Restriction Map of PRP31/YGR091W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PRP31/YGR091W on chromosome VII from coordinates 666341 to 667825.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.19804

AluI Eco57I CviJI Eco57MI Ksp632I* |AluI Ecl136II |CviJI |MnlI |Ecl136II ||SetI || TaqI ||SduI || SetI ||SacI || SduI ||HgiAI* || SacI ||HgiJII* MboII || HgiAI* MnlI ||| Hpy188I |TaqI || HgiJII* SetI | MseI \\\ \ \\ \\ \ \ \ \ ATGAGCTCTGAAGAGGACTATTTCGATGAGCTCGAATATGACCTTGCCGATGAAGTTAAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCGAGACTTCTCCTGATAAAGCTACTCGAGCTTATACTGGAACGGCTACTTCAATTA / / / / / // / / / / / | | Ksp632I* | | || | TaqI SetI MnlI MseI | | Hpy188I | | || Ecl136II | Ecl136II | | || CviJI | CviJI | | || AluI | AluI | | |HgiJII* | MnlI | | |HgiAI* HgiJII* | | |SacI HgiAI* | | |SduI SacI | | |SetI SduI | | Eco57MI SetI | | Eco57I | TaqI MboII M S S E E D Y F D E L E Y D L A D E V N * A L K R T I S M S S N M T L P M K L M E L * R G L F R * A R I * P C R * S * * ----:----|----:----|----:----|----:----|----:----|----:----| X L E S S S * K S S S S Y S R A S S T L X S S Q L P S N R H A R I H G Q R H L * H A R F L V I E I L E F I V K G I F N I AluI BbvII* CviJI Tsp4CI* ApoI TspDTI | MboII | SetI | TspEI TspEI \ \ \ \ \ \ \ \ GAGGAAAAAGAAGACATACAAACTAAAAAGCTCACTACGGTAAATTGTCAAACAGAAAAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCCTTTTTCTTCTGTATGTTTGATTTTTCGAGTGATGCCATTTAACAGTTTGTCTTTTT / / / / / / TspDTI BbvII* | CviJI Tsp4CI* TspEI MboII | AluI SetI E E K E D I Q T K K L T T V N C Q T E K R K K K T Y K L K S S L R * I V K Q K N G K R R H T N * K A H Y G K L S N R K I ----:----|----:----|----:----|----:----|----:----|----:----| S S F S S M C V L F S V V T F Q * V S F H P F L L C V F * F A * * P L N D F L F L F F F V Y L S F L E S R Y I T L C F F MboII |TaqI |AsuII || ApoI || TspEI || | XmnI || | | BetI* Hpy178III* || | | BspMII* | MaeII || | | |HpaII | | SetI Hin4I || | | |Hpy178III* TspEI | | TaiI Hin4I \\ \ \ \\ \ \ \ \ \ TTCAATCCATTCGAAATTCTTCCGGAAAGTATAGAATTATTCAGGACGTTGGCACTCATC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTAGGTAAGCTTTAAGAAGGCCTTTCATATCTTAATAAGTCCTGCAACCGTGAGTAG / / / // // / // / / TspEI | | |TspEI |BspMII* TspEI || | Hin4I ApoI | | |ApoI |BetI* || | Hin4I | | XmnI Hpy178III* || MaeII | AsuII HpaII |TaiI | TaqI |SetI MboII Hpy178III* F N P F E I L P E S I E L F R T L A L I S I H S K F F R K V * N Y S G R W H S S Q S I R N S S G K Y R I I Q D V G T H Q ----:----|----:----|----:----|----:----|----:----|----:----| N L G N S I R G S L I S N N L V N A S M I * D M R F E E P F Y L I I * S T P V * E I W E F N K R F T Y F * E P R Q C E D BsmAI | Hpy188I Hpy178III* | | Hin4I MseI | SetI | | Hin4I TspEI TaqI |AhaIII* \ \ \ \ \ \ \ \\ AGTCCTGATAGGTTATCTCTATCAGAGACAGCACAGATTTTACCAAAAATTGTCGATTTA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCAGGACTATCCAATAGAGATAGTCTCTGTCGTGTCTAAAATGGTTTTTAACAGCTAAAT / / / / / / // | SetI | Hin4I | | |MseI Hpy178III* | Hin4I | | AhaIII* Hpy188I | TaqI BsmAI TspEI S P D R L S L S E T A Q I L P K I V D L V L I G Y L Y Q R Q H R F Y Q K L S I * S * * V I S I R D S T D F T K N C R F K ----:----|----:----|----:----|----:----|----:----|----:----| L G S L N D R D S V A C I K G F I T S K * D Q Y T I E I L S L V S K V L F Q R N T R I P * R * * L C C L N * W F N D I * MaeIII Tsp4CI* | Tsp4CI* TfiI Hin4II* | | FokI HinfI | TspDTI MseI | | | MseI \ \ \ \ \ \ \ \ AAAAGAATCCTTCAACAACAAGAAATAGATTTCATTAAACTGTTACCGTTTTTTAACGAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTCTTAGGAAGTTGTTGTTCTTTATCTAAAGTAATTTGACAATGGCAAAAAATTGCTT / // / / / / / / HinfI |TspDTI | | | | MseI BseGI TfiI Hin4II* | | | FokI | | Tsp4CI* | | MaeIII | Tsp4CI* MseI K R I L Q Q Q E I D F I K L L P F F N E K E S F N N K K * I S L N C Y R F L T K K N P S T T R N R F H * T V T V F * R N ----:----|----:----|----:----|----:----|----:----|----:----| F L I R * C C S I S K M L S N G N K L S L F F G E V V L F L N * * V T V T K * R F S D K L L L F Y I E N F Q * R K K V F TatI Tsp4CI* Bsp1407I TspEI |Csp6I Hpy178III* | MseI CviRI* ||RsaI BseGI | MnlI | VspI | TspEI |||TspRI \ \ \ \ \ \ \ \\\\ ATCATCCCCCTCATCAAGAGCAATATAAAATTAATGCACAATTTTCTAATCTCACTGTAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTAGGGGGAGTAGTTCTCGTTATATTTTAATTACGTGTTAAAAGATTAGAGTGACATG // // / / / / /// |MnlI || CviRI* TspEI | | ||Bsp1407I Hpy178III* |VspI | | ||Tsp4CI* |MseI | | ||TatI TspEI | | |Csp6I | | RsaI | Tsp4CI* TspRI I I P L I K S N I K L M H N F L I S L Y S S P S S R A I * N * C T I F * S H C T H P P H Q E Q Y K I N A Q F S N L T V Q ----:----|----:----|----:----|----:----|----:----|----:----| I M G R M L L L I F N I C L K R I E S Y F * G G * * S C Y L I L A C N E L R V T D D G E D L A I Y F * H V I K * D * Q V Tsp4CI* | AccI | |Hpy166II | || MaeII | || | SetI | || | TaiI | || | | Hpy178III* | || | | |MboII | || | | |TspDTI HphI BccI \ \\ \ \ \\ \ \ AGTAGACGTTTTCCAGAACTATCTTCATTGATACCATCACCATTACAATACTCAAAAGTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TCATCTGCAAAAGGTCTTGATAGAAGTAACTATGGTAGTGGTAATGTTATGAGTTTTCAC // / // / / / || | || Hpy178III* HphI BccI || | |MboII || | TspDTI || MaeII |AccI |TaiI |SetI Hpy166II S R R F P E L S S L I P S P L Q Y S K V V D V F Q N Y L H * Y H H H Y N T Q K * * T F S R T I F I D T I T I T I L K S D ----:----|----:----|----:----|----:----|----:----|----:----| L L R K G S S D E N I G D G N C Y E F T C Y V N E L V I K M S V M V M V I S L L T S T K W F * R * Q Y W * W * L V * F H TspDTI BsrI TspEI | AloI TspDTI \ \ \ \ \ ATAAGCATACTGGAAAATGAAAATTATTCAAAAAACGAAAGTGATGAACTATTTTTCCAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TATTCGTATGACCTTTTACTTTTAATAAGTTTTTTGCTTTCACTACTTGATAAAAAGGTG / / / / / BsrI | | AloI TspDTI | TspDTI TspEI I S I L E N E N Y S K N E S D E L F F H * A Y W K M K I I Q K T K V M N Y F S T K H T G K * K L F K K R K * * T I F P L ----:----|----:----|----:----|----:----|----:----|----:----| I L M S S F S F * E F F S L S S S N K W S L C V P F H F N N L F R F H H V I K G Y A Y Q F I F I I * F V F T I F * K E V MseI BinI* | MnlI | MboI | | Hin4I | XhoII | | | FatI TspEI | | DpnI | | | |CviAII AloI |Hin4I | | |BstKTI | | | || NlaIII \ \\ \ \ \\ \ \ \ \\ \ TTGGAAAATAAAGCAAAATTGACCAGAGAGCAGATCCTCGTTTTAACAATGTCCATGAAG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTTTTATTTCGTTTTAACTGGTCTCTCGTCTAGGAGCAAAATTGTTACAGGTACTTC / / / / // / // / // / AloI Hin4I TspEI | || XhoII |MnlI | || AatII | || MboI |MseI | || TaiI | |DpnI Hin4I | || SetI | BstKTI | |FatI BinI* | CviAII NlaIII L E N K A K L T R E Q I L V L T M S M K W K I K Q N * P E S R S S F * Q C P * R G K * S K I D Q R A D P R F N N V H E D ----:----|----:----|----:----|----:----|----:----|----:----| K S F L A F N V L S C I R T K V I D M F S P F Y L L I S W L A S G R K L L T W S Q F I F C F Q G S L L D E N * C H G H L AcyI MaeII |ZraI || SetI || TaiI || AatII || BbvII* ApoI || | MboII TspEI || | |TspDTI CviJI MnlI | HgaI \\ \ \\ \ \ \ \ ACGTCTTTCAAAAACAAAGAGCCATTGGACATCAAAACGAGGACGCAAATTTTAGAAGCA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGCAGAAAGTTTTTGTTTCTCGGTAACCTGTAGTTTTGCTCCTGCGTTTAAAATCTTCGT // / / / / / || TspDTI CviJI MnlI | HgaI || BbvII* TspEI || MboII ApoI |MaeII |AcyI ZraI T S F K N K E P L D I K T R T Q I L E A R L S K T K S H W T S K R G R K F * K Q V F Q K Q R A I G H Q N E D A N F R S K ----:----|----:----|----:----|----:----|----:----|----:----| V D K L F L S G N S M L V L V C I K S A S T K * F C L A M P C * F S S A F K L L R R E F V F L W Q V D F R P R L N * F C ApoI SetI TspEI |MboII CviJI \ \\ \ AATAGCATATTGGAAAATTTATGGAAACTACAAGAAGATATAGGTCAATACATAGCCTCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCGTATAACCTTTTAAATACCTTTGATGTTCTTCTATATCCAGTTATGTATCGGAGT / / / / TspEI | MboII CviJI ApoI SetI N S I L E N L W K L Q E D I G Q Y I A S I A Y W K I Y G N Y K K I * V N T * P Q * H I G K F M E T T R R Y R S I H S L K ----:----|----:----|----:----|----:----|----:----|----:----| F L M N S F K H F S C S S I P * Y M A E L Y C I P F N I S V V L L Y L D I C L R I A Y Q F I * P F * L F I Y T L V Y G * AsuI* |BssKI |CviJI |HaeIII TseI MaeII |BmgT120I |BisI AflIII || HpaII ||BlsI EcoRV | SetI || ScrFI |||CviJI |MnlI TspEI | TaiI || CauII* |||| TspEI \\ \ \ \ \\ \ \\\\ \ AAGATATCAATAATTGCCCCTAACGTGTGTTTCTTGGTAGGCCCGGAGATAGCAGCCCAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTATAGTTATTAACGGGGATTGCACACAAAGAACCATCCGGGCCTCTATCGTCGGGTT / / / / / ////// /// EcoRV TspEI | | AflIII |||||BssKI ||CviJI MnlI | MaeII ||||HpaII ||TseI TaiI |||CauII* |BisI SetI |||ScrFI BlsI ||AsuI* |BmgT120I HaeIII CviJI K I S I I A P N V C F L V G P E I A A Q R Y Q * L P L T C V S W * A R R * Q P N D I N N C P * R V F L G R P G D S S P I ----:----|----:----|----:----|----:----|----:----|----:----| F I D I I A G L T H K K T P G S I A A W L S I L L Q G * R T N R P L G P S L L G L Y * Y N G R V H T E Q Y A R L Y C G L FatI |MnlI GsuI BsrI MseI |CviAII Eco57MI | HgaI VspI || NspI | BfiI | | CviRI* | BbvI || NlaIII | BsmI | | | BsrDI \ \ \\ \ \ \ \ \ \ \ TTAATAGCACATGCTGGAGGGGTTTTGGAGTTCAGTCGCATTCCCAGTTGCAACATTGCG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AATTATCGTGTACGACCTCCCCAAAACCTCAAGTCAGCGTAAGGGTCAACGTTGTAACGC // // // / // / /// |VspI || |FatI | |BfiI BsrI ||HgaI |MseI || CviAII | BsmI |BsrDI TspEI |NlaIII Eco57MI CviRI* |NspI GsuI |MnlI BbvI L I A H A G G V L E F S R I P S C N I A * * H M L E G F W S S V A F P V A T L R N S T C W R G F G V Q S H S Q L Q H C V ----:----|----:----|----:----|----:----|----:----|----:----| N I A C A P P T K S N L R M G L Q L M A I L L V H Q L P K P T * D C E W N C C Q * Y C M S S P N Q L E T A N G T A V N R MboII | SetI | | FatI | | |CviAII | | || MnlI Csp6I | | || NlaIII |RsaI | | || |MaeIII || Hin4II* \ \ \\ \\ \\ \ TCCATTGGGAAGAATAAGCACCTCTCACATGAGTTACATACATTAGAGAGTGGAGTACGA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTAACCCTTCTTATTCGTGGAGAGTGTACTCAATGTATGTAATCTCTCACCTCATGCT // / // / // |MboII | |FatI MaeIII |Hin4II* SetI | CviAII |Csp6I | MnlI RsaI NlaIII S I G K N K H L S H E L H T L E S G V R P L G R I S T S H M S Y I H * R V E Y D H W E E * A P L T * V T Y I R E W S T T ----:----|----:----|----:----|----:----|----:----|----:----| D M P F F L C R E C S N C V N S L P T R T W Q S S Y A G R V H T V Y M L S H L V G N P L I L V E * M L * M C * L T S Y S Hpy188I | FatI | |CviAII | || TfiI | || HinfI | || NlaIII EcoRV | || | Hpy188I | BdaI | || | | ApoI BdaI | BdaI | || | | TspEI BdaI \ \ \ \\ \ \ \ \ CAAGAAGGATATCTATTTGCTTCTGACATGATTCAGAAATTTCCCGTTTCTGTCCATAAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTTCCTATAGATAAACGAAGACTGTACTAAGTCTTTAAAGGGCAAAGACAGGTATTT // / / // // / / / |BdaI | | || || | BdaI TstI |BdaI | | || || | BdaI EcoRV | | || || TspEI | | || || ApoI | | || |Hpy188I | | || HinfI | | || TfiI | | |FatI | | CviAII | NlaIII Hpy188I Q E G Y L F A S D M I Q K F P V S V H K K K D I Y L L L T * F R N F P F L S I N R R I S I C F * H D S E I S R F C P * T ----:----|----:----|----:----|----:----|----:----|----:----| C S P Y R N A E S M I * F N G T E T W L V L L I D I Q K Q C S E S I E R K Q G Y L F S I * K S R V H N L F K G N R D M F MaeI |TstI || CviJI SfaNI || |AciI CfrI |TstI || |BisI Cac8I || DdeI BseGI || ||BlsI | BalI || Bpu10I | CviRI* || ||SfaNI | CviJI || | MwoI | | FokI || |||TauI | HaeIII \\ \ \ \ \ \ \\ \\\\ \ \ CAAATGCTTAGGATGCTTTGTGCAAAAGTATCACTAGCCGCAAGAGTTGATGCTGGCCAG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTACGAATCCTACGAAACACGTTTTCATAGTGATCGGCGTTCTCAACTACGACCGGTC / // / / / / ///// / / / / | || BseGI | | TstI ||||| SfaNI | | CfrI | |Bpu10I | FokI ||||AciI | HaeIII | |DdeI CviRI* |||BisI | CviJI | MwoI ||BlsI | BalI SfaNI |CviJI Cac8I |TauI MaeI Q M L R M L C A K V S L A A R V D A G Q K C L G C F V Q K Y H * P Q E L M L A R N A * D A L C K S I T S R K S * C W P E ----:----|----:----|----:----|----:----|----:----|----:----| C I S L I S Q A F T D S A A L T S A P W V F A * S A K H L L I V L R L L Q H Q G L H K P H K T C F Y * * G C S N I S A L HphI | Tsp4CI* | | AluI | | CviJI Tsp4CI* | | | SetI CviJI TaqI \ \ \ \ \ \ \ AAAAACGGTGATAGAAATACAGTTTTAGCTCATAAATGGAAAGCCGAACTATCGAAGAAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTGCCACTATCTTTATGTCAAAATCGAGTATTTACCTTTCGGCTTGATAGCTTCTTT / / / / / / / / Tsp4CI* | | | CviJI CviJI TaqI SetI | | | AluI | | SetI | Tsp4CI* HphI K N G D R N T V L A H K W K A E L S K K K T V I E I Q F * L I N G K P N Y R R K K R * * K Y S F S S * M E S R T I E E S ----:----|----:----|----:----|----:----|----:----|----:----| F F P S L F V T K A * L H F A S S D F F S F R H Y F Y L K L E Y I S L R V I S S F V T I S I C N * S M F P F G F * R L F AluI CviJI |MaeI ||SetI ||| MboII MnlI ||| | AluI SetI ||| | CviJI | BetI* ||| | | SetI | BspMII* ||| | | | Hpy188I | |HpaII ||| | | | | CviJI | |Hpy178III* ||| | | | | | AvaI Hin4II* | || AsuI* ||| | | | | | |BmeT110I Hpy188I CviJI | || AvaII \\\ \ \ \ \ \ \\ \ \ \ \\ \ GCTAGAAAGCTATCAGAAGCCCCGAGCATTTCTGAAACGAAGGCTCTACCTATTCCGGAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CGATCTTTCGATAGTCTTCGGGGCTCGTAAAGACTTTGCTTCCGAGATGGATAAGGCCTC / // / / / / // / / / / // | || | | | | |AvaI Hpy188I | | MnlI |BspMII* | || | | | | | Hin4II* | SetI |BetI* | || | | | | BmeT110I CviJI Hpy178III* | || | | | CviJI HpaII | || | | Hpy188I | || | CviJI | || | AluI | || SetI | |MboII | MaeI CviJI AluI A R K L S E A P S I S E T K A L P I P E L E S Y Q K P R A F L K R R L Y L F R R * K A I R S P E H F * N E G S T Y S G G ----:----|----:----|----:----|----:----|----:----|----:----| A L F S D S A G L M E S V F A R G I G S L * F A I L L G S C K Q F S P E V * E P S S L * * F G R A N R F R L S * R N R L AluI BseYI CviJI TatI | SetI ApoI |Csp6I ApoI BmgT120I | | GsaI TspEI ||RsaI TspEI Hpy188I \ \ \ \ \ \\\ \ \ GACCAACCCAAAAAGAAAAGAGCTGGGAGAAAATTTAGGAAGTACAAGGAAAAATTCAGA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGTTGGGTTTTTCTTTTCTCGACCCTCTTTTAAATCCTTCATGTTCCTTTTTAAGTCT // / / / / /// // |AvaII | | BseYI TspEI ||TatI |Hpy188I |AsuI* | CviJI ApoI |Csp6I TspEI BmgT120I | AluI RsaI ApoI | GsaI SetI D Q P K K K R A G R K F R K Y K E K F R T N P K R K E L G E N L G S T R K N S D P T Q K E K S W E K I * E V Q G K I Q T ----:----|----:----|----:----|----:----|----:----|----:----| S W G L F F L A P L F N L F Y L S F N L P G V W F S F L Q S F I * S T C P F I * V L G F L F S S P S F K P L V L F F E S FatI |CviAII || NspI || NlaIII ApoI || | Hpy188I TspEI FokI || | | TspEI BccI |BseGI |Cac8I Tsp4CI* \\ \ \ \ \ \\ \\ \ CTATCGCATGTCAGACAATTACAAAATAGGATGGAATTTGGCAAGCAAGAACAAACTGTT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GATAGCGTACAGTCTGTTAATGTTTTATCCTACCTTAAACCGTTCGTTCTTGTTTGACAA / // / / / / / / / / | || Hpy188I | BccI | | | FokI Tsp4CI* | |FatI TspEI | | Cac8I | CviAII | TspEI NlaIII | ApoI NspI BseGI L S H V R Q L Q N R M E F G K Q E Q T V Y R M S D N Y K I G W N L A S K N K L F I A C Q T I T K * D G I W Q A R T N C S ----:----|----:----|----:----|----:----|----:----|----:----| S D C T L C N C F L I S N P L C S C V T V I A H * V I V F Y S P I Q C A L V F Q * R M D S L * L I P H F K A L L F L S N Hpy178III* | TfiI HphI | HinfI | MboII \ \ \ \ CTTGATTCCTATGGTGAAGAAGTTGGTTTGGGTATGTCTAATACTTCTTTACAACAAGCA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTAAGGATACCACTTCTTCAACCAAACCCATACAGATTATGAAGAAATGTTGTTCGT / / / / | HinfI | MboII | TfiI HphI Hpy178III* L D S Y G E E V G L G M S N T S L Q Q A L I P M V K K L V W V C L I L L Y N K Q * F L W * R S W F G Y V * Y F F T T S S ----:----|----:----|----:----|----:----|----:----|----:----| R S E * P S S T P K P I D L V E K C C A E Q N R H H L L Q N P Y T * Y K K V V L K I G I T F F N T Q T H R I S R * L L C SetI NlaIV | Hpy178III* EcoP15I | | MboI | MwoI | | BglII CviJI | | AluI | | XhoII | AluI | | CviJI | | | DpnI | CviJI | | | SetI | | | |BstKTI MboII | | SetI SetI \ \ \ \ \ \ \ \\ \ \ \ \ \ GTAGGAGCTACATCAGGTTCCAGAAGATCTGCTGGTAATCAAGCCAAGCTAACAAAGGTA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CATCCTCGATGTAGTCCAAGGTCTTCTAGACGACCATTAGTTCGGTTCGATTGTTTCCAT / / / / / / / // / / / / / / | | | CviJI | | | || | MboII | | CviJI SetI | | | AluI | | | || XhoII | | AluI | | SetI | | | || BglII | SetI | EcoP15I | | | || MboI CviJI MwoI | | | |DpnI | | | BstKTI | | Hpy178III* | NlaIV SetI V G A T S G S R R S A G N Q A K L T K V * E L H Q V P E D L L V I K P S * Q R * R S Y I R F Q K I C W * S S Q A N K G N ----:----|----:----|----:----|----:----|----:----|----:----| T P A V D P E L L D A P L * A L S V F T L L L * M L N W F I Q Q Y D L W A L L P Y S S C * T G S S R S T I L G L * C L Y BdaI Cac8I BdaI | AluI |BseMII | CviJI ||BspCNI | | SetI ||| MnlI | | | ApoI ||| | TspDTI | | | TspEI ||| | |DdeI | | | EcoRI ||| | ||Hpy188I | | | |BdaI StyI ||| | ||| CviJI | | | |BdaI SecI* \\\ \ \\\ \ \ \ \ \\ \ ATGAAGCACAGGATTTCTGAGGCTAATCAGCAAGCTGACGAATTCCTAATCTCCTTGGGT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTCGTGTCCTAAAGACTCCGATTAGTCGTTCGACTGCTTAAGGATTAGAGGAACCCA /// / / / / / / / / / / ||| | | | | CviJI | | BdaI EcoRI SecI* ||| | | | DdeI | | BdaI TspEI StyI ||| | | Hpy188I | CviJI ApoI ||| | TspDTI | AluI ||| MnlI Cac8I ||BspCNI SetI |BseMII BdaI BdaI M K H R I S E A N Q Q A D E F L I S L G * S T G F L R L I S K L T N S * S P W V E A Q D F * G * S A S * R I P N L L G S ----:----|----:----|----:----|----:----|----:----|----:----| I F C L I E S A L * C A S S N R I E K P L S A C S K Q P * D A L Q R I G L R R P H L V P N R L S I L L S V F E * D G Q T TfiI HinfI BccI CviRI* \ \ \ CATAATACAGAGCAACCGAATCTGTCGCCAGAGATGGTTCAAATGCACAAGAAACAGCAT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTATGTCTCGTTGGCTTAGACAGCGGTCTCTACCAAGTTTACGTGTTCTTTGTCGTA / / / HinfI BccI CviRI* TfiI H N T E Q P N L S P E M V Q M H K K Q H I I Q S N R I C R Q R W F K C T R N S I * Y R A T E S V A R D G S N A Q E T A Y ----:----|----:----|----:----|----:----|----:----|----:----| * L V S C G F R D G S I T * I C L F C C D Y Y L A V S D T A L S P E F A C S V A M I C L L R I Q R W L H N L H V L F L M MfeI TspEI |MboII || MboII || | TsoI || | | BetI* || | | |HpaII Ksp632I* || | | || FatI | BsmAI || | | || |CviAII | Eco31I || | | || || NlaIII \ \ \\ \ \ \\ \\ \ ACTAACCCAGAAGAAGAGACCAATTGGTTTTCCGGTCATGGTTAG 1450 1460 1470 1480 ----:----|----:----|----:----|----:----|----: TGATTGGGTCTTCTTCTCTGGTTAACCAAAAGGCCAGTACCAATC / / / // / /// // | Eco31I | || TsoI ||| |FatI | BsmAI | |TspEI ||| CviAII Ksp632I* | |MfeI ||NlaIII | MboII |BetI* MboII HpaII T N P E E E T N W F S G H G * L T Q K K R P I G F P V M V X * P R R R D Q L V F R S W L X ----:----|----:----|----:----|----:----|----: V L G S S S V L Q N E P * P * Y * G L L L S W N T K R D H N S V W F F L G I P K G T M T L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AhaIII* 1 DraI AloI 1 AluI 10 AluBI ApoI 9 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 3 BdaI 4 BetI* 3 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmeT110I 1 BmgT120I 2 Bpu10I 1 BseGI 3 BstF5I,BtsCI BseMII 1 BseYI 1 BsmAI 2 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BspMII* 2 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 2 Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 6 CviJI 21 CviKI-1 CviRI* 4 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 2 MalI Ecl136II 2 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 2 EcoP15I 1 EcoRI 1 EcoRV 2 Eco32I FatI 6 FokI 3 GsaI 1 GsuI 1 BpmI HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII Hin4I 3 Hin4II* 3 HpyAV HinfI 4 HpaII 4 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 8 Hpy188III Hpy188I 9 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 2 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 MfeI 1 MunI MnlI 10 MseI 7 Tru1I,Tru9I MwoI 2 HpyF10VI,BstMWI NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspI 2 BstNSI,XceI RsaI 3 AfaI SacI 2 Psp124BI,SstI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 21 SfaNI 2 LweI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 5 TatI 2 TauI 1 TfiI 4 PfeI TseI 1 ApeKI TsoI 1 Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 20 TasI,Tsp509I,Sse9I TspRI 1 TscAI TstI 1 VspI 2 PshBI,AseI XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AclI AflII AgeI AjuI AlfI AlwNI ApaI ApaLI AscI Asp718I AvrII BaeI BamHI BarI BbvCI Bce83I* BceAI BcgI BciVI BclI BglI BmtI BplI BsaAI BsaBI BsaXI BseBI BsePI BseRI BseSI BsgI BsiI* BsiYI* BslFI BsmFI Bsp120I BspHI BspLU11I* BspMI BspOI BsrBI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstXI BstZ17I BtgZI BtrI BtsI Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Eco47III EcoNI EcoRII EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GlaI HaeII HgiCI* HhaI Hin6I HindII HindIII HinP1I HpaI Hpy99I HspAI KasI KpnI MauBI McrI* MluI MlyI MmeI Mph1103I MroNI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacII SalI SanDI SapI SauI* ScaI SchI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII Tsp45I TspGWI TspMI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769