4II* SetI TaqI \ \ \ \ \ \ GCTTACGTCATCGCCAAGAACAGACCAGACTTGAAGGTTTGTATTATCGAAAGTTCAGTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CGAATGCAGTAGCGGTTCTTGTCTGGTCTGAACTTCCAAACATAATAGCTTTCAAGTCAA / / / / / / | | MaeII Hin4II* SetI TaqI | TaiI | SetI AciI A Y V I A K N R P D L K V C I I E S S V L T S S P R T D Q T * R F V L S K V Q L L R H R Q E Q T R L E G L Y Y R K F S C ----:----|----:----|----:----|----:----|----:----|----:----| A * T M A L F L G S K F T Q I I S L E T R K R * R W S C V L S S P K Y * R F N L S V D D G L V S W V Q L N T N D F T * N CviRI* | BssKI | SexAI | EcoRII FatI | | ScrFI NcoI | | BseBI StyI | | | DraIII SecI* | | | | SetI DsaI* | | | | |PflMI |CviAII | | | | |BsiYI* || NlaIII | | | | || TaqII TspEI TsoI || |MslI \ \ \ \ \\ \ \ \ \\ \\ GCACCAGGTGGTGGTAGTTGGTTGGGTGGTCAATTATTTAGTGCCATGGTTATGAGAAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGGTCCACCACCATCAACCAACCCACCAGTTAATAAATCACGGTACCAATACTCTTTT / ///// / / / /// | ||||| TaqII TspEI | ||MslI | ||||EcoRII TsoI | |DsaI* | ||||SexAI | |SecI* | ||||BssKI | |StyI | |||BsiYI* | |NcoI | |||PflMI | |FatI | ||BseBI | CviAII | ||ScrFI NlaIII | |SetI | DraIII CviRI* A P G G G S W L G G Q L F S A M V M R K H Q V V V V G W V V N Y L V P W L * E N T R W W * L V G W S I I * C H G Y E K T ----:----|----:----|----:----|----:----|----:----|----:----| A G P P P L Q N P P * N N L A M T I L F Q V L H H Y N T P H D I I * H W P * S F C W T T T T P Q T T L * K T G H N H S F Hin4II* | BbvII* AluI | | MaeIII CviJI | | Tsp45I |MmeI | | | SetI ||SetI | | | |MboII DrdI \\\ \ \ \ \\ \ CCAGCTCATTTGTTCTTACAAGAGTTGGAAATCCCTTACGAAGACGAAGGTGACTATGTT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCGAGTAAACAAGAATGTTCTCAACCTTTAGGGAATGCTTCTGCTTCCACTGATACAA /// / / / / / / ||CviJI Hin4II* | | | | HphI ||AluI | | | DrdI |MmeI | | Tsp45I SetI | | MaeIII | BbvII* | MboII SetI P A H L F L Q E L E I P Y E D E G D Y V Q L I C S Y K S W K S L T K T K V T M L S S F V L T R V G N P L R R R R * L C C ----:----|----:----|----:----|----:----|----:----|----:----| G A * K N K C S N S I G * S S S P S * T V L E N T R V L T P F G K R L R L H S H W S M Q E * L L Q F D R V F V F T V I N HphI | MseI | | FatI | | |CviAII | | ||Cac8I | | |||TspDTI | | ||||SphI | | ||||NspI Tsp4CI* | | ||||NlaIII | EcoNI | | |||||AciI | | BsiYI* | | |||||BisI | | | SetI | | ||||||BlsI | | | | CviRI* | | |||||||TauI | | | | |TspEI \ \ \\\\\\\\ \ \ \ \ \\ GTCGTTAAGCATGCCGCTTTGTTCATCTCTACTGTCCTTTCAAAGGTCTTGCAATTACCA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCAATTCGTACGGCGAAACAAGTAGAGATGACAGGAAAGTTTCCAGAACGTTAATGGT / //////// / / / / / / | |||||||AciI | | | SetI | TspEI | ||||||BisI | | EcoNI CviRI* | |||||BlsI | BsiYI* | ||||FatI Tsp4CI* | ||||TauI | |||CviAII | ||Cac8I | |TspDTI | NlaIII | NspI | SphI MseI V V K H A A L F I S T V L S K V L Q L P S L S M P L C S S L L S F Q R S C N Y Q R * A C R F V H L Y C P F K G L A I T K ----:----|----:----|----:----|----:----|----:----|----:----| T T L C A A K N M E V T R E F T K C N G Q R * A H R K T * R * Q G K L P R A I V D N L M G S Q E D R S D K * L D Q L * W MaeIII SetI BstEII MseI Tsp4CI* | TsoI | MboII SetI \ \ \ \ \ \ \ AATGTTAAACTGTTCAATGCTACCTGTGTTGAAGATTTGGTTACCAGACCACCTACCGAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAATTTGACAAGTTACGATGGACACAACTTCTAAACCAATGGTCTGGTGGATGGCTT / / / / / / / | Tsp4CI* SetI TsoI | | SetI MseI | BstEII | MaeIII MboII N V K L F N A T C V E D L V T R P P T E M L N C S M L P V L K I W L P D H L P K C * T V Q C Y L C * R F G Y Q T T Y R K ----:----|----:----|----:----|----:----|----:----|----:----| F T L S N L A V Q T S S K T V L G G V S L H * V T * H * R H Q L N P * W V V * R I N F Q E I S G T N F I Q N G S W R G F BsrI MaeIII MaeII Tsp45I | SetI AluI | Tsp4CI* MaeIII | TaiI CviJI HphI | | HphI Tsp45I | | MaeIII | SetI \ \ \ \ \ \ \ \ \ \ AAGGGCGAAGTCACCGTTGCTGGTGTTGTCACCAACTGGACGTTAGTTACCCAAGCTCAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCCGCTTCAGTGGCAACGACCACAACAGTGGTTGACCTGCAATCAATGGGTTCGAGTG / / / / // / / / / / HphI | HphI | || MaeII | | | Tsp4CI* Tsp4CI* | |TaiI | | CviJI Tsp45I | |SetI | | AluI MaeIII | BsrI | SetI Tsp45I MaeIII MaeIII K G E V T V A G V V T N W T L V T Q A H R A K S P L L V L S P T G R * L P K L T G R S H R C W C C H Q L D V S Y P S S R ----:----|----:----|----:----|----:----|----:----|----:----| F P S T V T A P T T V L Q V N T V W A * F P R L * R Q Q H Q * W S S T L * G L E L A F D G N S T N D G V P R * N G L S V FatI CviRI* |CviAII || AsuI* || AvaII || NlaIII || |BmgT120I || || MaeII || || | SetI || || | TaiI Tsp4CI* || || | TspEI |Csp6I || || | | BspMI MaeIII BdaI ||RsaI || ||NlaIV | | | TspEI | SetI BdaI \\\ \\ \\\ \ \ \ \ \ \ \ GGTACTCAATGTTGCATGGACCCTAACGTAATTGAATTGGCAGGTTACAAAAATGACGGA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGAGTTACAACGTACCTGGGATTGCATTAACTTAACCGTCCAATGTTTTTACTGCCT // / // // / / / / / / / / |Csp6I | || || | | | | | SetI | BdaI RsaI | || || | | | | TspEI | BdaI | || || | | | BspMI MaeIII | || || | | TspEI | || || | MaeII | || || TaiI | || || SetI | || |AvaII | || |AsuI* | || BmgT120I | || NlaIV | |FatI | CviAII CviRI* NlaIII G T Q C C M D P N V I E L A G Y K N D G V L N V A W T L T * L N W Q V T K M T E Y S M L H G P * R N * I G R L Q K * R N ----:----|----:----|----:----|----:----|----:----|----:----| P V * H Q M S G L T I S N A P * L F S P R Y E I N C P G * R L Q I P L N C F H R T S L T A H V R V Y N F Q C T V F I V S AgeI BetI* Cfr10I |HpaII || BccI BsiI* PleI || | FatI | MaeIII |FatI || | BspHI | Tsp45I |MlyI || | |CviAII | Hpy178III* ||CviAII || | |Hpy178III* | | SmlI ||| NlaIII || | || NlaIII | | | PshAI ||| | BdaI || | || | AsuI* | | | TspGWI ||| | BdaI || | || | AvaII | | | |HinfI ||| | |Bce83I* || | || | |BmgT120I \ \ \ \\ \\\ \ \\ \\ \ \\ \ \\ ACTCGTGACTTGAGTCAAAAGCATGGTGTCATTTTATCCACTACCGGTCATGATGGTCCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGCACTGAACTCAGTTTTCGTACCACAGTAAAATAGGTGATGGCCAGTACTACCAGGT / / / / / / // // /// // // | | | | HinfI | || |Bce83I* ||| || |AvaII | | | SmlI | || BdaI ||| || |AsuI* | | PshAI | || BdaI ||| || BmgT120I | TspGWI | |FatI ||| |BspHI | Tsp45I | CviAII ||| |FatI | MaeIII NlaIII ||| Hpy178III* Hpy178III* PleI ||| CviAII BsiI* MlyI ||NlaIII |Cfr10I |BetI* |AgeI |BccI HpaII T R D L S Q K H G V I L S T T G H D G P L V T * V K S M V S F Y P L P V M M V H S * L E S K A W C H F I H Y R S * W S I ----:----|----:----|----:----|----:----|----:----|----:----| V R S K L * F C P T M K D V V P * S P G F E H S S D F A H H * K I W * R D H H D S T V Q T L L M T D N * G S G T M I T W TfiI HinfI | SalI | |TaqI | |AccI | ||HindII | ||Hpy166II | |||Hpy99I TspEI MwoI | |||| MboI | PflMI |Hin6I | |||| BclI | BsiYI* ||GlaI | |||| | DpnI | | AciI |||HhaI | |||| | |BstKTI | | |Hin4II* \\\\ \ \\\\ \ \\ \ \ \\ TTTGGTGCTTTCTGCGCCAAGAGAATCGTCGACATTGATCAAAACCAAAAATTGGGCGGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCACGAAAGACGCGGTTCTCTTAGCAGCTGTAACTAGTTTTGGTTTTTAACCCGCCA / /// / /// // / / / / / | ||Hin6I | ||SalI || BclI | | | AciI | |GlaI | |AccI || MboI | | Hin4II* | HhaI | |TaqI |DpnI | TspEI MwoI | | BstKTI BsiYI* | Hpy166II PflMI | HindII Hpy99I HinfI TfiI F G A F C A K R I V D I D Q N Q K L G G L V L S A P R E S S T L I K T K N W A V W C F L R Q E N R R H * S K P K I G R Y ----:----|----:----|----:----|----:----|----:----|----:----| N P A K Q A L L I T S M S * F W F N P P M Q H K R R W S F R R C Q D F G F I P R K T S E A G L S D D V N I L V L F Q A T Hpy178III* | FatI | |CviAII | ||TspDTI | ||| NlaIII | ||| | FatI | ||| | |CviAII | ||| | || NlaIII OliI | ||| | || | TspDTI MslI CviRI* \ \\\ \ \\ \ \ \ \ ATGAAGGGTCTGGACATGAACCATGCCGAACACGATGTCGTTATTCACTCTGGTGCATAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCCCAGACCTGTACTTGGTACGGCTTGTGCTACAGCAATAAGTGAGACCACGTATG / / // / // / / / | | || | || TspDTI MslI CviRI* | | || | |FatI OliI | | || | CviAII | | || NlaIII | | |FatI | | CviAII | TspDTI | NlaIII Hpy178III* M K G L D M N H A E H D V V I H S G A Y * R V W T * T M P N T M S L F T L V H T E G S G H E P C R T R C R Y S L W C I R ----:----|----:----|----:----|----:----|----:----|----:----| I F P R S M F W A S C S T T I * E P A Y Y S P D P C S G H R V R H R * E S Q H M H L T Q V H V M G F V I D N N V R T C V HindII Hpy166II | FatI | AflIII | BspLU11I* | |CviAII | || TatI | || |NspI SgrAI | || |Csp6I BsrI Cfr10I | || |NlaIII | BseGI |HpaII | || ||RsaI BccI | |MseI \\ \ \\ \\\ \ \ \\ GCCGGTGTTGACAACATGTACTTTGCTGGTATGGAAGTTGCTGAACTGGATGGATTAAAC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCCACAACTGTTGTACATGAAACGACCATACCTTCAACGACTTGACCTACCTAATTTG // / / ///// / / / / / || | | ||||TatI | | | | Tsp4CI* || | | |||Csp6I | | | MseI || | | ||RsaI | | BseGI || | | |BspLU11I* | BsrI || | | |AflIII BccI || | | |FatI || | | CviAII || | NlaIII || | NspI || Hpy166II || HindII |Cfr10I |SgrAI HpaII A G V D N M Y F A G M E V A E L D G L N P V L T T C T L L V W K L L N W M D * T R C * Q H V L C W Y G S C * T G W I K P ----:----|----:----|----:----|----:----|----:----|----:----| A P T S L M Y K A P I S T A S S S P N F R R H Q C C T S Q Q Y P L Q Q V P H I L G T N V V H V K S T H F N S F Q I S * V FokI Tsp4CI* | AsuI* | AvaII | |NlaIV | |BmgT120I | || PflMI BseMII | || BsiYI* |FatI | || | EcoP15I |BspCNI | || | | AluI ||CviAII | || | | CviJI ||| TseI | || | | | SetI ||| NlaIII | || | | | | CviJI ||| |BisI | || | | | | | TspDTI ||| ||BlsI ApoI | || | | | | | | BbvI ||| ||| DdeI TspEI | || | | | | | | |MmeI ||| ||| EspI* | BbvI \ \\ \ \ \ \ \ \ \\ \\\ \\\ \ \ \ CGTATGGGTCCAACTTTTGGAGCTATGGCTTTGAGTGGTGTTCATGCTGCTGAGCAAATT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GCATACCCAGGTTGAAAACCTCGATACCGAAACTCACCACAAGTACGACGACTCGTTTAA / /// / /// // / / // / ///// / / | ||| BsiYI* ||CviJI || MmeI | || | ||||| EspI* TspEI | ||| PflMI ||AluI |TspDTI | || | ||||| DdeI ApoI | ||AvaII || CviJI | || | ||||TseI | ||AsuI* |EcoP15I | || | |||BisI | |BmgT120I SetI | || | ||BlsI | NlaIV | || | |FatI FokI | || | CviAII | || NlaIII | |BspCNI | BseMII BbvI R M G P T F G A M A L S G V H A A E Q I V W V Q L L E L W L * V V F M L L S K F Y G S N F W S Y G F E W C S C C * A N F ----:----|----:----|----:----|----:----|----:----|----:----| R I P G V K P A I A K L P T * A A S C I G Y P D L K Q L * P K S H H E H Q Q A F T H T W S K S S H S Q T T N M S S L L N TseI |BisI ||BlsI ||| DdeI \\\ \ TTGAAACACTTTGCTGCTTAG 970 980 ----:----|----:----|- AACTTTGTGAAACGACGAATC / /// / BbvI ||| DdeI ||TseI |BisI BlsI L K H F A A * * N T L L L X E T L C C L X ----:----|----:----|- K F C K A A * K S V S Q Q K Q F V K S S L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 6 BspACI,SsiI AflIII 1 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AluI 3 AluBI ApoI 2 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 1 BpuEI BceAI 1 BclI 1 FbaI,Ksp22I BdaI 2 BetI* 1 BsaWI BinI* 1 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmgT120I 3 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BspCNI 1 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrI 3 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 2 BtgZI 1 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 2 BstC8I Cfr10I 2 BsrFI,BssAI,Bse118I Csp6I 2 CviQI,RsaNI CviAII 9 CviJI 5 CviKI-1 CviRI* 5 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 2 MalI DraIII 1 AdeI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI EciI 1 Eco57I 1 AcuI Eco57MI 2 EcoNI 1 BstENI,XagI EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 9 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 1 GsuI 1 BpmI HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 3 HpyAV Hin6I 1 HinP1I,HspAI HindII 2 HincII HinfI 3 HpaII 2 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 3 Hpy99I 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeII 4 HpyCH4IV MaeIII 8 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MfeI 1 MunI MlyI 1 SchI MmeI 2 MnlI 2 MseI 6 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspI 2 BstNSI,XceI OliI 1 AleI PflMI 3 BasI,AccB7I,Van91I PleI 1 PpsI PshAI 1 BstPAI,BoxI RsaI 2 AfaI SalI 1 SapI 1 LguI,PciSI,BspQI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 16 SexAI 1 MabI SgrAI 1 SmlI 1 SmoI SphI 1 PaeI,BbuI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 2 TaqII 1 TatI 1 TauI 2 TfiI 2 PfeI TseI 2 ApeKI TsoI 2 Tsp45I 4 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 8 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BarI BbvCI BcgI BciVI BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BseRI BseSI BseYI BsgI BslFI BsmFI BsmI Bsp120I Bsp1407I BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstXI BstZ17I CauII* Cfr9I CfrI ClaI CspCI DinI DraII Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoRI EcoRV EcoT22I EgeI EheI Esp3I FalI FaqI FseI FspAI GsaI HaeII HaeIII HgaI HgiAI* HgiCI* Hin4I HindIII HpaI KasI KpnI MaeI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* PacI PasI PfoI PmaCI PmeI PpiI PpuMI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SanDI SauI* ScaI SfaNI SfeI* SfiI SfoI SgfI SgrDI SmaI SnaBI SpeI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769