Restriction Map of DBF2/YGR092W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

DBF2/YGR092W on chromosome VII from coordinates 668189 to 669907.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.26752

SalI |TaqI |AccI ||HindII ||Hpy166II Cac8I MwoI Hpy188I ||| SetI |MnlI | TspEI BccI \ \\\ \ \\ \ \ \ ATGCTATCAAAATCAGAAAAAAATGTCGACCTCTTGGCAGGCAATATGAGCAATTTGAGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGATAGTTTTAGTCTTTTTTTACAGCTGGAGAACCGTCCGTTATACTCGTTAAACTCA / /// / / / / Hpy188I ||SalI | MwoI | BccI |AccI Cac8I TspEI |TaqI MnlI |SetI Hpy166II HindII M L S K S E K N V D L L A G N M S N L S C Y Q N Q K K M S T S W Q A I * A I * V A I K I R K K C R P L G R Q Y E Q F E F ----:----|----:----|----:----|----:----|----:----|----:----| X S D F D S F F T S R K A P L I L L K L X A I L I L F F H R G R P L C Y S C N S H * * F * F F I D V E Q C A I H A I Q T MlyI PleI FatI |CviAII || NlaIII || | HinfI || | | BssKI BslFI || | | EcoRII |SduI || | | |SecI* |BseSI MnlI || | | ||ScrFI || BsrI | MnlI TaqI || | | ||BseBI || TspRI | | TsoI \ \\ \ \ \\\ \\ \ \ \ \ TTCGATGGGCATGGGACTCCTGGGGGCACTGGACTATTTCCTAACCAAAATATAACAAAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCTACCCGTACCCTGAGGACCCCCGTGACCTGATAAAGGATTGGTTTTATATTGTTTC / // // / / // / / // TaqI || |FatI | | |BseSI BslFI | |TsoI || | | | |TspRI BsrI | MnlI || | | | |SduI MnlI || | | | EcoRII || | | | BssKI || | | | SecI* || | | BseBI || | | ScrFI || | HinfI || CviAII |PleI NlaIII MlyI F D G H G T P G G T G L F P N Q N I T K S M G M G L L G A L D Y F L T K I * Q R R W A W D S W G H W T I S * P K Y N K E ----:----|----:----|----:----|----:----|----:----|----:----| K S P C P V G P P V P S N G L W F I V F N R H A H S E Q P C Q V I E * G F Y L L E I P M P S R P A S S * K R V L I Y C L FauI | StuI FokI | CviJI SetI | HaeIII | Cfr10I | | Cac8I | |HpaII | | |BseRI TfiI | || Hin4II* | | ||AciI HphI HinfI | || | BseGI BccI \ \ \\\ \ \ \ \\ \ \ \ AGGAGGACAAGGCCTGCGGGTATCAATGATTCACCTTCGCCGGTAAAACCATCCTTTTTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTCCTGTTCCGGACGCCCATAGTTACTAAGTGGAAGCGGCCATTTTGGTAGGAAAAAA //// / / // / // / / |||| | HphI |SetI | || BseGI BccI |||| AciI HinfI | |Hin4II* |||Cac8I TfiI | |Cfr10I ||BseRI | HpaII |HaeIII FokI |CviJI |StuI FauI R R T R P A G I N D S P S P V K P S F F G G Q G L R V S M I H L R R * N H P F F E D K A C G Y Q * F T F A G K T I L F S ----:----|----:----|----:----|----:----|----:----|----:----| L L V L G A P I L S E G E G T F G D K K S S S L A Q P Y * H N V K A P L V M R K P P C P R R T D I I * R R R Y F W G K K MboII |FatI ||CviAII |||Hin4I |||Hin4I Hin4I BseGI |||| NlaIII MmeI SetI Hin4I Hpy178III* \\\\ \ \ \ \ \ CCTTACGAAGATACTTCCAACATGGACATAGACGAAGTATCTCAACCTGATATGGATGTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GGAATGCTTCTATGAAGGTTGTACCTGTATCTGCTTCATAGAGTTGGACTATACCTACAG // / // / / / / || | |FatI MmeI SetI Hin4I BseGI || | CviAII Hin4I || NlaIII |MboII Hin4I Hin4I P Y E D T S N M D I D E V S Q P D M D V L T K I L P T W T * T K Y L N L I W M S L R R Y F Q H G H R R S I S T * Y G C L ----:----|----:----|----:----|----:----|----:----|----:----| G * S S V E L M S M S S T D * G S I S T E K R L Y K W C P C L R L I E V Q Y P H R V F I S G V H V Y V F Y R L R I H I D HindIII TaqI | AluI | BsmAI | CviJI FalI | | FokI | | SetI FalI \ \ \ \ \ \ \ TCGAACTCTCCCAAGAAGCTTCCACCAAAGTTTTACGAAAGAGCAACTTCAAATAAAACA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTTGAGAGGGTTCTTCGAAGGTGGTTTCAAAATGCTTTCTCGTTGAAGTTTATTTTGT // / / / / / / / || | FokI | | | FalI FalI || BsmAI | | | FalI FalI |TaqI | | HindIII Hpy178III* | CviJI | AluI SetI S N S P K K L P P K F Y E R A T S N K T R T L P R S F H Q S F T K E Q L Q I K H E L S Q E A S T K V L R K S N F K * N T ----:----|----:----|----:----|----:----|----:----|----:----| E F E G L F S G G F N * S L A V E F L V R S S E W S A E V L T K R F L L K L Y F R V R G L L K W W L K V F S C S * I F C XbaI CviRI* |MaeI | TatI |Hpy178III* FalI | |Csp6I || MslI FalI | ||RsaI || | Tsp4CI* \ \ \\\ \\ \ \ CAGAGAGTTGTTAGTGTTTGCAAAATGTACTTTCTAGAACATTACTGTGATATGTTTGAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTCTCAACAATCACAAACGTTTTACATGAAAGATCTTGTAATGACACTATACAAACTG / /// // // CviRI* ||TatI |XbaI |Tsp4CI* |Csp6I | MslI RsaI Hpy178III* MaeI Q R V V S V C K M Y F L E H Y C D M F D R E L L V F A K C T F * N I T V I C L T E S C * C L Q N V L S R T L L * Y V * L ----:----|----:----|----:----|----:----|----:----|----:----| C L T T L T Q L I Y K R S C * Q S I N S V S L Q * H K C F T S E L V N S H Y T Q L S N N T N A F H V K * F M V T I H K V XbaI |MaeI |Hpy178III* || SetI BbvII* || |CviRI* TspEI | MboII || || BspMI CviJI \ \ \ \\ \\ \ \ TATGTAATTAGTAGAAGACAACGCACGAAGCAAGTTCTAGAATACCTGCAACAGCAAAGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATACATTAATCATCTTCTGTTGCGTGCTTCGTTCAAGATCTTATGGACGTTGTCGTTTCG / / // / / / / TspEI BbvII* || SetI CviRI* | CviJI MboII |XbaI BspMI Hpy178III* MaeI Y V I S R R Q R T K Q V L E Y L Q Q Q S M * L V E D N A R S K F * N T C N S K A C N * * K T T H E A S S R I P A T A K P ----:----|----:----|----:----|----:----|----:----|----:----| * T I L L L C R V F C T R S Y R C C C L S H L * Y F V V C S A L E L I G A V A F I Y N T S S L A R L L N * F V Q L L L A Hpy188I AsuI* |ApoI BplI AvaII |TspEI BplI |BmgT120I BplI |EcoRI Hpy188I MseI |Ksp632I* || MboII MnlI BplI \\ \ \ \\ \\ \ \ \ CAACTTCCGAATTCTGACCAGATTAAACTCAACGAAGAGTGGTCCTCTTACTTACAAAGG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGAAGGCTTAAGACTGGTCTAATTTGAGTTGCTTCTCACCAGGAGAATGAATGTTTCC / // / / / /// / / | |Hpy188I | MseI Ksp632I* ||MboII | BplI | EcoRI BplI |AvaII | BplI | TspEI BplI |AsuI* MnlI | ApoI BmgT120I Hpy188I Q L P N S D Q I K L N E E W S S Y L Q R N F R I L T R L N S T K S G P L T Y K G T S E F * P D * T Q R R V V L L L T K G ----:----|----:----|----:----|----:----|----:----|----:----| W S G F E S W I L S L S S H D E * K C L G V E S N Q G S * V * R L T T R K S V F L K R I R V L N F E V F L P G R V * L P MboI BclI | DpnI SetI Hin4II* SetI | |BstKTI \ \ \ \ \\ GAACATCAGGTTTTGAGAAAAAGAAGGTTGAAACCAAAAAATAGGGATTTTGAAATGATC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTAGTCCAAAACTCTTTTTCTTCCAACTTTGGTTTTTTATCCCTAAAACTTTACTAG / / / // / SetI Hin4II* SetI || BclI || MboI |DpnI BstKTI E H Q V L R K R R L K P K N R D F E M I N I R F * E K E G * N Q K I G I L K * S T S G F E K K K V E T K K * G F * N D H ----:----|----:----|----:----|----:----|----:----|----:----| S C * T K L F L L N F G F F L S K S I I P V D P K S F F F T S V L F Y P N Q F S F M L N Q S F S P Q F W F I P I K F H D TsoI MnlI | SetI SetI CviJI TsoI \ \ \ \ \ ACACAAGTAGGTCAAGGTGGTTATGGGCAAGTTTATTTAGCCAGAAAGAAAGACACAAAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGTTCATCCAGTTCCACCAATACCCGTTCAAATAAATCGGTCTTTCTTTCTGTGTTTT / / / / // | SetI SetI CviJI |MnlI TsoI TsoI T Q V G Q G G Y G Q V Y L A R K K D T K H K * V K V V M G K F I * P E R K T Q K T S R S R W L W A S L F S Q K E R H K R ----:----|----:----|----:----|----:----|----:----|----:----| V C T P * P P * P C T * K A L F F S V F * V L L D L H N H A L K N L W F S L C L C L Y T L T T I P L N I * G S L F V C F MseI | AluI | CviJI ApoI | |BsmAI SetI TspEI | ||SetI AflIII \ \ \ \\\ \ GAGGTGTGTGCTTTGAAAATTTTGAACAAAAAACTATTGTTTAAGCTCAACGAGACAAAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCACACACGAAACTTTTAAAACTTGTTTTTTGATAACAAATTCGAGTTGCTCTGTTTT / / / / / SetI TspEI | | BsmAI ApoI | CviJI | AluI MseI SetI E V C A L K I L N K K L L F K L N E T K R C V L * K F * T K N Y C L S S T R Q N G V C F E N F E Q K T I V * A Q R D K T ----:----|----:----|----:----|----:----|----:----|----:----| S T H A K F I K F L F S N N L S L S V F L P T H K S F K S C F V I T * A * R S L L H T S Q F N Q V F F * Q K L E V L C F BsiYI* |TsoI MaeII |Tth111I | SetI || SetI | TaiI || | TsoI | | MseI EcoRV || | Hpy188I \ \ \ \ \\ \ \ CACGTTTTAACTGAAAGAGATATCCTAACCACGACAAGGTCTGAATGGTTAGTAAAACTT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTGCAAAATTGACTTTCTCTATAGGATTGGTGCTGTTCCAGACTTACCAATCATTTTGAA / / / / / / // // | | MseI EcoRV | | || |Hpy188I | AflIII | | || TsoI | MaeII | | |Tth111I TaiI | | SetI SetI | TsoI BsiYI* H V L T E R D I L T T T R S E W L V K L T F * L K E I S * P R Q G L N G * * N F R F N * K R Y P N H D K V * M V S K T S ----:----|----:----|----:----|----:----|----:----|----:----| C T K V S L S I R V V V L D S H N T F S V R K L Q F L Y G L W S L T Q I T L L V V N * S F S I D * G R C P R F P * Y F K BssKI EcoRII | ScrFI Csp6I | BseBI |RsaI | |SetI ||BssKI | || CviJI ||EcoRII BsmI | || | BsiYI* ||| ScrFI CviRI* | || | | ApoI ||| BseBI | EcoT22I SetI TsoI | || | | TspEI ||| | AciI \ \ \ \ \ \\ \ \ \ \\\ \ \ CTGTATGCATTCCAAGACCTACAAAGTTTATACCTGGCTATGGAATTTGTACCAGGCGGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GACATACGTAAGGTTCTGGATGTTTCAAATATGGACCGATACCTTAAACATGGTCCGCCA / / / / / /// / // / / / | CviRI* SetI TsoI | ||EcoRII | || | | AciI EcoT22I | ||BssKI | || | EcoRII BsmI | ||CviJI | || | BssKI | |BsiYI* | || BseBI | BseBI | || ScrFI | ScrFI | |Csp6I SetI | RsaI TspEI ApoI L Y A F Q D L Q S L Y L A M E F V P G G C M H S K T Y K V Y T W L W N L Y Q A V V C I P R P T K F I P G Y G I C T R R * ----:----|----:----|----:----|----:----|----:----|----:----| R Y A N W S R C L K Y R A I S N T G P P E T H M G L G V F N I G P * P I Q V L R Q I C E L V * L T * V Q S H F K Y W A T CfrI | BalI | Hin4I | Hin4I | CviJI | HaeIII Csp6I MseI | |FatI |RsaI VspI | ||CviAII ||HphI | SfaNI MaeI | ||| NlaIII \\\ \ \ \ \ \\\ \ GATTTTCGTACATTATTAATAAATACTAGATGCTTGAAAAGTGGCCATGCGAGATTTTAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAAGCATGTAATAATTATTTATGATCTACGAACTTTTCACCGGTACGCTCTAAAATG // / / / / /// // / |Csp6I VspI | MaeI | ||| |FatI TspRI HphI MseI SfaNI | ||| CviAII RsaI | ||CfrI | |NlaIII | HaeIII | CviJI | BalI Hin4I Hin4I D F R T L L I N T R C L K S G H A R F Y I F V H Y * * I L D A * K V A M R D F T F S Y I I N K Y * M L E K W P C E I L H ----:----|----:----|----:----|----:----|----:----|----:----| S K R V N N I F V L H K F L P W A L N * H N E Y M I L L Y * I S S F H G H S I K I K T C * * Y I S S A Q F T A M R S K V Hin4I Hin4I |Hin6I ||GlaI |||HhaI |||| MseI |||| | MwoI |||| | | MaeIII |||| | | | FatI |||| | | | |CviAII TspRI |||| | | | || NlaIII CviJI \ \\\\ \ \ \ \\ \ \ ATCAGTGAAATGTTTTGCGCTGTTAATGCGTTACATGATTTAGGCTATACACATAGAGAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTCACTTTACAAAACGCGACAATTACGCAATGTACTAAATCCGATATGTGTATCTCTA / /// / / // // / Hin4I ||| | MseI || |FatI CviJI Hin4I ||| MwoI || CviAII ||Hin6I |MaeIII |GlaI NlaIII HhaI I S E M F C A V N A L H D L G Y T H R D S V K C F A L L M R Y M I * A I H I E I Q * N V L R C * C V T * F R L Y T * R F ----:----|----:----|----:----|----:----|----:----|----:----| M L S I N Q A T L A N C S K P * V C L S C * H F T K R Q * H T V H N L S Y V Y L D T F H K A S N I R * M I * A I C M S I EcoP15I MseI SfaNI | TspEI |AhaIII* | MseI | | MseI || CviJI | | TaqI StyI | | |BslFI || |HpaII | | ClaI SecI* | | || BbvI \\ \\ \ \ \ \ \ \ \\ \ TTAAAGCCGGAAAACTTCTTAATCGATGCCAAGGGACATATAAAATTAACAGATTTTGGT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTCGGCCTTTTGAAGAATTAGCTACGGTTCCCTGTATATTTTAATTGTCTAAAACCA // / / / / / / / // / / || | HpaII | | ClaI SecI* EcoP15I || | BbvI || CviJI | | TaqI StyI || BslFI |MseI | MseI |MseI AhaIII* SfaNI TspEI L K P E N F L I D A K G H I K L T D F G * S R K T S * S M P R D I * N * Q I L V K A G K L L N R C Q G T Y K I N R F W F ----:----|----:----|----:----|----:----|----:----|----:----| K F G S F K K I S A L P C I F N V S K P N L A P F S R L R H W P V Y L I L L N Q * L R F V E * D I G L S M Y F * C I K T TseI CviJI SetI |BisI Csp6I | MboII ||BlsI |RsaI TspEI TspDTI | |TspDTI \\\ \\ \ \ \ \\ TTGGCTGCTGGTACGATTTCTAATGAAAGAATTGAAAGTATGAAGATAAGGTTAGAAAAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGACGACCATGCTAAAGATTACTTTCTTAACTTTCATACTTCTATTCCAATCTTTTT //// // / / / / |||TseI |Csp6I | TspDTI SetI TspDTI ||BisI RsaI TspEI MboII |BlsI CviJI L A A G T I S N E R I E S M K I R L E K W L L V R F L M K E L K V * R * G * K K G C W Y D F * * K N * K Y E D K V R K N ----:----|----:----|----:----|----:----|----:----|----:----| K A A P V I E L S L I S L I F I L N S F N P Q Q Y S K * H F F Q F Y S S L T L F Q S S T R N R I F S N F T H L Y P * F F AsuI* AvaII DraII PpuMI |BmgT120I ||BssKI ||EcoRII ||| ScrFI ||| BseBI MboII ||| |SetI | TatI ||| || ApoI | Bsp1407I ||| || TspEI Hpy166II SfeI* | |Csp6I \\\ \\ \ \ \ \ \\ ATCAAGGACCTGGAATTTCCAGCGTTTACAGAGAAATCTATAGAAGATAGAAGAAAAATG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTCCTGGACCTTAAAGGTCGCAAATGTCTCTTTAGATATCTTCTATCTTCTTTTTAC /// / / / / / / ||| | | TspEI Hpy166II SfeI* MboII ||| | | ApoI ||| | EcoRII ||| | BssKI ||| BseBI ||| ScrFI ||PpuMI ||DraII ||AvaII ||AsuI* |BmgT120I SetI I K D L E F P A F T E K S I E D R R K M S R T W N F Q R L Q R N L * K I E E K C Q G P G I S S V Y R E I Y R R * K K N V ----:----|----:----|----:----|----:----|----:----|----:----| I L S R S N G A N V S F D I S S L L F I F * P G P I E L T * L S I * L L Y F F F D L V Q F K W R K C L F R Y F I S S F H FatI NcoI StyI BetI* SecI* BspMII* RsaI TspEI DsaI* |HpaII |MboII | MseI |CviAII |Hpy178III* || MnlI BsiYI* | VspI || NlaIII ||BsmAI || |BsrI Hin4II* | |TspEI || | BsiYI* ||Eco31I \\ \\ \ \ \\ \\ \ \ \\\ TACAACCAGTTGAGGGAGAAGGAAATTAATTATGCGAACTCCATGGTTGGGTCTCCGGAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTGGTCAACTCCCTCTTCCTTTAATTAATACGCTTGAGGTACCAACCCAGAGGCCTA //// / / // / / // // / |||BsrI | Hin4II* || TspEI | |DsaI* || Eco31I |||MnlI BsiYI* |VspI | |SecI* || BsmAI ||Bsp1407I |MseI | |StyI |BspMII* ||TatI TspEI | |NcoI |BetI* |Csp6I | |FatI Hpy178III* MboII | BsiYI* HpaII RsaI | CviAII NlaIII Y N Q L R E K E I N Y A N S M V G S P D T T S * G R R K L I M R T P W L G L R I Q P V E G E G N * L C E L H G W V S G L ----:----|----:----|----:----|----:----|----:----|----:----| Y L W N L S F S I L * A F E M T P D G S T C G T S P S P F * N H S S W P Q T E P V V L Q P L L F N I I R V G H N P R R I Hin4I MnlI Hin4II* Hin4I |CviJI |SetI | Tsp4CI* BsrI \\ \\ \ \ \ TATATGGCTTTGGAGGTTTTAGAAGGAAAGAAATATGACTTTACTGTGGATTACTGGTCG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| ATATACCGAAACCTCCAAAATCTTCCTTTCTTTATACTGAAATGACACCTAATGACCAGC / / / / / / / | CviJI | Hin4II* Hin4I Tsp4CI* BsrI MnlI SetI Hin4I Y M A L E V L E G K K Y D F T V D Y W S I W L W R F * K E R N M T L L W I T G R Y G F G G F R R K E I * L Y C G L L V V ----:----|----:----|----:----|----:----|----:----|----:----| * I A K S T K S P F F Y S K V T S * Q D N Y P K P P K L L F S I H S * Q P N S T I H S Q L N * F S L F I V K S H I V P R AjuI | PflMI | BsiYI* | | MboI AjuI | | | DpnI |Hin4I | | | |BstKTI |Hin4I | | | || TaqI || TaqI | | | || | BinI* || AsuII | | | || | |BsmAI || | TsoI | | | || | |Eco31I \\ \ \ \ \ \ \\ \ \\ TTGGGTTGTATGCTGTTCGAAAGTTTAGTTGGTTATACACCATTTAGTGGATCATCGACT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCAACATACGACAAGCTTTCAAATCAACCAATATGTGGTAAATCACCTAGTAGCTGA // // / / // / // |Hin4I |AsuII AjuI BsiYI* || | |BinI* |Hin4I |TaqI PflMI || | TaqI AjuI TsoI || MboI |DpnI BstKTI L G C M L F E S L V G Y T P F S G S S T W V V C C S K V * L V I H H L V D H R L G L Y A V R K F S W L Y T I * W I I D * ----:----|----:----|----:----|----:----|----:----|----:----| N P Q I S N S L K T P * V G N L P D D V T P N Y A T R F N L Q N Y V M * H I M S Q T T H Q E F T * N T I C W K T S * R S BbvII* Hin6I | BccI SmlI |GlaI | |MboII AflII ||HhaI | || MnlI SetI |MseI |||HaeII MseI BsmAI | || |Hpy188I \ \\ \\\\ \ \ \ \\ \\ AATGAGACCTATGACAACTTAAGGCGCTGGAAACAAACTTTAAGAAGACCGAGACAATCT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTCTGGATACTGTTGAATTCCGCGACCTTTGTTTGAAATTCTTCTGGCTCTGTTAGA / / ////// / / // // | SetI |||||Hin6I MseI BsmAI || |Hpy188I Eco31I ||||GlaI || MnlI BsmAI |||HhaI |BccI ||HaeII BbvII* |AflII MboII |SmlI MseI N E T Y D N L R R W K Q T L R R P R Q S M R P M T T * G A G N K L * E D R D N L * D L * Q L K A L E T N F K K T E T I * ----:----|----:----|----:----|----:----|----:----|----:----| L S V * S L K L R Q F C V K L L G L C D * H S R H C S L A S S V F K L F V S V I I L G I V V * P A P F L S * S S R S L R TseI BinI* |BisI | MboI ||BlsI Hpy188I Hin4I | | DpnI TaqII |||BsmI |BbvI MseI Hin4I | | |BstKTI \ \\\\ \\ \ \ \ \ \\ GATGGGAGGGCAGCATTCTCCGATAGAACTTGGGATTTAATAACAAGATTGATTGCCGAT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCCTCCCGTCGTAAGAGGCTATCTTGAACCCTAAATTATTGTTCTAACTAACGGCTA / /// / / / / / // TaqII ||TseI | BbvI | MseI | |DpnI |BisI Hpy188I Hin4I | BstKTI BlsI Hin4I BinI* BsmI D G R A A F S D R T W D L I T R L I A D M G G Q H S P I E L G I * * Q D * L P I W E G S I L R * N L G F N N K I D C R S ----:----|----:----|----:----|----:----|----:----|----:----| S P L A A N E S L V Q S K I V L N I A S Q H S P L M R R Y F K P N L L L I S Q R I P P C C E G I S S P I * Y C S Q N G I TaqI ClaI | BinI* | | MseI | | |Hin4I | | |Hin4I | | ||BsaBI | | |||MboI | | |||XhoII | | |||| DpnI | | |||| |BstKTI | | |||| || TaqI | | |||| || AsuII | | |||| || | FatI | | |||| || | AflIII | | |||| || | BspLU11I* | | |||| || | |CviAII | | |||| || | || Hin4II* FatI | | |||| || | || |NspI |CviAII | | |||| || | || |NlaIII || NspI | | |||| || | || ||MseI || NlaIII CviRI* \ \ \\\\ \\ \ \\ \\\ \\ \ \ CCAATCAATCGATTAAGATCCTTCGAACATGTTAAACGCATGTCTTATTTTGCAGATATA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTAGTTAGCTAATTCTAGGAAGCTTGTACAATTTGCGTACAGAATAAAACGTCTATAT / / // / // / / / /// / / // / MboI | || | || | | | ||| | | |FatI CviRI* | || | || | | | ||| | | CviAII | || | || | | | ||| | NlaIII | || | || | | | ||| | NspI | || | || | | | ||| MseI | || | || | | | ||BspLU11I* | || | || | | | ||AflIII | || | || | | | ||FatI | || | || | | | |CviAII | || | || | | | Hin4II* | || | || | | NlaIII | || | || | | NspI | || | || | AsuII | || | || | TaqI | || | || XhoII | || | || MboI | || | |DpnI | || | BstKTI | || BsaBI | || MseI | |BinI* | ClaI | TaqI Hin4I Hin4I P I N R L R S F E H V K R M S Y F A D I Q S I D * D P S N M L N A C L I L Q I * N Q S I K I L R T C * T H V L F C R Y K ----:----|----:----|----:----|----:----|----:----|----:----| G I L R N L D K S C T L R M D * K A S I D L * D I L I R R V H * V C T K N Q L Y W D I S * S G E F M N F A H R I K C I Y BinI* TatI |SetI |MnlI || MboI |Csp6I || | DpnI ||RsaI || | |BstKTI BcgI ||ScaI || | || AciI FauI | MaeI SfaNI \\\ \\ \ \\ \ \ \ \ \ AACTTTAGTACTTTGAGGTCAATGATCCCGCCTTTTACACCCCAACTAGACAGCGAAACT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAAATCATGAAACTCCAGTTACTAGGGCGGAAAATGTGGGGTTGATCTGTCGCTTTGA / /// / / // / / / / / / | ||| | | || | AciI | BcgI MaeI SfaNI | ||| | | || MboI FauI | ||| | | |DpnI | ||| | | BstKTI | ||| | BinI* | ||| SetI | ||TatI | |Csp6I | ScaI | RsaI MnlI N F S T L R S M I P P F T P Q L D S E T T L V L * G Q * S R L L H P N * T A K L L * Y F E V N D P A F Y T P T R Q R N * ----:----|----:----|----:----|----:----|----:----|----:----| F K L V K L D I I G G K V G W S S L S V L S * Y K S T L S G A K * V G V L C R F V K T S Q P * H D R R K C G L * V A F S TspRI |CviJI || FatI || |CviAII || ||MwoI || |||CfrI || ||||NlaIII || |||||BalI || |||||CviJI Cfr10I HphI MnlI || |||||HaeIII |HpaII | BcgI | BsrI || |||||| MwoI \\ \ \ \ \ \\ \\\\\\ \ GATGCCGGTTATTTTGATGACTTCACCAGTGAGGCTGACATGGCCAAATATGCTGATGTT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGGCCAATAAAACTACTGAAGTGGTCACTCCGACTGTACCGGTTTATACGACTACAA // // // / // /// // || |BcgI |TspRI | || ||| |MwoI || HphI |BsrI | || ||| CfrI |Cfr10I MnlI | || ||HaeIII HpaII | || ||CviJI | || ||BalI | || |FatI | || CviAII | |NlaIII | MwoI CviJI D A G Y F D D F T S E A D M A K Y A D V M P V I L M T S P V R L T W P N M L M F C R L F * * L H Q * G * H G Q I C * C F ----:----|----:----|----:----|----:----|----:----|----:----| S A P * K S S K V L S A S M A L Y A S T Q H R N N Q H S * W H P Q C P W I H Q H I G T I K I V E G T L S V H G F I S I N TspEI | MseI | NmeAIII MlyI HinfI | | CviJI PleI |BceAI \ \ \ \ \\ TTCAAAAGACAAGACAAATTAACGGCTATGGTAGATGACTCGGCAGTATCATCAAAACTT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTTTCTGTTCTGTTTAATTGCCGATACCATCTACTGAGCCGTCATAGTAGTTTTGAA / // / // / | || CviJI |PleI BceAI | |MseI MlyI HinfI | TspEI NmeAIII F K R Q D K L T A M V D D S A V S S K L S K D K T N * R L W * M T R Q Y H Q N L Q K T R Q I N G Y G R * L G S I I K T C ----:----|----:----|----:----|----:----|----:----|----:----| K L L C S L N V A I T S S E A T D D F S K * F V L C I L P * P L H S P L I M L V E F S L V F * R S H Y I V R C Y * * F K Hpy166II Hpy166II | Hpy188I | MmeI TspRI | | PsrI | NlaIV | PsrI | | | MslI | | BsrI | | SfaNI \ \ \ \ \ \ \ \ \ \ GTTGGGTTCACTTTCCGACATAGAAATGGTAAACAGGGTTCCAGTGGCATCTTATTCAAC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CAACCCAAGTGAAAGGCTGTATCTTTACCATTTGTCCCAAGGTCACCGTAGAATAAGTTG / // / / / / / / | |PsrI MslI | | NlaIV PsrI SfaNI | Hpy188I | | TspRI Hpy166II | | BsrI | MmeI Hpy166II V G F T F R H R N G K Q G S S G I L F N L G S L S D I E M V N R V P V A S Y S T W V H F P T * K W * T G F Q W H L I Q R ----:----|----:----|----:----|----:----|----:----|----:----| T P N V K R C L F P L C P E L P M K N L Q Q T * K G V Y F H Y V P N W H C R I * N P E S E S M S I T F L T G T A D * E V BsrI | DdeI BspCNI | | TspGWI |BseMII | | |Hpy188I || SetI MaeI \ \ \\ \\ \ \ GGACTGGAACACTCAGACCCCTTTTCAACCTTTTACTAG 1690 1700 1710 ----:----|----:----|----:----|----:---- CCTGACCTTGTGAGTCTGGGGAAAAGTTGGAAAATGATC / / // // / / BsrI | |DdeI || SetI MaeI | Hpy188I |BseMII TspGWI BspCNI G L E H S D P F S T F Y * D W N T Q T P F Q P F T X T G T L R P L F N L L L X ----:----|----:----|----:----|----:---- P S S C E S G K E V K * * R V P V S L G R K L R K S S Q F V * V G K * G K V L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 2 AhaIII* 1 DraI AjuI 1 AluI 2 AluBI ApoI 4 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 2 MlsI,MluNI,MscI,Msp20I BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 3 BceAI 1 BcgI 1 BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BinI* 4 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 2 BplI 2 BsaBI 1 Bse8I,BseJI BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 6 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstKTI 5 Cac8I 2 BstC8I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 6 CviQI,RsaNI CviAII 8 CviJI 14 CviKI-1 CviRI* 4 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 5 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI Eco31I 2 Bso31I,BspTNI,BsaI EcoP15I 1 EcoRI 1 EcoRII 4 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 2 FatI 8 FauI 2 SmuI FokI 2 GlaI 2 HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HhaI 2 BstHHI,CfoI,AspLEI Hin4I 8 Hin4II* 5 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 3 HpaII 4 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 8 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 1 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MlyI 2 SchI MmeI 2 MnlI 10 MseI 15 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NmeAIII 1 NspI 2 BstNSI,XceI PflMI 1 BasI,AccB7I,Van91I PleI 2 PpsI PpuMI 1 Psp5II,PspPPI PsrI 1 RsaI 6 AfaI SalI 1 ScaI 1 BmcAI,AssI,ZrmI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 21 SfaNI 4 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI StuI 1 Eco147I,PceI,SseBI,AatI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 8 TaqII 1 TatI 3 TfiI 1 PfeI TseI 2 ApeKI TsoI 7 Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 4 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 2 PshBI,AseI XbaI 2 XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AgeI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvaI AvrII BaeI BamHI BarI BbvCI Bce83I* BciVI BdaI BfiI BglI BglII BmeT110I BmtI Bpu10I BsaAI BsaXI BsePI BseYI BsgI BsiI* Bsp120I BspHI BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I CspCI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco47III Eco57I Eco57MI EcoICRI EcoNI EgeI EheI Esp3I EspI* FnuDII* FseI FspAI GsaI GsuI HgaI HgiAI* HgiCI* HgiJII* HpaI Hpy99I KasI KpnI MauBI McrI* MfeI MluI MroNI MstI* NaeI NarI NdeI NgoMIV NheI NotI NruI NspBII* OliI PacI PasI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PstI PvuI PvuII RsrII SacI SacII SanDI SapI SauI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI SwaI TauI Tsp45I TspMI TstI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769