Restriction Map of CBF2/YGR140W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CBF2/YGR140W on chromosome VII from coordinates 767429 to 770299.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.19146

MboI | DpnI | |BstKTI | || TaqI TspDTI | || ClaI TspEI TspEI | BseGI FokI \ \\ \ \ \ \ \ \ ATGAGATCATCGATTTTGTTTCTACTAAAATTGATGAAAATTATGGATGTTCAGCAACAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCTAGTAGCTAAAACAAAGATGATTTTAACTACTTTTAATACCTACAAGTCGTTGTC // / / / / / / || | ClaI TspEI | | BseGI || | TaqI | TspDTI || MboI TspEI |DpnI BstKTI M R S S I L F L L K L M K I M D V Q Q Q * D H R F C F Y * N * * K L W M F S N S E I I D F V S T K I D E N Y G C S A T A ----:----|----:----|----:----|----:----|----:----|----:----| X L D D I K N R S F N I F I I S T * C C X S I M S K T E V L I S S F * P H E A V H S * R N Q K * * F Q H F N H I N L L L SetI | MboII | Hpy178III* | | AlwNI | | |MlyI | | |PleI AluI | | || BsrI CviJI | | || |Hpy166II | SetI Hpy188I | | || ||HinfI CviJI \ \ \ \ \ \\ \\\ \ CAAGAAGCTATGTCATCAGAAGATAGGTTTCAGGAACTGGTGGACTCCCTAAAGCCAAGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTCGATACAGTAGTCTTCTATCCAAAGTCCTTGACCACCTGAGGGATTTCGGTTCT / / / / / / / /// / / / | | CviJI | SetI | | ||| | HinfI CviJI | | AluI Hpy188I | | ||| Hpy166II | SetI | | ||BsrI FokI | | |PleI | | MlyI | Hpy178III* | AlwNI MboII Q E A M S S E D R F Q E L V D S L K P R K K L C H Q K I G F R N W W T P * S Q E R S Y V I R R * V S G T G G L P K A K N ----:----|----:----|----:----|----:----|----:----|----:----| C S A I D D S S L N * S S T S E R F G L A L L * T M L L Y T E P V P P S G L A L L F S H * * F I P K L F Q H V G * L W S Hin6I TatI DdeI |GlaI |Csp6I | TatI AluI |MstI* ||RsaI | |Csp6I CviJI ||HhaI ||| SfaNI SetI | ||RsaI | SetI TspEI \\\ \\\ \ \ \ \\\ \ \ \ ACTGCGCATCAGTACAAGACCTACTATACTAAGTACATACAATGGTGTCAGCTCAATCAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TGACGCGTAGTCATGTTCTGGATGATATGATTCATGTATGTTACCACAGTCGAGTTAGTT /// /// // / /// / / ||Hin6I ||| |SfaNI | ||TatI | CviJI |MstI* ||| SetI | |Csp6I | AluI |GlaI ||TatI | RsaI SetI HhaI |Csp6I DdeI RsaI T A H Q Y K T Y Y T K Y I Q W C Q L N Q L R I S T R P T I L S T Y N G V S S I K C A S V Q D L L Y * V H T M V S A Q S N ----:----|----:----|----:----|----:----|----:----|----:----| V A C * Y L V * * V L Y M C H H * S L * F Q A D T C S R S Y * T C V I T D A * D S R M L V L G V I S L V Y L P T L E I L MnlI TspEI | BetI* |BslFI | |HpaII || HgaI EcoP15I SetI BspMI \ \\ \\ \ \ \ \ ATTATACCGACACCGGAGGACAATTCTGTAAATAGCGTCCCCTATAAAGACCTGCCAATA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAATATGGCTGTGGCCTCCTGTTAAGACATTTATCGCAGGGGATATTTCTGGACGGTTAT / / // // / / / / | MnlI |BetI* || HgaI EcoP15I SetI BaeI TspEI HpaII |BslFI TspEI I I P T P E D N S V N S V P Y K D L P I L Y R H R R T I L * I A S P I K T C Q Y Y T D T G G Q F C K * R P L * R P A N I ----:----|----:----|----:----|----:----|----:----|----:----| I I G V G S S L E T F L T G * L S R G I F * V S V P P C N Q L Y R G R Y L G A L N Y R C R L V I R Y I A D G I F V Q W Y BssKI CviJI MseI EcoRII VspI | ScrFI BaeI BaeI | BseBI \ \ \ \ TCTGCTGAACTGATACATTGGTTTTTGTTAGATACATTAATAACCGATGATAAGCCTGGA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGACGACTTGACTATGTAACCAAAAACAATCTATGTAATTATTGGCTACTATTCGGACCT / / / / / / BspMI BaeI VspI | | EcoRII MseI | | BssKI | BseBI | ScrFI CviJI S A E L I H W F L L D T L I T D D K P G L L N * Y I G F C * I H * * P M I S L E C * T D T L V F V R Y I N N R * * A W R ----:----|----:----|----:----|----:----|----:----|----:----| D A S S I C Q N K N S V N I V S S L G P I Q Q V S V N T K T L Y M L L R H Y A Q R S F Q Y M P K Q * I C * Y G I I L R S GsuI Eco57MI | MboI | BglII | XhoII | |MboII | ||DpnI | |||MnlI | |||BstKTI | ||||Hpy178III* | ||||| MnlI | ||||| | MnlI | ||||| | |MboII | ||||| | || TspDTI | ||||| | || | Hin4I | ||||| | || | Hin4I | ||||| | || | Eco57I | ||||| | || | Eco57MI | ||||| | || | | ApoI | ||||| | || | | TspEI | ||||| | || | | EcoRI | ||||| | || | | | XmnI | ||||| | || | | | BseRI | ||||| | || | | | | BseRI | ||||| | || | | | | | Hpy178III* Ksp632I* | ||||| | || | | | | | |BseRI |Hin4I | ||||| | || | | | | | ||MboI |Hin4I | ||||| | || | | | | | ||| DpnI ||BsmAI | ||||| | || | | | | | ||| |BstKTI \\\ \ \\\\\ \ \\ \ \ \ \ \ \\\ \\ GAGAAAAGAGAAGAGACTGAAGATCTTGATGAGGAGGAGGAGAATTCATTCAAGATCGCT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTTTCTCTTCTCTGACTTCTAGAACTACTCCTCCTCCTCTTAAGTAAGTTCTAGCGA / / / / /// /// // / / / // / /// / / Hin4I | | | ||| ||| || | Eco57MI | || | ||| | TaiI Hin4I | | | ||| ||| || | Eco57I | || | ||| | SetI | | | ||| ||| || TspDTI | || | ||| MboI | | | ||| ||| || Hin4I | || | ||DpnI | | | ||| ||| || Hin4I | || | |BstKTI | | | ||| ||| |MboII | || | Hpy178III* | | | ||| ||| MnlI | || BseRI | | | ||| ||Hpy178III* | |BseRI | | | ||| |MnlI | EcoRI | | | ||| XhoII | TspEI | | | ||| BglII | XmnI | | | ||| MboI | ApoI | | | ||DpnI BseRI | | | ||MnlI | | | |BstKTI | | | MboII | | Eco57MI | | GsuI | BsmAI Ksp632I* E K R E E T E D L D E E E E N S F K I A R K E K R L K I L M R R R R I H S R S L E K R R D * R S * * G G G E F I Q D R Y ----:----|----:----|----:----|----:----|----:----|----:----| S F L S S V S S R S S S S S F E N L I A L S F L L S Q L D Q H P P P S N M * S R L F S F L S F I K I L L L L I * E L D S FatI BspHI MaeII TspEI |CviAII | SetI TspEI | TspDTI |Hpy178III* | TaiI TspEI MboII |BsmAI | | CviRI* || NlaIII \ \ \ \ \\ \ \ \ \\ \ ACGTTGAAGAAAATTATAGGCAGTCTCAATTTTTTGTCAAAATTGTGCAAAGTTCATGAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGCAACTTCTTTTAATATCCGTCAGAGTTAAAAAACAGTTTTAACACGTTTCAAGTACTT / / / // / / / / // MaeII | MboII |BsmAI | | CviRI* | |BspHI TspEI TspEI | TspEI | |FatI TspDTI | Hpy178III* | CviAII NlaIII T L K K I I G S L N F L S K L C K V H E R * R K L * A V S I F C Q N C A K F M K V E E N Y R Q S Q F F V K I V Q S S * K ----:----|----:----|----:----|----:----|----:----|----:----| V N F F I I P L R L K K D F N H L T * S * T S S F * L C D * N K T L I T C L E H R Q L F N Y A T E I K Q * F Q A F N M F BssKI EcoRII | ScrFI | BseBI | |SetI | ||HphI | |||HinfI | |||| MaeIII | |||| Tsp45I | |||| |TspDTI | |||| || PleI | |||| || |MlyI | |||| || || HindIII | |||| || || | AluI | |||| || || | CviJI | |||| || || | | SetI | |||| || || | | | GsuI TspDTI | |||| || || | | | Eco57MI \ \ \\\\ \\ \\ \ \ \ \ AATCCAAATGCTAATATAGACACAAAATACCTGGAGTCAGTCACCAAGCTTCATACCCAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGGTTTACGATTATATCTGTGTTTTATGGACCTCAGTCAGTGGTTCGAAGTATGGGTA / / / / // // / / / TspDTI | | | || || | | Eco57MI | | | || || | | HindIII | | | || || | | GsuI | | | || || | CviJI | | | || || | AluI | | | || || SetI | | | || |Tsp45I | | | || |MaeIII | | | || PleI | | | || MlyI | | | |TspDTI | | | HinfI | | EcoRII | | BssKI | BseBI | ScrFI | HphI SetI N P N A N I D T K Y L E S V T K L H T H I Q M L I * T Q N T W S Q S P S F I P I S K C * Y R H K I P G V S H Q A S Y P L ----:----|----:----|----:----|----:----|----:----|----:----| F G F A L I S V F Y R S D T V L S * V W F D L H * Y L C L I G P T L * W A E Y G I W I S I Y V C F V Q L * D G L K M G M TspDTI TfiI | SmlI HinfI HphI Bce83I* | | CspCI \ \ \ \ \ \ TGGATAGATTCACAAAAGGCAATCACCACTAATGAAACAAATAACACAAATACTCAAGTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTATCTAAGTGTTTTCCGTTAGTGGTGATTACTTTGTTTATTGTGTTTATGAGTTCAC / / / / / / | HphI Bce83I* TspDTI | SmlI HinfI CspCI TfiI W I D S Q K A I T T N E T N N T N T Q V G * I H K R Q S P L M K Q I T Q I L K C D R F T K G N H H * * N K * H K Y S S A ----:----|----:----|----:----|----:----|----:----|----:----| Q I S E C F A I V V L S V F L V F V * T N S L N V F P L * W * H F L Y C L Y E L P Y I * L L C D G S I F C I V C I S L H ApoI TspEI BseMII Hpy166II |CspCI NlaIV |BspCNI \ \\ \ \\ CTGTGTCCACCATTATTGAAAGTGTCTTTGAATTTATGGAACCCAGAAACTAACCATCTC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GACACAGGTGGTAATAACTTTCACAGAAACTTAAATACCTTGGGTCTTTGATTGGTAGAG / / / / // Hpy166II | TspEI NlaIV |BspCNI | ApoI BseMII CspCI L C P P L L K V S L N L W N P E T N H L C V H H Y * K C L * I Y G T Q K L T I S V S T I I E S V F E F M E P R N * P S L ----:----|----:----|----:----|----:----|----:----|----:----| S H G G N N F T D K F K H F G S V L W R A T D V M I S L T K S N I S G L F * G D Q T W W * Q F H R Q I * P V W F S V M E Hpy188I | TspEI | | MseI DdeI | | | TfiI BccI | | | HinfI |Hpy188I | | | | BssKI || ApoI MseI | | | | EcoRII || TsoI |AhaIII* | | | | | ScrFI TspEI || TspEI || SetI | | | | | BseBI | MseI \\ \ \\ \ \ \ \ \ \ \ \ \ TCTGAGAAATTTTTTAAAACCTGTTCTGAAAAATTAAGATTCCTGGTGGATTTTCAATTA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTCTTTAAAAAATTTTGGACAAGACTTTTTAATTCTAAGGACCACCTAAAAGTTAAT // / / // / / // / / / // || TsoI | || SetI Hpy188I |MseI | | EcoRII |MseI || DdeI | |MseI TspEI | | BssKI TspEI |BccI | AhaIII* | BseBI Hpy188I TspEI | ScrFI ApoI HinfI TfiI S E K F F K T C S E K L R F L V D F Q L L R N F L K P V L K N * D S W W I F N * * E I F * N L F * K I K I P G G F S I K ----:----|----:----|----:----|----:----|----:----|----:----| E S F N K L V Q E S F N L N R T S K * N R Q S I K * F R N Q F I L I G P P N E I R L F K K F G T R F F * S E Q H I K L * MboI | DpnI | |BstKTI | || MboII NlaIV AluI TspDTI SetI | || | Bce83I* | SmlI CviJI \ \ \ \\ \ \ \ \ \ AGAAGTTATTTGAACCTTTCATTTGAAGAAAGATCAAAGATACGATTTGGTTCCCTCAAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTCAATAAACTTGGAAAGTAAACTTCTTTCTAGTTTCTATGCTAAACCAAGGGAGTTC / / // // / / /// TspDTI SetI || || Bce83I* NlaIV ||CviJI || |MboII ||AluI || MboI |SmlI |DpnI SetI BstKTI R S Y L N L S F E E R S K I R F G S L K E V I * T F H L K K D Q R Y D L V P S S K L F E P F I * R K I K D T I W F P Q A ----:----|----:----|----:----|----:----|----:----|----:----| L L * K F R E N S S L D F I R N P E R L L F N N S G K M Q L F I L S V I Q N G * S T I Q V K * K F F S * L Y S K T G E L BslFI SetI Esp3I |TspEI | MnlI BsmAI || HgaI MaeIII AciI \ \ \ \\ \ \ \ CTCGGTAAAAGGGACAGAGACGCTATAATTTATCATAAAGTAACTCATTCGGCGGAAAAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GAGCCATTTTCCCTGTCTCTGCGATATTAAATAGTATTTCATTGAGTAAGCCGCCTTTTT / / // / / / MnlI BsmAI || HgaI MaeIII AciI Esp3I |TspEI BslFI L G K R D R D A I I Y H K V T H S A E K S V K G T E T L * F I I K * L I R R K K R * K G Q R R Y N L S * S N S F G G K K ----:----|----:----|----:----|----:----|----:----|----:----| S P L L S L S A I I * * L T V * E A S F A R Y F P C L R * L K D Y L L E N P P F E T F P V S V S Y N I M F Y S M R R F F EciI | BssKI | |HpaII | ||ScrFI | ||CauII* | |||AsuI* | ||||BmgT120I | |||||CviJI | |||||HaeIII BccI CviRI* \ \\\\\\ \ \ AAAGATACGCCGGGCCACCATCAACTCCTTGCATTATTACCCCAAGATTGTCCATTTATC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTATGCGGCCCGGTGGTAGTTGAGGAACGTAATAATGGGGTTCTAACAGGTAAATAG / / // / / EciI | |AsuI* | CviRI* | BmgT120I BccI | HaeIII | BssKI | CviJI CauII* HpaII ScrFI K D T P G H H Q L L A L L P Q D C P F I K I R R A T I N S L H Y Y P K I V H L S R Y A G P P S T P C I I T P R L S I Y L ----:----|----:----|----:----|----:----|----:----|----:----| F S V G P W W * S R A N N G W S Q G N I F L Y A P G G D V G Q M I V G L N D M * F I R R A V M L E K C * * G L I T W K D TseI AluI CviJI |BisI ||BlsI AccI ||SetI |BssNAI |||PsrI |Hpy166II BbvI MnlI |||CviRI* MseI SetI || PsrI BccI \ \ \\\\ \ \ \\ \ \ TGCCCTCAAACTACATTAGCTGCATATTTGTATTTAAGGTTCTATGGTATACCATCTGTT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| ACGGGAGTTTGATGTAATCGACGTATAAACATAAATTCCAAGATACCATATGGTAGACAA / / / //// / // | | | |||CviRI* MseI |AccI | | | |||TseI SetI Hpy166II | | | ||BisI BssNAI | | | |BlsI PsrI | | | CviJI | | | AluI | | SetI | | PsrI | MnlI BbvI C P Q T T L A A Y L Y L R F Y G I P S V A L K L H * L H I C I * G S M V Y H L F P S N Y I S C I F V F K V L W Y T I C F ----:----|----:----|----:----|----:----|----:----|----:----| Q G * V V N A A Y K Y K L N * P I G D T R G E F * M L Q M N T N L T R H Y V M Q A R L S C * S C I Q I * P E I T Y W R N TaqI AsuII CviJI TspEI | BccI |BseGI |FokI CviJI TspDTI \ \ \\ \\ \ \ TCGAAAGGGGATGGCTTTCCCAATTTGAACGCTGATGAAAATGGCTCACTTTTACAAGAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTTTCCCCTACCGAAAGGGTTAAACTTGCGACTACTTTTACCGAGTGAAAATGTTCTA / / / // // / / | | BccI |CviJI |FokI | TspDTI | AsuII BseGI TspEI CviJI | TaqI BccI S K G D G F P N L N A D E N G S L L Q D R K G M A F P I * T L M K M A H F Y K I E R G W L S Q F E R * * K W L T F T R Y ----:----|----:----|----:----|----:----|----:----|----:----| E F P S P K G L K F A S S F P E S K C S K S L P H S E W N S R Q H F H S V K V L R F P I A K G I Q V S I F I A * K * L I MnlI Hin4I Hin4I | DdeI Hin4I TspRI MnlI Hin4I TspEI \ \ \ \ \ \ \ ATTCCCATACTAAGAGGCAAATCACTGACAACTTATCCCAGAGAGGAAACATTTAGTAAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGGTATGATTCTCCGTTTAGTGACTGTTGAATAGGGTCTCTCCTTTGTAAATCATTA / / / / / MnlI Hin4I TspRI MnlI Hin4I Hin4I Hin4I DdeI I P I L R G K S L T T Y P R E E T F S N F P Y * E A N H * Q L I P E R K H L V I S H T K R Q I T D N L S Q R G N I * * L ----:----|----:----|----:----|----:----|----:----|----:----| I G M S L P L D S V V * G L S S V N L L Y E W V L L C I V S L K D W L P F M * Y N G Y * S A F * Q C S I G S L F C K T I Tsp4CI* SetI | BsiYI* | PsiI SspI | | SetI | |Ksp632I* | MboII \ \ \ \ \\ \ \ TATTATACAACCGTGTTTAGGTATTGCCACTTACCTTATAAAAGAAGAGAATATTTCAAC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| ATAATATGTTGGCACAAATCCATAACGGTGAATGGAATATTTTCTTCTCTTATAAAGTTG / / / / / / / / / TspEI | | SetI SetI | Ksp632I* | MboII | BsiYI* PsiI SspI Tsp4CI* Y Y T T V F R Y C H L P Y K R R E Y F N I I Q P C L G I A T Y L I K E E N I S T L Y N R V * V L P L T L * K K R I F Q Q ----:----|----:----|----:----|----:----|----:----|----:----| * * V V T N L Y Q W K G * L L L S Y K L N N Y L R T * T N G S V K Y F F L I N * I I C G H K P I A V * R I F S S F I E V BseGI | BbvII* | | FokI SetI | | | MboII MaeIII | Hpy166II BsiYI* | | | |TspDTI \ \ \ \ \ \ \ \\ AAATGTAACCTTGTTTACCCAACTTGGGATGAAGACACTTTTAGAACATTTTTCAATGAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTTACATTGGAACAAATGGGTTGAACCCTACTTCTGTGAAAATCTTGTAAAAAGTTACTT / / / / / / / | | | BsiYI* BseGI | FokI | | Hpy166II TspDTI | MaeIII BbvII* SetI MboII K C N L V Y P T W D E D T F R T F F N E N V T L F T Q L G M K T L L E H F S M K M * P C L P N L G * R H F * N I F Q * R ----:----|----:----|----:----|----:----|----:----|----:----| L H L R T * G V Q S S S V K L V N K L S C I Y G Q K G L K P H L C K * F M K * H F T V K N V W S P I F V S K S C K E I F TsoI FatI NcoI StyI SecI* DsaI* DdeI |CviAII SauI* || MboII |SetI || NlaIII BseMII || StuI || |TspDTI |BspCNI || CviJI || ||TspEI || MnlI || HaeIII Tsp4CI* \\ \\\ \\ \ \\ \ \ GAAAACCATGGAAATTGGTTAGAACAACCTGAGGCCTTTGCGTTCCCTGACAAAATACCG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTGGTACCTTTAACCAATCTTGTTGGACTCCGGAAACGCAAGGGACTGTTTTATGGC / / // / // / / / / / | | |DsaI* | || | SetI | HaeIII Tsp4CI* | | |SecI* | || MnlI | CviJI | | |StyI | |BspCNI | StuI | | |NcoI | BseMII SauI* | | |FatI TspEI DdeI | | TspDTI | | CviAII | | MboII | NlaIII TsoI E N H G N W L E Q P E A F A F P D K I P K T M E I G * N N L R P L R S L T K Y R K P W K L V R T T * G L C V P * Q N T V ----:----|----:----|----:----|----:----|----:----|----:----| S F W P F Q N S C G S A K A N G S L I G L F G H F N T L V V Q P R Q T G Q C F V F V M S I P * F L R L G K R E R V F Y R Hpy178III* | FatI | BspHI | |CviAII | |Hpy178III* TaqI | || NlaIII TspDTI \ \ \\ \ \ TTCGACTTCAAGAAAATCATGAACTTCAAATCGCCCTACACTTCGTATTCTACAAACGCT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTGAAGTTCTTTTAGTACTTGAAGTTTAGCGGGATGTGAAGCATAAGATGTTTGCGA / / / // / TaqI | | |BspHI TspDTI | | |FatI | | Hpy178III* | | CviAII | NlaIII Hpy178III* F D F K K I M N F K S P Y T S Y S T N A S T S R K S * T S N R P T L R I L Q T L R L Q E N H E L Q I A L H F V F Y K R * ----:----|----:----|----:----|----:----|----:----|----:----| N S K L F I M F K L D G * V E Y E V F A T R S * S F * S S * I A R C K T N * L R E V E L F D H V E F R G V S R I R C V S EciI |AsuI* |AvaII SspI |DraII | BetI* |PpuMI | BspMII* ||BmgT120I | |HpaII |||NlaIV AciI MnlI | |Hpy178III* \\\\ \ \ \ \\ AAAAAGGACCCTTTTCCGCCTCCAAAGGATTTATTAGTTCAAATATTTCCGGAGATTGAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTCCTGGGAAAAGGCGGAGGTTTCCTAAATAATCAAGTTTATAAAGGCCTCTAACTA / // / / / // EciI |PpuMI AciI MnlI SspI |BspMII* |DraII |BetI* |AvaII Hpy178III* |AsuI* HpaII BmgT120I NlaIV K K D P F P P P K D L L V Q I F P E I D K R T L F R L Q R I Y * F K Y F R R L M K G P F S A S K G F I S S N I S G D * * ----:----|----:----|----:----|----:----|----:----|----:----| L F S G K G G G F S K N T * I N G S I S * F P G K E A E L P N I L E F I E P S Q F L V R K R R W L I * * N L Y K R L N I DdeI FatI | BsmAI BspCNI |CviAII | TspDTI |BseMII ||TspDTI | Hpy188I || XbaI ||| NlaIII | |ApoI || |MaeI ||| Hin4II* | |TspEI || |Hpy178III* ||| |MslI SetI | |EcoRI || || MseI \\\ \\ \ \ \\ \\ \\ \ GAATATAAAAGACATGATTATGAAGGTTTGTCTCAGAATTCAAGGGATTTTCTAGATTTA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTTATATTTTCTGTACTAATACTTCCAAACAGAGTCTTAAGTTCCCTAAAAGATCTAAAT / /// / /// // // // / | ||MslI SetI ||| || |BseMII |XbaI MseI | |FatI ||| || BspCNI Hpy178III* | Hin4II* ||| |EcoRI MaeI | CviAII ||| |TspEI TspDTI ||| |ApoI NlaIII ||| BsmAI ||DdeI |Hpy188I TspDTI E Y K R H D Y E G L S Q N S R D F L D L N I K D M I M K V C L R I Q G I F * I * I * K T * L * R F V S E F K G F S R F N ----:----|----:----|----:----|----:----|----:----|----:----| S Y L L C S * S P K D * F E L S K R S K H I Y F V H N H L N T E S N L P N E L N F I F S M I I F T Q R L I * P I K * I * FatI NcoI StyI SecI* DsaI* |CviAII ApoI || NlaIII TspEI \\ \ \ ATGGAAGTTTTACGAGAAAGATTTTTGAGCAATCTACCATGGATTTACAAATTCTTTCCT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTCAAAATGCTCTTTCTAAAAACTCGTTAGATGGTACCTAAATGTTTAAGAAAGGA / // / | |DsaI* TspEI | |SecI* ApoI | |StyI | |NcoI | |FatI | CviAII NlaIII M E V L R E R F L S N L P W I Y K F F P W K F Y E K D F * A I Y H G F T N S F L G S F T R K I F E Q S T M D L Q I L S * ----:----|----:----|----:----|----:----|----:----|----:----| I S T K R S L N K L L R G H I * L N K G L P L K V L F I K S C D V M S K C I R E H F N * S F S K Q A I * W P N V F E K R FatI BspHI |CviAII |Hpy178III* || PfoI || BssKI || EcoRII || | ScrFI || | BseBI || | | AsuI* || | | AvaII BsiYI* || | | DraII | Hin4I || | | PpuMI | Hin4I || | | |BmgT120I | | ApoI || NlaIII | | ||NlaIV | | TspEI Hpy188I \\ \ \ \ \\\ \ \ \ \ AATCATGATATATTCCAGGACCCCATTTTTGGAAATTCCGATTTTCAATCATACTTCAAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTACTATATAAGGTCCTGGGGTAAAAACCTTTAAGGCTAAAAGTTAGTATGAAGTTA / // / /// // // / | |BspHI | ||| |Hin4I |Hpy188I Hin4I | |FatI | ||| |Hin4I TspEI Hin4I | Hpy178III* | ||| BsiYI* ApoI | CviAII | ||PpuMI NlaIII | ||DraII | ||AvaII | ||AsuI* | |BmgT120I | |NlaIV | EcoRII | BssKI | PfoI BseBI ScrFI N H D I F Q D P I F G N S D F Q S Y F N I M I Y S R T P F L E I P I F N H T S M S * Y I P G P H F W K F R F S I I L Q * ----:----|----:----|----:----|----:----|----:----|----:----| L * S I N W S G M K P F E S K * D Y K L * D H Y I G P G W K Q F N R N E I M S * I M I Y E L V G N K S I G I K L * V E I BssKI EcoRII | ScrFI | BseBI Hin4I TaqI | | CviJI Hin4I HphI Hpy166II |TaqII | | | MseI \ \ \ \\ \ \ \ \ GACAAAACTATACATTCAAAGGGTTCACCCATTTTATCATTCGATATACTACCAGGCTTT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTTTGATATGTAAGTTTCCCAAGTGGGTAAAATAGTAAGCTATATGATGGTCCGAAA / / / / / / HphI Hpy166II | TaqI | EcoRII TaqII | BssKI | CviJI BseBI ScrFI D K T I H S K G S P I L S F D I L P G F T K L Y I Q R V H P F Y H S I Y Y Q A L Q N Y T F K G F T H F I I R Y T T R L * ----:----|----:----|----:----|----:----|----:----|----:----| S L V I C E F P E G M K D N S I S G P K H C F * V N L P N V W K I M R Y V V L S V F S Y M * L T * G N * * E I Y * W A K StuI ApoI CviJI TspEI MseI HaeIII \ \ \ AATAAAATCTATAAGAATAAGACAAATTTTTACTCACTCTTAATAGAAAGGCCTTCGCAG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTTAGATATTCTTATTCTGTTTAAAAATGAGTGAGAATTATCTTTCCGGAAGCGTC / / / / MseI TspEI MseI HaeIII ApoI CviJI StuI N K I Y K N K T N F Y S L L I E R P S Q I K S I R I R Q I F T H S * * K G L R S * N L * E * D K F L L T L N R K A F A V ----:----|----:----|----:----|----:----|----:----|----:----| L L I * L F L V F K * E S K I S L G E C * Y F R Y S Y S L N K S V R L L F A K A I F D I L I L C I K V * E * Y F P R R L BseMII |BspCNI || MnlI HindII || |TfiI Hin4II* PleI || |HinfI Hpy166II TaqI |MlyI || || DdeI | Hin4I | HinfI ||Hpy178III* Hin4I || || |Hpy188I \ \ \ \ \\\ \ \\ \\ \\ TTGACATTTGCTTCGAGTCATAATCCAGATACACACCCCACTCAAAAACAAGAATCTGAG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGTAAACGAAGCTCAGTATTAGGTCTATGTGTGGGGTGAGTTTTTGTTCTTAGACTC // / / / / / // / // / |Hpy166II | HinfI | | Hin4I || MnlI || DdeI |HindII TaqI | Hpy178III* |BspCNI |Hpy188I Hin4II* PleI BseMII HinfI Hin4I MlyI TfiI L T F A S S H N P D T H P T Q K Q E S E * H L L R V I I Q I H T P L K N K N L R D I C F E S * S R Y T P H S K T R I * G ----:----|----:----|----:----|----:----|----:----|----:----| N V N A E L * L G S V C G V * F C S D S T S M Q K S D Y D L Y V G W E F V L I Q Q C K S R T M I W I C V G S L F L F R L AsuI* HinfI |NlaIV | HindII |BmgT120I | Hpy166II ||CviJI | | PleI TspEI ||HaeIII | | |MlyI | MseI TspEI TspDTI \\\ \ \ \\ \ \ \ \ GGGCCATTACAAATGAGTCAACTTGATACTACACAATTAAATGAATTATTGAAGCAACAG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CCCGGTAATGTTTACTCAGTTGAACTATGATGTGTTAATTTACTTAATAACTTCGTTGTC /// // / // / / ||AsuI* || PleI |MseI TspEI TspDTI |BmgT120I || MlyI TspEI |HaeIII |Hpy166II |CviJI |HindII NlaIV HinfI G P L Q M S Q L D T T Q L N E L L K Q Q G H Y K * V N L I L H N * M N Y * S N R A I T N E S T * Y Y T I K * I I E A T E ----:----|----:----|----:----|----:----|----:----|----:----| P G N C I L * S S V V C N F S N N F C C P A M V F S D V Q Y * V I L H I I S A V P W * L H T L K I S C L * I F * Q L L L TaqI TspEI ApoI AsuII CviRI* |BsgI TspEI \ \ \\ \ AGTTTCGAATATGTGCAGTTCCAAACACTTTCTAATTTCCAAATTTTATTATCGGTATTC 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAAGCTTATACACGTCAAGGTTTGTGAAAGATTAAAGGTTTAAAATAATAGCCATAAG / / / / / AsuII CviRI* BsgI TspEI TspEI TaqI ApoI S F E Y V Q F Q T L S N F Q I L L S V F V S N M C S S K H F L I S K F Y Y R Y S F R I C A V P N T F * F P N F I I G I Q ----:----|----:----|----:----|----:----|----:----|----:----| L K S Y T C N W V S E L K W I K N D T N S N R I H A T G F V K * N G F K I I P I T E F I H L E L C K R I E L N * * R Y E MnlI | Hpy178III* ApoI | | TspDTI AluI TspEI TspEI MboII | | | CviJI CviJI \ \ \ \ \ \ \ \ AATAAAATTTTTGAGAAATTGGAGATGAAAAAATCTTCAAGAGGCTATATTTTACATCAG 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTTTAAAAACTCTTTAACCTCTACTTTTTTAGAAGTTCTCCGATATAAAATGTAGTC / / / / / / / / / TspEI | MboII MnlI | | CviJI | CviJI ApoI TspEI | Hpy178III* | AluI TspDTI SetI N K I F E K L E M K K S S R G Y I L H Q I K F L R N W R * K N L Q E A I F Y I S * N F * E I G D E K I F K R L Y F T S A ----:----|----:----|----:----|----:----|----:----|----:----| L L I K S F N S I F F D E L P * I K C * * Y F K Q S I P S S F I K L L S Y K V D I F N K L F Q L H F F R * S A I N * M L BseGI | TspEI | | MseI | | | FokI MseI StyI | | | | TspDTI SetI SecI* | | | | | DdeI |TspEI TspEI | SetI | | | | | |SfaNI \\ \ \ \ \ \ \ \ \ \\ CTTAATTTATTCAAAATTACCTTGGATGAAAGAATTAAGAAATCTAAGATTGACGATGCC 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| GAATTAAATAAGTTTTAATGGAACCTACTTTCTTAATTCTTTAGATTCTAACTGCTACGG / / / / / // / / / / | TspEI TspEI | BseGI || | FokI | SfaNI MseI SetI SecI* || TspDTI DdeI StyI |MseI TspEI L N L F K I T L D E R I K K S K I D D A L I Y S K L P W M K E L R N L R L T M P * F I Q N Y L G * K N * E I * D * R C R ----:----|----:----|----:----|----:----|----:----|----:----| S L K N L I V K S S L I L F D L I S S A A * N I * F * R P H F F * S I * S Q R H K I * E F N G Q I F S N L F R L N V I G MaeII |BsaAI ApoI || SetI CviJI MboII TspEI || TaiI | MseI | BccI \ \\ \ \ \ \ \ GATAAATTTATACGTGATAATCAGCCCATTAAAAAAGAAGAAAACATTGTGAATGAAGAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTAAATATGCACTATTAGTCGGGTAATTTTTTCTTCTTTTGTAACACTTACTTCTA / / // / / / / | | |MaeII CviJI MseI | BccI | | BsaAI MboII | TaiI | SetI TspEI ApoI D K F I R D N Q P I K K E E N I V N E D I N L Y V I I S P L K K K K T L * M K M * I Y T * * S A H * K R R K H C E * R W ----:----|----:----|----:----|----:----|----:----|----:----| S L N I R S L * G M L F S S F M T F S S R Y I * V H Y D A W * F L L F C Q S H L I F K Y T I I L G N F F F F V N H I F I AsuI* |BmgT120I ||CviJI ||HaeIII CviJI MfeI ||| MboII AciI HaeIII TspEI ||| |TspDTI | MnlI | EciI TspEI | AciI \\\ \\ \ \ \ \ \ \ \ GGGCCTAACACATCAAGGCGGACAAAGAGGCCGAAGCAAATTAGATTACTCTCAATTGCG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CCCGGATTGTGTAGTTCCGCCTGTTTCTCCGGCTTCGTTTAATCTAATGAGAGTTAACGC // / // // / /// / || TspDTI |AciI |EciI TspEI ||| AciI || MboII MnlI HaeIII ||BsaXI |AsuI* CviJI |TspEI BmgT120I |MfeI HaeIII Hin4I CviJI G P N T S R R T K R P K Q I R L L S I A G L T H Q G G Q R G R S K L D Y S Q L R A * H I K A D K E A E A N * I T L N C G ----:----|----:----|----:----|----:----|----:----|----:----| P G L V D L R V F L G F C I L N S E I A H A * C M L A S L S A S A F * I V R L Q P R V C * P P C L P R L L N S * E * N R MnlI Hpy188I |TfiI | TfiI |HinfI | HinfI || BsaXI | Hpy99I || |MmeI TfiI | | MnlI || ||Hin4I BsaXI | | | MnlI || ||| TspGWI Tsp4CI* Hin4I | | | | SecI* || ||| | Hin4I | TfiI HinfI | | | | DsaI* || ||| | Hin4I | HinfI \ \ \ \ \ \ \\ \\\ \ \ \ \ GATTCCTCCGACGAATCCTCCACGGAGGATTCAAATGTATTCAAAAAGGACGGTGAATCC 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGGAGGCTGCTTAGGAGGTGCCTCCTAAGTTTACATAAGTTTTTCCTGCCACTTAGG / / / // / / / // / / / | | | |MnlI | | | || TspGWI | HinfI | | | HinfI | | | || Hin4I | TfiI | | | TfiI | | | || Hin4I Tsp4CI* | | MnlI | | | |HinfI | Hpy188I | | | |TfiI | Hpy99I | | | MmeI HinfI | | Hin4I TfiI | | BsaXI | MnlI DsaI* SecI* D S S D E S S T E D S N V F K K D G E S I P P T N P P R R I Q M Y S K R T V N P F L R R I L H G G F K C I Q K G R * I H ----:----|----:----|----:----|----:----|----:----|----:----| S E E S S D E V S S E F T N L F S P S D P N R R R I R W P P N L H I * F P R H I I G G V F G G R L I * I Y E F L V T F G MlyI PleI BccI |BseMII |TaqI ||BspCNI || HphI ||| SfaNI || | BccI ||| | HinfI || | | Hin6I ||| | MboII || | | |GlaI ||| | |TspDTI || | | |Hin4I ||| | || DdeI || | | |Hin4I ||| | || |Hpy188I || | | ||HhaI ||| | || || CviRI* || | | ||| NdeI BplI ||| | || || | BplI || | | ||| |MboII BplI ||| | || || | BplI \\ \ \ \\\ \\ \ \\\ \ \\ \\ \ \ ATCGAAGATGGCGCATATGGAGAAAATGAAGATGAGAATGACTCTGAGATGCAAGAGCAG 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTTCTACCGCGTATACCTCTTTTACTTCTACTCTTACTGAGACTCTACGTTCTCGTC /// // /// / / / /// / /// / // ||| || ||| | | BplI ||| | ||| | |BplI ||| || ||| | | BplI ||| | ||| | |BplI ||| || ||| | NdeI ||| | ||| | CviRI* ||| || ||| MboII ||| | ||| DdeI ||| || ||Hin6I ||| | ||Hpy188I ||| || |GlaI ||| | |HinfI ||| || HhaI ||| | SfaNI ||| |BccI ||| TspDTI ||| Hin4I ||| MboII ||| Hin4I ||PleI ||TaqI |BspCNI |HphI |MlyI BccI BseMII I E D G A Y G E N E D E N D S E M Q E Q S K M A H M E K M K M R M T L R C K S S R R W R I W R K * R * E * L * D A R A V ----:----|----:----|----:----|----:----|----:----|----:----| M S S P A Y P S F S S S F S E S I C S C W R L H R M H L F H L H S H S Q S A L A D F I A C I S F I F I L I V R L H L L L AsuI* AvaII |NlaIV MseI PsiI |BmgT120I \ \ \\ TTAAAATCTATGATAAACGAACTTATAAACTCCAAAATAAGCACTTTTTTACGGGACCAA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTTAGATACTATTTGCTTGAATATTTGAGGTTTTATTCGTGAAAAAATGCCCTGGTT / / /// MseI PsiI ||AvaII ||AsuI* |BmgT120I NlaIV L K S M I N E L I N S K I S T F L R D Q * N L * * T N L * T P K * A L F Y G T K K I Y D K R T Y K L Q N K H F F T G P N ----:----|----:----|----:----|----:----|----:----|----:----| N F D I I F S S I F E L I L V K K R S W T L I * S L R V * L S W F L C K K V P G * F R H Y V F K Y V G F Y A S K * P V L MboI | DpnI | |BstKTI | ||TspEI | ||BslFI ApoI | ||| BinI* TspEI MaeIII | ||| | TspEI | Hpy178III* Tsp45I \ \\\ \ \ \ \ \ ATGGATCAATTTGAATTGAAAATAAACGCTTTATTAGATAAAATTCTTGAAGAAAAAGTC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTAGTTAAACTTAACTTTTATTTGCGAAATAATCTATTTTAAGAACTTCTTTTTCAG // / // / / / / || | || TspEI | Hpy178III* MboII || | |BinI* TspEI || | BslFI ApoI || | TspEI || MboI |DpnI BstKTI M D Q F E L K I N A L L D K I L E E K V W I N L N * K * T L Y * I K F L K K K S G S I * I E N K R F I R * N S * R K S H ----:----|----:----|----:----|----:----|----:----|----:----| I S * N S N F I F A K N S L I R S S F T F P D I Q I S F L R K I L Y F E Q L F L H I L K F Q F Y V S * * I F N K F F F D AclI MaeII Ksp632I* |MnlI || SetI CviJI MboII TaqI Hpy166II || TaiI HaeIII \ \ \ \\ \ \ ACTCGTATTATCGAGCAAAAACTTGGTTCACACACGGGGAAGTTTTCAACGTTGAAGAGG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGCATAATAGCTCGTTTTTGAACCAAGTGTGTGCCCCTTCAAAAGTTGCAACTTCTCC / / / // // / Tsp45I TaqI Hpy166II || || HaeIII MaeIII || || CviJI || |Ksp632I* || MaeII || AclI |MnlI TaiI SetI T R I I E Q K L G S H T G K F S T L K R L V L S S K N L V H T R G S F Q R * R G S Y Y R A K T W F T H G E V F N V E E A ----:----|----:----|----:----|----:----|----:----|----:----| V R I I S C F S P E C V P F N E V N F L * E Y * R A F V Q N V C P S T K L T S S S T N D L L F K T * V R P L K * R Q L P MboII | FatI | |MmeI | |CviAII | || AjuI MboII | || |NlaIII TspGWI AjuI \ \\ \\ \ \ CCACAACTATACATGACGGAAGAACACAATGTTGGATTTGATATGGAAGTTCCTAAAAAA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGTTGATATGTACTGCCTTCTTGTGTTACAACCTAAACTATACCTTCAAGGATTTTTT / /// // // / | ||| |FatI |MboII AjuI | ||| CviAII TspGWI | ||NlaIII | |MmeI | AjuI MboII P Q L Y M T E E H N V G F D M E V P K K H N Y T * R K N T M L D L I W K F L K N T T I H D G R T Q C W I * Y G S S * K T ----:----|----:----|----:----|----:----|----:----|----:----| G C S Y M V S S C L T P N S I S T G L F A V V I C S P L V C H Q I Q Y P L E * F W L * V H R F F V I N S K I H F N R F F CviJI DdeI MboI |FatI | AsuI* TspRI AlwNI BclI |BtgZI | AvaII | Csp6I | Tsp4CI* | DpnI ||CviAII | |BmgT120I | |RsaI | |BdaI | BsaBI ||| BceAI | || BsrI | |BsmAI | |BdaI | |BstKTI ||| NlaIII \ \\ \ \ \\ \ \\ \ \\ \\\ \ CTTAGGACCAGTGGTAAGTACGCAGAGACTGTGAAAGATAATGATGATCATCAAGCCATG 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GAATCCTGGTCACCATTCATGCGTCTCTGACACTTTCTATTACTACTAGTAGTTCGGTAC / /// // / / / // / // // | ||AvaII || | | Tsp4CI* || BclI || |BtgZI | ||AsuI* || | | BdaI || MboI || |FatI | |BmgT120I || | | BdaI |BsaBI || CviAII | TspRI || | AlwNI |DpnI |NlaIII | BsrI || BsmAI BstKTI CviJI DdeI |Csp6I RsaI L R T S G K Y A E T V K D N D D H Q A M L G P V V S T Q R L * K I M M I I K P C * D Q W * V R R D C E R * * * S S S H V ----:----|----:----|----:----|----:----|----:----|----:----| S L V L P L Y A S V T F S L S S * * A M V * S W H Y T R L S Q S L Y H H D D L W K P G T T L V C L S H F I I I I M L G H HindII Hpy166II | CviRI* | | BdaI | | BdaI | | |BseMII | | ||BspCNI | | ||| SfaNI | | ||| | Hpy178III* AluI | | ||| | |DdeI MboI BdaI | | ||| | |BsmAI | DpnI BdaI | BdaI | ||| | |Esp3I | |BstKTI CviJI | BdaI | ||| | |Bpu10I | ||Hpy178III* | SetI \ \ \ \\\ \ \\ \ \\\ \ \ TCAACTACTGCATCGCCGTCTCCTGAGCAAGATCAAGAAGCAAAGAGCTATACTGACGAA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTGATGACGTAGCGGCAGAGGACTCGTTCTAGTTCTTCGTTTCTCGATATGACTGCTT // //// // // // / / / / |BdaI |||BspCNI || || || | | | CviJI |BdaI ||BseMII || || || | | | AluI | |BdaI || || || | | BdaI | |BdaI || || || | | BdaI | CviRI* || || || | | SetI Hpy166II || || || | Hpy178III* HindII || || || MboI BceAI || || |DpnI || || BstKTI || |Esp3I || |BsmAI || Bpu10I || DdeI |Hpy178III* SfaNI S T T A S P S P E Q D Q E A K S Y T D E Q L L H R R L L S K I K K Q R A I L T N N Y C I A V S * A R S R S K E L Y * R T ----:----|----:----|----:----|----:----|----:----|----:----| D V V A D G D G S C S * S A F L * V S S T L * Q M A T E Q A L D L L L S S Y Q R * S S C R R R R L L I L F C L A I S V F ApoI TfiI Hpy178III* TspEI MnlI HinfI | HphI Hpy166II \ \ \ \ \ \ CAAGAATTTATGCTGGACAAATCCATAGACAGCATAGAGGGAATCATTCTTGAATGGTTC 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTAAATACGACCTGTTTAGGTATCTGTCGTATCTCCCTTAGTAAGAACTTACCAAG / / / // / TspEI MnlI HinfI || Hpy166II ApoI TfiI |Hpy178III* HphI Q E F M L D K S I D S I E G I I L E W F K N L C W T N P * T A * R E S F L N G S R I Y A G Q I H R Q H R G N H S * M V H ----:----|----:----|----:----|----:----|----:----|----:----| C S N I S S L D M S L M S P I M R S H N V L I * A P C I W L C C L P F * E Q I T L F K H Q V F G Y V A Y L S D N K F P E DdeI | Csp6I Cac8I MaeIII | |RsaI | BsmI | SetI | |MwoI | CviRI* | |TspDTI \ \\ \ \ \ \\ ACCCCAAACGCTAAGTACGCCAACCAATGCGTGCATTCAATGAACAAATCAGGTAACAAG 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TGGGGTTTGCGATTCATGCGGTTGGTTACGCACGTAAGTTACTTGTTTAGTCCATTGTTC // // / / / / / || |Csp6I | CviRI* | | MaeIII || RsaI Cac8I | TspDTI |DdeI BsmI SetI MwoI T P N A K Y A N Q C V H S M N K S G N K P Q T L S T P T N A C I Q * T N Q V T S P K R * V R Q P M R A F N E Q I R * Q V ----:----|----:----|----:----|----:----|----:----|----:----| V G F A L Y A L W H T C E I F L D P L L * G L R * T R W G I R A N L S C I L Y C G W V S L V G V L A H M * H V F * T V L AluI HindIII CviJI | AluI ApoI | SetI | CviJI MfeI TspEI | TspEI | | SetI TspEI EcoRI \ \ \ \ \ \ \ TCGTGGAGAGCTAATTGTGAAGCTTTATACAAGGAAAGAAAATCAATTGTTGAATTCTAT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AGCACCTCTCGATTAACACTTCGAAATATGTTCCTTTCTTTTAGTTAACAACTTAAGATA / / / / / / / / | CviJI | | | HindIII TspEI EcoRI | AluI | | CviJI MfeI TspEI SetI | | AluI ApoI | SetI TspEI S W R A N C E A L Y K E R K S I V E F Y R G E L I V K L Y T R K E N Q L L N S I V E S * L * S F I Q G K K I N C * I L Y ----:----|----:----|----:----|----:----|----:----|----:----| D H L A L Q S A K Y L S L F D I T S N * T T S L * N H L K I C P F F I L Q Q I R R P S S I T F S * V L F S F * N N F E I FatI BspHI |CviAII |Hpy178III* || NlaIII || | HinfI || | | Hpy178III* || | | |TaqI || | | || BsmAI || | | || |PleI || | | || ||MlyI TspEI \\ \ \ \\ \\\ \ ATTTATTTGGTAAATCATGAGAGTCTCGACAGATACAAAGCAGTTGATATTTGCGAAAAA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TAAATAAACCATTTAGTACTCTCAGAGCTGTCTATGTTTCGTCAACTATAAACGCTTTTT / // / // / / | || | || | BsmAI | || | || PleI | || | || MlyI | || | |TaqI | || | Hpy178III* | || HinfI | |BspHI | |FatI | Hpy178III* | CviAII NlaIII I Y L V N H E S L D R Y K A V D I C E K F I W * I M R V S T D T K Q L I F A K N L F G K S * E S R Q I Q S S * Y L R K I ----:----|----:----|----:----|----:----|----:----|----:----| I * K T F * S L R S L Y L A T S I Q S F Y K N P L D H S D R C I C L L Q Y K R F N I Q Y I M L T E V S V F C N I N A F F MboI | DpnI | |BstKTI Hin6I | ||Hin4II* FnuDII* DdeI | |||TspDTI |GlaI SauI* | |||Hpy188I SetI ||HhaI | MnlI FatI \ \\\\ \ \\\ \ \ \ TTACGAGATCAGAACGAAGGTTCATTTTCGCGCTTGGCAAAGTTCCTAAGGAAGTGGAGG 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| AATGCTCTAGTCTTGCTTCCAAGTAAAAGCGCGAACCGTTTCAAGGATTCCTTCACCTCC / //// / /// / / | |||| SetI ||Hin6I SauI* NlaIII | |||Hpy188I |GlaI DdeI | |||MboI FnuDII* MnlI | ||Hin4II* HhaI | ||TspDTI | |DpnI | BstKTI TspEI L R D Q N E G S F S R L A K F L R K W R Y E I R T K V H F R A W Q S S * G S G G T R S E R R F I F A L G K V P K E V E A ----:----|----:----|----:----|----:----|----:----|----:----| N R S * F S P E N E R K A F N R L F H L I V L D S R L N M K A S P L T G L S T S * S I L V F T * K R A Q C L E * P L P P ApoI CviAII TspEI | NlaIII | BccI | |TspDTI | | BccI \ \\ \ \ \ CATGACCATCAAAATTCATTTGATGGTCTGTTAGTATATCTATCTAACTGA 2830 2840 2850 2860 2870 ----:----|----:----|----:----|----:----|----:----|- GTACTGGTAGTTTTAAGTAAACTACCAGACAATCATATAGATAGATTGACT // /// |FatI ||BccI CviAII |TspEI TspDTI |ApoI BccI H D H Q N S F D G L L V Y L S N * M T I K I H L M V C * Y I Y L T X * P S K F I * W S V S I S I * L X ----:----|----:----|----:----|----:----|----:----|- C S W * F E N S P R N T Y R D L Q A H G D F N M Q H D T L I D I * S M V M L I * K I T Q * Y I * R V S # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 4 BspACI,SsiI AclI 1 Psp1406I AhaIII* 1 DraI AjuI 1 AluI 9 AluBI AlwNI 2 CaiI ApoI 14 AcsI,XapI AsuI* 7 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 4 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 9 Bce83I* 2 BpuEI BceAI 1 BclI 1 FbaI,Ksp22I BdaI 4 BetI* 2 BsaWI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 7 BplI 2 Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 5 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 6 BseRI 3 BsgI 1 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 7 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 6 BspHI 4 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 2 BseNI,Bse1I,BsrSI BssKI 6 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 8 BtgZI 1 Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CspCI 1 CviAII 10 CviJI 24 CviKI-1 CviRI* 7 HpyCH4V DdeI 12 BstDEI,HpyF3I DpnI 8 MalI DraII 2 EcoO109I DsaI* 3 BtgI,BstDSI EciI 3 Eco57I 1 AcuI Eco57MI 3 EcoP15I 1 EcoRI 3 EcoRII 5 AjnI,Psp6I,PspGI Esp3I 2 BsmBI FatI 10 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GlaI 3 GsuI 2 BpmI HaeIII 7 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HhaI 3 BstHHI,CfoI,AspLEI Hin4I 10 Hin4II* 3 HpyAV Hin6I 3 HinP1I,HspAI HindII 3 HincII HindIII 2 HinfI 14 HpaII 3 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 10 Hpy8I Hpy178III* 17 Hpy188III Hpy188I 9 Hpy99I 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 5 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 16 MfeI 2 MunI MlyI 6 SchI MmeI 2 MnlI 19 MseI 13 Tru1I,Tru9I MslI 1 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 1 HpyF10VI,BstMWI NcoI 2 Bsp19I NdeI 1 FauNDI NlaIII 10 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I PfoI 1 PleI 6 PpsI PpuMI 2 Psp5II,PspPPI PsiI 2 AanI PsrI 1 RsaI 4 AfaI SauI* 2 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 6 BmrFI,MspR9I,Bme1390I SecI* 4 BseDI,BssECI,BsaJI SetI 27 SfaNI 4 LweI SmlI 2 SmoI SspI 2 StuI 2 Eco147I,PceI,SseBI,AatI StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 9 TaqII 1 TatI 2 TfiI 8 PfeI TseI 1 ApeKI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 21 TspEI 41 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 2 TscAI VspI 1 PshBI,AseI XbaI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AflIII AgeI AlfI AloI ApaI ApaLI AscI Asp718I AvaI AvrII BalI BamHI BarI BbvCI BcgI BciVI BfiI BglI BmeT110I BmtI BsePI BseSI BseYI BsiI* Bsp120I Bsp1407I BspLU11I* BspOI BsrBI BsrDI BstAPI BstEII BstXI BtrI BtsI Cfr10I Cfr9I CfrI DinI DraIII DrdI Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRV EcoT22I EgeI EheI EspI* FalI FauI FseI FspAI GsaI HaeII HgiAI* HgiCI* HgiJII* HpaI KasI KpnI MauBI McrI* MluI Mph1103I MroNI NaeI NarI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PmaCI PmeI PpiI PshAI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI ScaI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SwaI TauI TspMI TstI Tth111I XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769