Restriction Map of MSB2/YGR014W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MSB2/YGR014W on chromosome VII from coordinates 516943 to 520863.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.28254

AsuI* |BssKI |CviJI |HaeIII |BmgT120I ||AvaI ||BssKI ||SecI* ||Cfr9I |||HpaII |||ScrFI |||CauII* |||BmeT110I ||||SmaI ||||SrfI ||||ScrFI ||||CauII* BsmAI |||||AsuI* CviRI* | TaqI TspEI ||||||BmgT120I \ \ \ \ \\\\\\\ ATGCAGTTTCCATTCGCTTGTCTCCTATCGACCCTTGTAATTAGTGGGTCATTGGCCCGG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTCAAAGGTAAGCGAACAGAGGATAGCTGGGAACATTAATCACCCAGTAACCGGGCC / // / ////// CviRI* |TaqI TspEI |||||Cfr9I BsmAI |||||BssKI |||||SecI* |||||AvaI ||||BmeT110I ||||CauII* ||||HpaII ||||ScrFI |||CauII* |||ScrFI |||SrfI |||SmaI ||AsuI* |BmgT120I HaeIII CviJI M Q F P F A C L L S T L V I S G S L A R C S F H S L V S Y R P L * L V G H W P G A V S I R L S P I D P C N * W V I G P G ----:----|----:----|----:----|----:----|----:----|----:----| X C N G N A Q R R D V R T I L P D N A R X A T E M R K D G I S G Q L * H T M P G H L K W E S T E * R G K Y N T P * Q G P AluI CviJI |DdeI CviJI ||SetI HaeIII ||| Hpy188I BspCNI | Cac8I ||| | CviJI |BseMII | | CviJI TaqI Hin4II* BsrDI ||| | |Hin4I || HinfI \ \ \ \ \ \ \\\ \ \\ \\ \ GCCAGCCCCTTCGACTTTATATTCGGCAATGGAACGCAACAAGCTCAGAGCCAAAGCGAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTCGGGGAAGCTGAAATATAAGCCGTTACCTTGCGTTGTTCGAGTCTCGGTTTCGCTC /// / / / / / / // / // ||| CviJI | Hin4II* BsrDI | | || | |BseMII ||Cac8I TaqI | | || | BspCNI |AsuI* | | || CviJI BmgT120I | | |DdeI HaeIII | | Hpy188I BssKI | | Hin4I CviJI | CviJI | AluI SetI A S P F D F I F G N G T Q Q A Q S Q S E P A P S T L Y S A M E R N K L R A K A R Q P L R L Y I R Q W N A T S S E P K R E ----:----|----:----|----:----|----:----|----:----|----:----| A L G K S K I N P L P V C C A * L W L S P W G R R S * I R C H F A V L E S G F R G A G E V K Y E A I S R L L S L A L A L BspCNI |BseMII HindIII ||BdaI PleI | AluI ||BdaI |SetI | CviJI ||| XcmI |MlyI | | SetI ||| |SetI || HphI | | | DdeI ||| || BstXI || | BdaI | | | | Hpy178III* ||| || | Bce83I* || | BdaI Hin4I | | | | | TspDTI ||| || | |MaeIII \\ \ \ \ \ \ \ \ \ \ \\\ \\ \ \\ AGTCAAGGTCAAGTTTCTTTCACCAATGAAGCTTCTCAGGATAGTTCCACCACCTCTTTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TCAGTTCCAGTTCAAAGAAAGTGGTTACTTCGAAGAGTCCTATCAAGGTGGTGGAGAAAC / / / / / / / / / // /// / / / | | | | | Hin4I | | | || ||| | | Bce83I* | | | | BdaI | | | || ||| | BstXI | | | | BdaI | | | || ||| | XcmI | | | HphI | | | || ||| SetI | | PleI | | | || ||BdaI | | MlyI | | | || ||BdaI | SetI | | | || |BseMII HinfI | | | || BspCNI | | | |Hpy178III* | | | |TspDTI | | | DdeI | | HindIII | CviJI | AluI SetI S Q G Q V S F T N E A S Q D S S T T S L V K V K F L S P M K L L R I V P P P L W S R S S F F H Q * S F S G * F H H L F G ----:----|----:----|----:----|----:----|----:----|----:----| L * P * T E K V L S A E * S L E V V E K S D L D L K K * W H L K E P Y N W W R K T L T L N R E G I F S R L I T G G G R Q TspDTI | AlfI AlfI MnlI | AlfI AlfI | CviJI |SmlI | SetI BsrI CviRI* | MboII \ \ \\ \ \ \ \ \ \ GTAACAGCCTATTCTCAAGGTGTTCATTCGCACCAGTCTGCAACAATAGTGAGTGCCACA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CATTGTCGGATAAGAGTTCCACAAGTAAGCGTGGTCAGACGTTGTTATCACTCACGGTGT / / / / // / / / / | | | | |SmlI BsrI CviRI* | MboII | | | | SetI AlfI | | | | AlfI AlfI | | | | AlfI | | | TspDTI | | CviJI | MaeIII MnlI V T A Y S Q G V H S H Q S A T I V S A T * Q P I L K V F I R T S L Q Q * * V P Q N S L F S R C S F A P V C N N S E C H N ----:----|----:----|----:----|----:----|----:----|----:----| T V A * E * P T * E C W D A V I T L A V P L L R N E L H E N A G T Q L L L S H W Y C G I R L T N M R V L R C C Y H T G C Cac8I | AluI | CviJI | Ecl136II SfaNI | | SetI |MnlI | | SduI |Hin4I | | SacI ||BstXI | | HgiAI* Hin4I Ksp632I* |||BccI | | HgiJII* | DrdI NdeI \ \\\\ \ \ \ \ \ \ ATCTCTTCCCTCCCATCTACTTGGTATGATGCGAGCTCCACTTCCCAGACTTCTGTGTCA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAGAGAAGGGAGGGTAGATGAACCATACTACGCTCGAGGTGAAGGGTCTGAAGACACAGT / / / / / / / / / | | | | SfaNI | Ecl136II Hin4I DrdI | | | | BccI | CviJI | | | MnlI | AluI | | BstXI HgiJII* | Hin4I HgiAI* Ksp632I* Cac8I SacI SduI SetI I S S L P S T W Y D A S S T S Q T S V S S L P S H L L G M M R A P L P R L L C H L F P P I Y L V * C E L H F P D F C V I ----:----|----:----|----:----|----:----|----:----|----:----| I E E R G D V Q Y S A L E V E W V E T D L R K G G M * K T H H S S W K G S K Q T D R G E W R S P I I R A G S G L S R H * Hin6I BceAI |GlaI Hpy178III* ||HhaI | TfiI ||FnuDII* | HinfI HgaI ||| AccI BsrI | | Hpy188I MseI | MmeI ||| |Hpy166II \ \ \ \ \ \ \ \\\ \\ TATGCCAGTCAAGAATCCGACTATGCCGTTAATCAAAACTCTTGGAGCGCGTCTACTAAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ATACGGTCAGTTCTTAGGCTGATACGGCAATTAGTTTTGAGAACCTCGCGCAGATGATTA // / // / / / /// // |BsrI | |Hpy188I MseI | | ||| |AccI NdeI | HinfI | | ||| Hpy166II | TfiI | | ||FnuDII* Hpy178III* | | ||Hin6I BceAI | | |GlaI | | HhaI | HgaI MmeI Y A S Q E S D Y A V N Q N S W S A S T N M P V K N P T M P L I K T L G A R L L I C Q S R I R L C R * S K L L E R V Y * S ----:----|----:----|----:----|----:----|----:----|----:----| Y A L * S D S * A T L * F E Q L A D V L M H W D L I R S H R * D F S K S R T * * I G T L F G V I G N I L V R P A R R S I SetI | BcgI | TatI | |Csp6I | ||RsaI AluI | ||| BbvI CviJI | ||| Hin4II* |Eco57I | ||| | CfrI BsrI |Eco57MI | ||| | XmaIII* |BccI || Hin6I | ||| | | CviJI || Csp6I || |GlaI | ||| | | HaeIII || |RsaI ||SetI ||HhaI | ||| | | |McrI* \\ \\ \\\ \\\ \ \\\ \ \ \\ CAACTGCCATCTACCAGTACGACAAGCTACTATGCGCCAACCTTCAGTACATCGGCCGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGACGGTAGATGGTCATGCTGTTCGATGATACGCGGTTGGAAGTCATGTAGCCGGCTA / / // /// /// / / /// // // | | || ||CviJI ||| SetI | ||| || |MwoI | | || ||AluI ||Hin6I | ||| || XmaIII* | | || |Eco57MI |GlaI | ||| || CfrI | | || |Eco57I HhaI | ||| |HaeIII | | || SetI | ||| |CviJI | | |Csp6I | ||| |BbvI | | RsaI | ||| McrI* | BccI | ||Hin4II* BsrI | ||TatI | |Csp6I | RsaI BcgI Q L P S T S T T S Y Y A P T F S T S A D N C H L P V R Q A T M R Q P S V H R P I T A I Y Q Y D K L L C A N L Q Y I G R F ----:----|----:----|----:----|----:----|----:----|----:----| * S G D V L V V L * * A G V K L V D A S D V A M * W Y S L S S H A L R * Y M P R L Q W R G T R C A V I R W G E T C R G I BcgI | TseI | CviRI* | |BisI | ||BlsI | |||AluI | |||CviJI | |||| SetI | |||| |AlwNI | |||| || Hpy188I | |||| || | BbvI MwoI | |||| || | | BtsI | TseI | |||| || | | |BsmAI | |BisI | |||| || | | || BsrI | ||BlsI MaeI | |||| || | | || |TspRI TspRI \ \\\ \ \ \\\\ \\ \ \ \\ \\ \ TTTGCTGCTTCTAGTGTAAATGCAGCTTCTGATGTCTCCACTGCCAGTGTTCCCATTGAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGACGAAGATCACATTTACGTCGAAGACTACAGAGGTGACGGTCACAAGGGTAACTA /// / / //// / / / // ||TseI MaeI | |||| | | | |BsmAI |BisI | |||| | | | TspRI BlsI | |||| | | | BsrI | |||| | | BbvI | |||| | TspRI | |||| | BtsI | |||| Hpy188I | |||AlwNI | |||CviJI | |||TseI | |||AluI | ||BisI | |BlsI | |SetI | CviRI* BcgI F A A S S V N A A S D V S T A S V P I D L L L L V * M Q L L M S P L P V F P L I C C F * C K C S F * C L H C Q C S H * Y ----:----|----:----|----:----|----:----|----:----|----:----| K A A E L T F A A E S T E V A L T G M S N Q Q K * H L H L K Q H R W Q W H E W Q K S S R T Y I C S R I D G S G T N G N I ApaLI | CviRI* | Hpy166II | | SduI MaeIII BplI | | BseSI TspEI | BsmAI BplI | | HgiAI* \ \ \ \ \ \ \ ACGAGTGCTAATTCTATCCCTTTCACAACTACAAGTAACATAGAGACTACAACGAGTGCA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTCACGATTAAGATAGGGAAAGTGTTGATGTTCATTGTATCTCTGATGTTGCTCACGT / /// / /// TspEI ||BsmAI | ||ApaLI |BplI | |SetI |BplI | Hpy166II MaeIII | CviRI* HgiAI* BseSI SduI T S A N S I P F T T T S N I E T T T S A R V L I L S L S Q L Q V T * R L Q R V H E C * F Y P F H N Y K * H R D Y N E C T ----:----|----:----|----:----|----:----|----:----|----:----| V L A L E I G K V V V L L M S V V V L A Y S H * N * G K * L * L Y C L S * L S H R T S I R D R E C S C T V Y L S C R T C AciI | TseI | |BisI | ||BlsI | |||AluI | |||CviJI | |||PvuII | |||NspBII* MnlI SpeI | |||| MaeII |Hpy188I |MaeI | |||| | BbvI || BplI || Csp6I | |||| | |SetI SetI || BplI || |RsaI | |||| SetI | |TaiI \ \\ \ \\ \\ \ \\\\ \ \ \\ CCTCTCACTTCGGACACTCCACTTATTTCCACTAGTACGATGTCCGCAGCTGATAACGTA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGAGTGAAGCCTGTGAGGTGAATAAAGGTGATCATGCTACAGGCGTCGACTATTGCAT /// //// //// / / ||BplI |||Csp6I |||| | MaeII ||BplI ||RsaI |||| TaiI |Hpy188I |SpeI |||| SetI MnlI MaeI |||NspBII* |||PvuII |||CviJI |||TseI |||AluI ||BisI |BlsI |SetI AciI P L T S D T P L I S T S T M S A A D N V L S L R T L H L F P L V R C P Q L I T Y S H F G H S T Y F H * Y D V R S * * R I ----:----|----:----|----:----|----:----|----:----|----:----| G R V E S V G S I E V L V I D A A S L T V E * K P C E V * K W * Y S T R L Q Y R R E S R V S W K N G S T R H G C S I V Y EcoP15I MnlI | Hpy188I \ \ \ TTTTCGTCAGCAAACCCTATTTCTGCCTCCCTAACAACCACCGATAGTTCAGAAAGTTTT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAGCAGTCGTTTGGGATAAAGACGGAGGGATTGTTGGTGGCTATCAAGTCTTTCAAAA / / / / BbvI MnlI | Hpy188I EcoP15I F S S A N P I S A S L T T T D S S E S F F R Q Q T L F L P P * Q P P I V Q K V L F V S K P Y F C L P N N H R * F R K F * ----:----|----:----|----:----|----:----|----:----|----:----| N E D A F G I E A E R V V V S L E S L K I K T L L G * K Q R G L L W R Y N L F N K R * C V R N R G G * C G G I T * F T K BetI* |MslI HgiCI* |HpaII TaqI | NlaIV || CviRI* MaeI \ \ \ \\ \ \ GACCAAACTTCGACTGCTGGTGCCATTCCGGTGCAAAGTTCAGCAGATTTTAGTAGTTCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGTTTGAAGCTGACGACCACGGTAAGGCCACGTTTCAAGTCGTCTAAAATCATCAAGA / / / / // / TaqI | | | || CviRI* | | | |BetI* | | | HpaII | | MslI | HgiCI* NlaIV D Q T S T A G A I P V Q S S A D F S S S T K L R L L V P F R C K V Q Q I L V V L P N F D C W C H S G A K F S R F * * F * ----:----|----:----|----:----|----:----|----:----|----:----| S W V E V A P A M G T C L E A S K L L E Q G F K S Q Q H W E P A F N L L N * Y N V L S R S S T G N R H L T * C I K T T R EcoP15I |TatI CviJI ApoI ||Csp6I AciI | EciI TspEI |||RsaI | PsrI | |MaeI PsrI \ \\\\ \ \ \ \\ \ AGTGAAATTTTAGTACAAAGTTCGGCGGATTTCAGTAGCCCTAGTTCTCCAACTACTACC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTTTAAAATCATGTTTCAAGCCGCCTAAAGTCATCGGGATCAAGAGGTTGATGATGG / / //// / / / / / MaeI | |||TatI PsrI AciI | MaeI PsrI | ||Csp6I CviJI | |RsaI EciI | EcoP15I TspEI ApoI S E I L V Q S S A D F S S P S S P T T T V K F * Y K V R R I S V A L V L Q L L P * N F S T K F G G F Q * P * F S N Y Y R ----:----|----:----|----:----|----:----|----:----|----:----| L S I K T C L E A S K L L G L E G V V V * H F K L V F N P P N * Y G * N E L * * T F N * Y L T R R I E T A R T R W S S G MmeI | TseI | AluI | CviJI | PvuII | NspBII* | |BisI | ||BlsI | ||SetI CviRI* TfiI CviRI* BbvI | ||| BtsI | TspRI HinfI BtsI | TspRI \ \ \\\ \ \ \ \ \ \ \ GATATATCGCTATCAGCTGCCCCACTGCAAACAAGTGAATCAAGCAGTTTTACCACTGCA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTATATAGCGATAGTCGACGGGGTGACGTTTGTTCACTTAGTTCGTCAAAATGGTGACGT / / / ///// / / / / | | | ||||TspRI CviRI* HinfI TspRI CviRI* | | | ||||BtsI TfiI BtsI | | | |||TseI | | | ||BisI | | | |BlsI | | | NspBII* | | | PvuII | | | CviJI | | | AluI | | SetI | MmeI BbvI D I S L S A A P L Q T S E S S S F T T A I Y R Y Q L P H C K Q V N Q A V L P L H Y I A I S C P T A N K * I K Q F Y H C I ----:----|----:----|----:----|----:----|----:----|----:----| S I D S D A A G S C V L S D L L K V V A R Y I A I L Q G V A F L H I L C N * W Q I Y R * * S G W Q L C T F * A T K G S C Bce83I* | BccI | |MaeII TseI | || SetI MwoI | || TaiI |BisI | || EcoP15I ||BlsI | || | CviJI |||AluI | || | |SmlI |||CviJI | || | || HphI |||SfaNI | || | || | Hin6I |||| SetI | || | || | |GlaI SfeI* |||| | BsrI | || | || | ||HhaI |SetI |||| | | BbvI | || | || | |||HaeII || MnlI \\\\ \ \ \ \ \\ \ \\ \ \\\\ \\ \ TCAGCAGCTCTACCAGTAAGTTCAACAGACGTTGATGGCTCAAGCGCCTCACCTGTAGTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCGTCGAGATGGTCATTCAAGTTGTCTGCAACTACCGAGTTCGCGGAGTGGACATCAC / /// / / / // / / / / //// / // | ||| SfaNI | | || | | | | |||| SetI |SfeI* | ||| BsrI | | || | | | | |||Hin6I MnlI | ||CviJI | | || | | | | ||GlaI | ||TseI | | || | | | | |HhaI | ||AluI | | || | | | | HaeII | |BisI | | || | | | | SmlI | BlsI | | || | | | HphI | SetI | | || | | CviJI MwoI | | || | EcoP15I | | || MaeII | | |BccI | | TaiI | | SetI | Bce83I* BbvI S A A L P V S S T D V D G S S A S P V V Q Q L Y Q * V Q Q T L M A Q A P H L * * S S S T S K F N R R * W L K R L T C S E ----:----|----:----|----:----|----:----|----:----|----:----| D A A R G T L E V S T S P E L A E G T T M L L E V L L N L L R Q H S L R R V Q L * C S * W Y T * C V N I A * A G * R Y H NheI AluI CviJI |MaeI FatI ||SetI |CviAII ||Cac8I || NlaIII ||| AluI || | Hin6I ||| BmtI || | |GlaI ||| CviJI || | ||HhaI ||| |TstI || | |||AciI ||| |SmlI || | |||BisI ||| ||SetI || | |||HaeII ||| ||| TseI || | ||||BlsI ||| ||| MwoI || | |||||TauI ||| ||| |BisI || | |||||| Bce83I* ||| ||| ||BlsI BbvI Hpy188I \\ \ \\\\\\ \ \\\ \\\ \\\ \ \ AGCATGAGCGCCGCAGGACAAATAGCTAGCTCAAGCAGCACAGATAATCCAACTATGTCA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTACTCGCGGCGTCCTGTTTATCGATCGAGTTCGTCGTGTCTATTAGGTTGATACAGT / ///////// / / /// / / /// / / / | ||||||||Bce83I* | | ||| | | ||TseI BbvI | Hpy188I | ||||||||AciI | | ||| | | |BisI TstI | |||||||BisI | | ||| | | BlsI | ||||||BlsI | | ||| | SmlI | |||||Hin6I | | ||| MwoI | |||||TauI | | ||CviJI | ||||GlaI | | ||NheI | |||HhaI | | ||AluI | ||HaeII | | |MaeI | |FatI | | Cac8I | CviAII | | SetI NlaIII | CviJI | AluI | BmtI | TstI SetI S M S A A G Q I A S S S S T D N P T M S A * A P Q D K * L A Q A A Q I I Q L C Q H E R R R T N S * L K Q H R * S N Y V R ----:----|----:----|----:----|----:----|----:----|----:----| L M L A A P C I A L E L L V S L G V I D S C S R R L V F L * S L C C L Y D L * T A H A G C S L Y S A * A A C I I W S H * MseI MmeI |HpaI Hin4I BcgI |HindII Hin4I | Tsp4CI* |Hpy166II | TspDTI | | Hin6I || SfeI* | |NlaIV | | TspRI TstI SetI || | BccI | || Hpy188I | | |GlaI \ \ \\ \ \ \ \\ \ \ \ \\ GAAACCTTTTCGTTAACATCTACAGAAGTTGATGGTTCCGATGTTTCATCAACAGTGAGC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGGAAAAGCAATTGTAGATGTCTTCAACTACCAAGGCTACAAAGTAGTTGTCACTCG / / // / / / / / / / / /// SetI | |MseI | Hin4I | | Hpy188I | | | ||GlaI | Hpy166II | Hin4I | NlaIV | | | |HhaI | HindII | BccI TspDTI | | | Hin4I | HpaI SfeI* | | | Hin4I MmeI | | Tsp4CI* | TspRI BcgI E T F S L T S T E V D G S D V S S T V S K P F R * H L Q K L M V P M F H Q Q * A N L F V N I Y R S * W F R C F I N S E R ----:----|----:----|----:----|----:----|----:----|----:----| S V K E N V D V S T S P E S T E D V T L L F R K T L M * L L Q H N R H K M L L S F G K R * C R C F N I T G I N * * C H A TatI HhaI |Csp6I MwoI | Hin4I CviJI ||RsaI | PsrI | Hin4I |NlaIV BcgI ||ScaI Tsp4CI* | CviJI \ \ \\ \ \\\ \ \ \ GCATTATTATCGGCTCCTTTTTTACAAACAAGTACTTCCAACAGTTTCAGCATTGTTAGC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAATAATAGCCGAGGAAAAAATGTTTGTTCATGAAGGTTGTCAAAGTCGTAACAATCG / // / /// / // // Hin6I |NlaIV BcgI ||TatI Tsp4CI* |PsrI |MmeI CviJI |Csp6I MwoI CviJI ScaI RsaI A L L S A P F L Q T S T S N S F S I V S H Y Y R L L F Y K Q V L P T V S A L L A I I I G S F F T N K Y F Q Q F Q H C * P ----:----|----:----|----:----|----:----|----:----|----:----| A N N D A G K K C V L V E L L K L M T L R M I I P E K K V F L Y K W C N * C Q * C * * R S R K * L C T S G V T E A N N A BccI | PsrI | | GsuI | | DdeI | | Eco57MI | | | Hpy188I | | | | MaeII | | | | | SetI | | | | | TaiI | | | | | |MnlI | | | | | ||NheI | | | | | |||MaeI | | | | | ||||Cac8I | | | | | |||||BspCNI | | | | | ||||||AluI | | | | | ||||||BmtI | | | | | ||||||CviJI | | | | | ||||||BseMII | | | | | ||||||| SetI | | | | | ||||||| |BsrI | | | | | ||||||| || TatI | | | | | ||||||| || |Csp6I | | | | | ||||||| || ||RsaI | | | | | ||||||| || ||ScaI | | | | | ||||||| || ||| CviRI* MmeI BccI | | | | | ||||||| || ||| | FokI \ \ \ \ \ \ \ \\\\\\\ \\ \\\ \ \ CCATCGGTATCTTTTGTTCCATCACAGAGTTCCTCAGACGTTGCTAGCTCCAGTACTGCA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGCCATAGAAAACAAGGTAGTGTCTCAAGGAGTCTGCAACGATCGAGGTCATGACGT / / / / /// // ////// /// / / BccI | | | ||| || |||||BsrI ||| | TspDTI | | | ||| || ||||CviJI ||| CviRI* | | | ||| || ||||NheI ||TatI | | | ||| || ||||AluI |Csp6I | | | ||| || |||MaeI ScaI | | | ||| || ||BseMII RsaI | | | ||| || ||Cac8I | | | ||| || ||SetI | | | ||| || |BspCNI | | | ||| || BmtI | | | ||| |MnlI | | | ||| MaeII | | | ||TaiI | | | ||SetI | | | |DdeI | | | Hpy188I | | Eco57MI | | GsuI | BccI PsrI P S V S F V P S Q S S S D V A S S S T A H R Y L L F H H R V P Q T L L A P V L Q I G I F C S I T E F L R R C * L Q Y C K ----:----|----:----|----:----|----:----|----:----|----:----| G D T D K T G D C L E E S T A L E L V A G M P I K Q E M V S N R L R Q * S W Y Q W R Y R K N W * L T G * V N S A G T S C SpeI |MaeI || Csp6I || |RsaI || || DdeI || || SauI* TspDTI BseGI Hpy188I AciI || || |SetI MnlI \ \ \ \ \\ \\ \\ \ AATGTAGTTAGTTCATCCTTTTCTGATATTCCACCGCAAACTAGTACCTCAGGGAGCGTA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTACATCAATCAAGTAGGAAAAGACTATAAGGTGGCGTTTGATCATGGAGTCCCTCGCAT / / / / //// / / // FokI BseGI Hpy188I AciI |||| | | |BseMII |||| | | BspCNI |||| | MnlI |||| SauI* |||| DdeI |||Csp6I ||RsaI ||SetI |SpeI MaeI N V V S S S F S D I P P Q T S T S G S V M * L V H P F L I F H R K L V P Q G A * C S * F I L F * Y S T A N * Y L R E R S ----:----|----:----|----:----|----:----|----:----|----:----| F T T L E D K E S I G G C V L V E P L T L H L * N M R K Q Y E V A F * Y R L S R I Y N T * G K R I N W R L S T G * P A Y Hin6I |GlaI ||HhaI BspCNI ||| MwoI HgiCI* |BseMII ||| |AciI SfaNI MnlI MnlI SetI | NlaIV \\ \\\ \\ \ \ \ \ \ \ GTTTCGGTAGCGCAATCCGCATCTGCCCTCGCATTTCAAAGTTCAACAGAGGTATATGGT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAGCCATCGCGTTAGGCGTAGACGGGAGCGTAAAGTTTCAAGTTGTCTCCATATACCA //// / / / / / / |||MwoI AciI | MnlI MnlI SetI NlaIV ||Hin6I SfaNI TspRI |GlaI BsrI HhaI V S V A Q S A S A L A F Q S S T E V Y G F R * R N P H L P S H F K V Q Q R Y M V F G S A I R I C P R I S K F N R G I W C ----:----|----:----|----:----|----:----|----:----|----:----| T E T A C D A D A R A N * L E V S T Y P L K P L A I R M Q G R M E F N L L P I H N R Y R L G C R G E C K L T * C L Y I T AvaI XhoI SmlI PspXI TspRI |TaqI |BmeT110I SfeI* || TspDTI | Tsp4CI* || | SduI | | AccI || | HgiAI* | | |Hpy166II BsrI || | | MnlI | | ||Bce83I* \ \\ \ \ \ \ \ \\\ GCCAGTGCCTCGAGCACAATGAGTTCATTATTATCAACTACTTCGCTACAGTCTACTACT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTCACGGAGCTCGTGTTACTCAAGTAATAATAGTTGATGAAGCGATGTCAGATGATGA / // / // /// HgiCI* || MnlI || ||AccI |PspXI || |Hpy166II |SmlI || Bce83I* |XhoI |SfeI* |AvaI Tsp4CI* BmeT110I HgiAI* TspDTI TaqI SduI A S A S S T M S S L L S T T S L Q S T T P V P R A Q * V H Y Y Q L L R Y S L L L Q C L E H N E F I I I N Y F A T V Y Y F ----:----|----:----|----:----|----:----|----:----|----:----| A L A E L V I L E N N D V V E S C D V V H W H R S C L S N M I I L * K A V T * * G T G R A C H T * * * * S S R * L R S S BseRI | NheI | AluI | CviJI | |HgaI TaqI | |MaeI | MnlI | ||SetI | Hpy99I | ||Cac8I | | Hpy188I AluI | ||| AluI | | | SetI CviJI | ||| BmtI | | | |GsuI |SmlI | ||| CviJI | | | |HgaI ||SetI | ||| | SetI | | | |Eco57MI AcyI \\\ \ \\\ \ \ \ \ \ \\ \ TTGGATAGCTCAAGTTTAGCTAGCTCCTCTGCGTCGAGTTCAGACCTTACAGATTATGGC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTATCGAGTTCAAATCGATCGAGGAGACGCAGCTCAAGTCTGGAATGTCTAATACCG / / / / / /// / / // / / / / | | | | | ||| HgaI | |TaqI | | | HgaI | | | | | ||CviJI | MnlI | | Eco57MI | | | | | ||NheI Hpy99I | | GsuI | | | | | ||AluI | SetI | | | | | |MaeI Hpy188I | | | | | Cac8I | | | | | SetI | | | | CviJI | | | | AluI | | | | BmtI | | | SetI | | BseRI | | SmlI | CviJI | AluI SetI L D S S S L A S S S A S S S D L T D Y G W I A Q V * L A P L R R V Q T L Q I M A G * L K F S * L L C V E F R P Y R L W R ----:----|----:----|----:----|----:----|----:----|----:----| K S L E L K A L E E A D L E S R V S * P K P Y S L N L * S R Q T S N L G * L N H Q I A * T * S A G R R R T * V K C I I A CviJI | DdeI | | Hpy188I | | | MnlI BsrI | | | | TatI |BsmAI | | | | BspCNI |Esp3I | | | | |Csp6I ||TatI | | | | |BseMII |||Csp6I AciI | | | | ||RsaI ||||RsaI Cac8I | NspBII* | | | | ||ScaI \\\\\ \ \ \ \ \ \ \ \\\ GTCTCCAGTACAGCAAGCATACCGCTGTTGTCAGCCTCAGAACAAGCAAGTACTTCCAGC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CAGAGGTCATGTCGTTCGTATGGCGACAACAGTCGGAGTCTTGTTCGTTCATGAAGGTCG / / /// / / / // / // /// | BsrI ||| Cac8I NspBII* | |DdeI | || ||TatI AcyI ||TatI AciI | | | || |Csp6I |Esp3I | | | || ScaI |BsmAI | | | || RsaI |Csp6I | | | |BseMII RsaI | | | BspCNI | | MnlI | Hpy188I CviJI V S S T A S I P L L S A S E Q A S T S S S P V Q Q A Y R C C Q P Q N K Q V L P A L Q Y S K H T A V V S L R T S K Y F Q Q ----:----|----:----|----:----|----:----|----:----|----:----| T E L V A L M G S N D A E S C A L V E L R R W Y L L C V A T T L R L V L L Y K W D G T C C A Y R Q Q * G * F L C T S G A BccI | PsrI | | DdeI | | | Hpy188I MwoI | | | | TstI | PsrI EcoP15I | | | | BsaXI MwoI | CviJI | Hin4II* | | | | | MnlI \ \ \ \ \ \ \ \ \ \ \ AGTTTTAGCGTTGTTAGCCCTTCGGTATCTTTTGTTCCATCACAAAGTTCCTCAGATGTT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAAATCGCAACAATCGGGAAGCCATAGAAAACAAGGTAGTGTTTCAAGGAGTCTACAA / // / // / / /// / MwoI |PsrI CviJI |EcoP15I | BccI ||| MnlI MwoI Hin4II* PsrI ||BsaXI ||DdeI |Hpy188I TstI S F S V V S P S V S F V P S Q S S S D V V L A L L A L R Y L L F H H K V P Q M L F * R C * P F G I F C S I T K F L R C C ----:----|----:----|----:----|----:----|----:----|----:----| L K L T T L G E T D K T G D C L E E S T C N * R Q * G K P I K Q E M V F N R L H T K A N N A R R Y R K N W * L T G * I N NheI |MaeI AarI ||Cac8I SduI BtsI |||BspCNI TspRI BspMI ||||BmtI HgiAI* BsaXI | CviRI* ||||BseMII | FokI | TstI | | Cac8I ||||| BsrI | | TspDTI | | BseGI | | TspRI \\\\\ \ \ \ \ \ \ \ \ \ \ GCTAGCACCAGTGCTCCAAGTGTAGTTAGTTCATCCTTTTCTTATACTTCACTGCAAGCA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CGATCGTGGTCACGAGGTTCACATCAATCAAGTAGGAAAAGAATATGAAGTGACGTTCGT ////// / / / / / / // / / |||||| HgiAI* | | | BseGI TspRI || | SetI |||||| SduI | | BsaXI BtsI || Cac8I |||||TspRI | | TstI |CviRI* |||||BsrI | FokI BspMI ||||NheI TspDTI AarI |||MaeI ||BseMII ||Cac8I |BspCNI BmtI A S T S A P S V V S S S F S Y T S L Q A L A P V L Q V * L V H P F L I L H C K Q * H Q C S K C S * F I L F L Y F T A S R ----:----|----:----|----:----|----:----|----:----|----:----| A L V L A G L T T L E D K E * V E S C A Q * C W H E L H L * N M R K K Y K V A L S A G T S W T Y N T * G K R I S * Q L C SetI TatI | CviJI |Csp6I | | MaeI ||RsaI | | | FatI ||ScaI | | | |CviAII ||| BseMII | | | || NlaIII Ksp632I* ||| |BspCNI | | | || | MboII | MnlI ||| || MnlI | | | || | TspDTI | | SfeI* PsrI ||| || BsrI \ \ \ \\ \ \ \ \ \ \ \\\ \\ \ GGTGGCTCTAGCATGACCAATCCCTCTTCATCAACTATAGTATATTCAAGTAGTACTGGC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCGAGATCGTACTGGTTAGGGAGAAGTAGTTGATATCATATAAGTTCATCATGACCG / // /// // // /// // | || ||MboII || |PsrI ||| |MnlI | || |TspDTI || SfeI* ||| BsrI | || |FatI |Ksp632I* ||TatI | || CviAII MnlI |BspCNI | |NlaIII |Csp6I | MaeI BseMII CviJI ScaI RsaI G G S S M T N P S S S T I V Y S S S T G V A L A * P I P L H Q L * Y I Q V V L A W L * H D Q S L F I N Y S I F K * Y W Q ----:----|----:----|----:----|----:----|----:----|----:----| P P E L M V L G E E D V I T Y E L L V P L H S * C S W D R K M L * L I N L Y Y Q T A R A H G I G R * * S Y Y I * T T S A BbvI | DdeI | |Hpy188I | || TfiI | || HinfI | || | AciI | || | | TseI | || | | NspBII* | || | | |BisI | || | | |PsrI | || | | ||BlsI | || | | |||CviRI* | || | | |||| BcgI | || | | |||| SfeI* | || | | |||| | MwoI | || | | |||| | | AluI | || | | |||| | | CviJI | || | | |||| | | SfaNI | || | | |||| | | | SetI | || | | |||| | | | |AlwNI | || | | |||| | | | || CviRI* | || | | |||| | | | || | BseRI | || | | |||| | | | || | | Tsp4CI* | || | | |||| | | | || | | | TspRI | || | | |||| | | | || | | | | CviJI | || | | |||| | | | || | | | | |NlaIV | || | | |||| | | | || | | | | ||SduI | || | | |||| | | | || | | | | ||HgiJII* | || | | |||| | | | || | | | | ||| AccI | || | | |||| | | | || | | | | ||| |Hpy166II | || | | |||| | | | || | | | | ||| ||BcgI | || | | |||| | | | || | | | | ||| ||| MnlI \ \\ \ \ \\\\ \ \ \ \\ \ \ \ \ \\\ \\\ \ AGTTCTGAGGAATCCGCTGCATCTACAGCTTCTGCAACACTGTCGGGCTCCTCGTCTACT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAGACTCCTTAGGCGACGTAGATGTCGAAGACGTTGTGACAGCCCGAGGAGCAGATGA / // // //// // /// / // / / / // /// / | || || |||| || ||| | || | | | |NlaIV ||| MnlI | || || |||| || ||| | || | | | CviJI ||AccI | || || |||| || ||| | || | | HgiJII* |Hpy166II | || || |||| || ||| | || | | SduI BcgI | || || |||| || ||| | || | Tsp4CI* | || || |||| || ||| | || BseRI | || || |||| || ||| | |TspRI | || || |||| || ||| | CviRI* | || || |||| || ||| SfaNI | || || |||| || ||AlwNI | || || |||| || ||CviJI | || || |||| || ||AluI | || || |||| || |SfeI* | || || |||| || SetI | || || |||| |MwoI | || || |||| BcgI | || || |||CviRI* | || || |||TseI | || || ||BisI | || || |BlsI | || || NspBII* | || || AciI | || |HinfI | || |TfiI | || PsrI | |DdeI | BbvI Hpy188I S S E E S A A S T A S A T L S G S S S T V L R N P L H L Q L L Q H C R A P R L L F * G I R C I Y S F C N T V G L L V Y L ----:----|----:----|----:----|----:----|----:----|----:----| L E S S D A A D V A E A V S D P E E D V C N Q P I R Q M * L K Q L V T P S R T * T R L F G S C R C S R C C Q R A G R R S FokI Hpy188I CviRI* |HinfI | MwoI || SmlI ApoI | | CviJI MnlI || Eco57I TspEI | | | BseGI |BccI Bce83I* || Eco57MI \ \ \ \ \ \\ \ \\ \ TATATGGCAGGAAATTTGCAATCACAGCCTCCATCCACTTCAAGTTTGCTTTCGGAGTCT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| ATATACCGTCCTTTAAACGTTAGTGTCGGAGGTAGGTGAAGTTCAAACGAAAGCCTCAGA / / // / / / / / / // | | |FokI | BseGI | | Bce83I* | |HinfI | | MwoI CviJI | BccI | Eco57MI | CviRI* MnlI | Eco57I TspEI Hpy188I ApoI Y M A G N L Q S Q P P S T S S L L S E S I W Q E I C N H S L H P L Q V C F R S L Y G R K F A I T A S I H F K F A F G V S ----:----|----:----|----:----|----:----|----:----|----:----| * I A P F K C D C G G D V E L K S E S D K Y P L F N A I V A E M W K L N A K P T I H C S I Q L * L R W G S * T Q K R L R AluI CviJI PvuII NspBII* | SetI | | NheI | | |MaeI | | |MwoI | | ||Cac8I | | ||| NheI | | ||| AluI BsmAI | | ||| BmtI |PleI | | ||| CviJI ||AluI | | ||| |MaeI ||MlyI | | ||| ||SetI ||CviJI | | ||| ||Cac8I AarI ||| SetI | | ||| ||| BmtI HphI BspMI \\\ \ \ \ \\\ \\\ \ \ \ CAAGCTACAAGCACTTCAGCTGTGCTAGCTAGCAGTTCTGTTTCTACAACTTCACCCTAT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGATGTTCGTGAAGTCGACACGATCGATCGTCAAGACAAAGATGTTGAAGTGGGATA /// / / / / / /// /// / / ||| BsmAI | | | | ||| ||NheI HphI TspRI ||CviJI | | | | ||| |MaeI BtsI ||PleI | | | | ||| Cac8I ||MlyI | | | | ||CviJI ||AluI | | | | ||NheI |SmlI | | | | ||AluI SetI | | | | ||BmtI | | | | |MaeI | | | | Cac8I | | | | SetI | | | BmtI | | MwoI | NspBII* | PvuII | CviJI | AluI SetI Q A T S T S A V L A S S S V S T T S P Y K L Q A L Q L C * L A V L F L Q L H P I S Y K H F S C A S * Q F C F Y N F T L Y ----:----|----:----|----:----|----:----|----:----|----:----| * A V L V E A T S A L L E T E V V E G * E L * L C K L Q A L * C N Q K * L K V R L S C A S * S H * S A T R N R C S * G I BtsI | SfeI* | | CviRI* | | | PstI | | | TspRI | | | | SetI | | | | |MwoI | | | | |BstAPI | | | | || Hin4I | | | | || CviRI* | | | | || | FokI | | | | || | MnlI | | | | || | | SfeI* | | | | || | | | SfaNI | | | | || | | | | StuI | | | | || | | | | CviJI | | | | || | | | | HaeIII MnlI | | | | || | | | | | BseGI MnlI | Hin4I AciI \ \ \ \ \\ \ \ \ \ \ \ \ \ \ \ ACCACTGCAGGTGGTGCATCTACAGAGGCCTCATCCCTCATATCATCTACATCTGCGGAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TGGTGACGTCCACCACGTAGATGTCTCCGGAGTAGGGAGTATAGTAGATGTAGACGCCTT / / ///// // / / // / / / / | | ||||| |MnlI | | |SfaNI MnlI | MnlI AciI | | ||||| | | | |BseGI Hin4I | | ||||| | | | HaeIII | | ||||| | | | CviJI | | ||||| | | | StuI | | ||||| | | SfeI* | | ||||| | FokI | | ||||| CviRI* | | ||||Hin4I | | |||BstAPI | | |||MwoI | | ||SfeI* | | |SetI | | CviRI* | PstI BspMI AarI T T A G G A S T E A S S L I S S T S A E P L Q V V H L Q R P H P S Y H L H L R K H C R W C I Y R G L I P H I I Y I C G N ----:----|----:----|----:----|----:----|----:----|----:----| V V A P P A D V S A E D R M D D V D A S Y W Q L H H M * L P R M G * I M * M Q P G S C T T C R C L G * G E Y * R C R R F BssKI SecI* EcoRII | ScrFI BsrDI MboII | BseBI CviRI* BbvII* | | SetI | CviRI* | MnlI \ \ \ \ \ \ \ ACTTCCCAGGTAAGTTATTCACAAAGCACAACTGCATTGCAAACTTCCTCATTCGCATCG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGGGTCCATTCAATAAGTGTTTCGTGTTGACGTAACGTTTGAAGGAGTAAGCGTAGC //// / / / / // |||EcoRII | | CviRI* | |BbvII* |||BssKI | CviRI* | MnlI ||SecI* BsrDI MboII |BseBI |ScrFI SetI T S Q V S Y S Q S T T A L Q T S S F A S L P R * V I H K A Q L H C K L P H S H R F P G K L F T K H N C I A N F L I R I V ----:----|----:----|----:----|----:----|----:----|----:----| V E W T L * E C L V V A N C V E E N A D F K G P L N N V F C L Q M A F K R M R M S G L Y T I * L A C S C Q L S G * E C R AluI SfaNI CviJI | Hin4II* MaeI SetI | SetI \ \ \ \ \ \ TCTTCAACAACAGAAGGAAGTGAAACATCTAGTCAAGGTTTTTCTACCAGCTCTGTTTTA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGTTGTTGTCTTCCTTCACTTTGTAGATCAGTTCCAAAAAGATGGTCGAGACAAAAT / / / / / / | SfaNI | SetI | CviJI Hin4II* MaeI | AluI SetI S S T T E G S E T S S Q G F S T S S V L L Q Q Q K E V K H L V K V F L P A L F * F N N R R K * N I * S R F F Y Q L C F S ----:----|----:----|----:----|----:----|----:----|----:----| D E V V S P L S V D L * P K E V L E T K T K L L L L F H F M * D L N K * W S Q K R * C C F S T F C R T L T K R G A R N * TaqI | Hin4II* BspCNI | | HphI Hin4I |BseMII | | | ApoI | DdeI || ApoI | | | TspEI | | Hpy188I || TspEI MboII | | | EcoRI | | | MnlI || EcoRI \ \ \ \ \ \ \ \ \ \\ \ GTTCAAATGCCTTCTTCGATTTCCAGCGAATTCTCACCCTCTCAGACGACAACTCAAATG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGTTTACGGAAGAAGCTAAAGGTCGCTTAAGAGTGGGAGAGTCTGCTGTTGAGTTTAC / // / // // / // MboII || HphI |EcoRI || MnlI |BseMII |Hin4II* |TspEI |DdeI BspCNI TaqI |ApoI Hpy188I Hin4I V Q M P S S I S S E F S P S Q T T T Q M F K C L L R F P A N S H P L R R Q L K * S N A F F D F Q R I L T L S D D N S N E ----:----|----:----|----:----|----:----|----:----|----:----| T * I G E E I E L S N E G E * V V V * I L E F A K K S K W R I R V R E S S L E F N L H R R R N G A F E * G R L R C S L H DdeI |FokI CviRI* || TatI |Hin4I || |Csp6I AccI ||Cac8I || ||RsaI BsrI ||| AluI || |||Hpy166II TspRI ||| CviJI || |||| BspCNI |BssNAI ||| | SetI || |||| |BseGI |Hpy166II ||| | TspDTI || |||| |BseMII || DdeI SetI \\\ \ \ \\ \\\\ \\ \\ \ \ AATTCTGCAAGCTCATCATCTCAGTACACTATATCATCCACTGGTATACTTTCTCAGGTT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGACGTTCGAGTAGTAGAGTCATGTGATATAGTAGGTGACCATATGAAAGAGTCCAA // / / / / /// // / / // // || | | TspDTI | ||| || TspRI | |AccI |DdeI || | | CviJI | ||| |BseMII | Hpy166II SetI || | | AluI | ||| |BseGI | BssNAI || | Cac8I | ||| BspCNI BsrI || | SetI | ||TatI || CviRI* | |Hpy166II |EcoRI | |Csp6I |TspEI | RsaI |ApoI | FokI Hin4I DdeI N S A S S S S Q Y T I S S T G I L S Q V I L Q A H H L S T L Y H P L V Y F L R F F C K L I I S V H Y I I H W Y T F S G F ----:----|----:----|----:----|----:----|----:----|----:----| F E A L E D D * Y V I D D V P I S E * T S N Q L S M M E T C * I M W Q Y V K E P I R C A * * R L V S Y * G S T Y K R L N Hpy188I | BspCNI | |BseMII | || OliI | || MslI Bce83I* SmlI Hpy188I \ \\ \ \ \ \ TCAGACACATCGGTGTCTTATACAACTTCAAGTTCGTCTGTTTCTCAAGTTTCAGACACA 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCTGTGTAGCCACAGAATATGTTGAAGTTCAAGCAGACAAAGAGTTCAAAGTCTGTGT / // / / / / / | || MslI Bce83I* SmlI | BsrI | || OliI Hpy188I | |BseMII | BspCNI Hpy188I S D T S V S Y T T S S S S V S Q V S D T Q T H R C L I Q L Q V R L F L K F Q T H R H I G V L Y N F K F V C F S S F R H T ----:----|----:----|----:----|----:----|----:----|----:----| E S V D T D * V V E L E D T E * T E S V K L C M P T K Y L K L N T Q K E L K L C * V C R H R I C S * T R R N R L N * V C Hpy188I | AgeI | BetI* | Cfr10I BsrI Bce83I* SmlI | |HpaII \ \ \ \ \\ CCAGTTTCTTATACAACTTCAAGTTCGTCTGTTTCTCAAGTTTCAGACACACCGGTTTCT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCAAAGAATATGTTGAAGTTCAAGCAGACAAAGAGTTCAAAGTCTGTGTGGCCAAAGA / / / // Bce83I* SmlI Hpy188I |Cfr10I |BetI* |AgeI HpaII P V S Y T T S S S S V S Q V S D T P V S Q F L I Q L Q V R L F L K F Q T H R F L S F L Y N F K F V C F S S F R H T G F L ----:----|----:----|----:----|----:----|----:----|----:----| G T E * V V E L E D T E * T E S V G T E V L K K Y L K L N T Q K E L K L C V P K W N R I C S * T R R N R L N * V C R N R Hpy188I Bce83I* SmlI | BsrI TspDTI \ \ \ \ \ TATACAACTTCAAGTTCGTCTGTTTCTCAAGTTTCAGACACACCAGTTTCTTATACAACT 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| ATATGTTGAAGTTCAAGCAGACAAAGAGTTCAAAGTCTGTGTGGTCAAAGAATATGTTGA / / / / / / Bce83I* SmlI | BsrI | Bce83I* Hpy188I TspDTI Y T T S S S S V S Q V S D T P V S Y T T I Q L Q V R L F L K F Q T H Q F L I Q L Y N F K F V C F S S F R H T S F L Y N F ----:----|----:----|----:----|----:----|----:----|----:----| * V V E L E D T E * T E S V G T E * V V K Y L K L N T Q K E L K L C V L K K Y L I C S * T R R N R L N * V C W N R I C S Hpy188I | AgeI | BetI* | Cfr10I TspGWI Bce83I* SmlI | |HpaII | Bce83I* \ \ \ \\ \ \ TCAAGTTCATCTGTTTCTCAAGTTTCAGACACACCGGTTTCTTATACAACTTCAAGTTCG 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTCAAGTAGACAAAGAGTTCAAAGTCTGTGTGGCCAAAGAATATGTTGAAGTTCAAGC / / // / / SmlI Hpy188I |Cfr10I | Bce83I* |BetI* TspGWI |AgeI HpaII S S S S V S Q V S D T P V S Y T T S S S Q V H L F L K F Q T H R F L I Q L Q V R K F I C F S S F R H T G F L Y N F K F V ----:----|----:----|----:----|----:----|----:----|----:----| E L E D T E * T E S V G T E * V V E L E K L N M Q K E L K L C V P K K Y L K L N * T * R N R L N * V C R N R I C S * T R Hpy188I | AflIII Hin4II* | | MaeII |TspGWI | | |BtrI || BaeI | | || SetI || Bce83I* | | || TaiI || Hpy178III* | | || | Csp6I || | MboI SmlI | | || | |RsaI || | | DpnI | BaeI | | || | || SetI || | | |BstKTI SmlI \ \ \ \ \\ \ \\ \ \\ \ \ \\ \ TCCGTTTCTCAAGTTTCAGACACGTCAGTACCTTCTACAAGTTCCAGATCGTCCGTTTCT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCAAAGAGTTCAAAGTCTGTGCAGTCATGGAAGATGTTCAAGGTCTAGCAGGCAAAGA / / / / // // // / /// / BaeI SmlI | | || |Csp6I || | ||| MboI | | || RsaI || | ||DpnI | | || SetI || | |BstKTI | | |AflIII || | Hpy178III* | | |MaeII || Bce83I* | | BtrI |Hin4II* | TaiI |TspGWI | SetI BaeI Hpy188I S V S Q V S D T S V P S T S S R S S V S P F L K F Q T R Q Y L L Q V P D R P F L R F S S F R H V S T F Y K F Q I V R F S ----:----|----:----|----:----|----:----|----:----|----:----| D T E * T E S V D T G E V L E L D D T E T R K E L K L C T L V K * L N W I T R K G N R L N * V R * Y R R C T G S R G N R DdeI | BsmAI | Hpy188I | | BetI* | | |OliI | | |MslI | | |HpaII | | || HgiCI* | | || |BspCNI | | || ||NlaIV Hin4II* | | || ||BseMII |TspGWI SetI MaeI \ \ \\ \\\ \\ \ \ CAAGTCTCAGACACTCCGGTGCCTTCTACAAGTTCAAGGTCGTCCGTTTCTCAAACATCT 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCAGAGTCTGTGAGGCCACGGAAGATGTTCAAGTTCCAGCAGGCAAAGAGTTTGTAGA / // / ///// / / / / SmlI || | ||||| HgiCI* | SetI SetI || | ||||NlaIV Hin4II* || | |||BetI* TspGWI || | ||BseMII || | ||HpaII || | |BspCNI || | MslI || | OliI || BsmAI |DdeI Hpy188I Q V S D T P V P S T S S R S S V S Q T S K S Q T L R C L L Q V Q G R P F L K H L S L R H S G A F Y K F K V V R F S N I * ----:----|----:----|----:----|----:----|----:----|----:----| * T E S V G T G E V L E L D D T E * V D E L R L C E P A K * L N L T T R K E F M L D * V S R H R R C T * P R G N R L C R FatI AluI HphI |CviAII CviJI | AclI || NlaIII | SetI | MaeII || | Hin6I | | SfeI* | | SetI || | |GlaI | | | FokI | | TaiI || | |Eco47III | | | | CviJI BseGI | | MnlI || | ||HhaI \ \ \ \ \ \ \ \ \ \\ \ \\\ AGCTCACTACAGCCCACCACTACATCCTCCCAACGTTTCACCATTTCCACTCATGGAGCG 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TCGAGTGATGTCGGGTGGTGATGTAGGAGGGTTGCAAAGTGGTAAAGGTGAGTACCTCGC // /// / / / / / // //// |CviJI ||FokI BseGI | | MaeII | || |||Hin6I |AluI |CviJI | | MnlI | || ||Eco47III MaeI SfeI* | | AclI | || ||GlaI | TaiI | || |HhaI | SetI | || HaeII HphI | |FatI | CviAII NlaIII S S L Q P T T T S S Q R F T I S T H G A A H Y S P P L H P P N V S P F P L M E R L T T A H H Y I L P T F H H F H S W S A ----:----|----:----|----:----|----:----|----:----|----:----| L E S C G V V V D E W R K V M E V * P A * S V V A W W * M R G V N * W K W E H L A * * L G G S C G G L T E G N G S M S R CviJI | BseMII | |BspCNI | || HindIII | || | AluI | || | CviJI | || | | SetI MaeI | || | | | DdeI | AluI HaeII | || | | | |Hpy188I | CviJI | Hpy188I | || | | | ||TsoI | | SetI CviRI* \ \ \ \\ \ \ \ \\\ \ \ \ \ CTTTCTGAAAGTAGTTCTGTTAGCCAACAAGCTTCTGAGATTACTAGCTCAATCAATGCA 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| GAAAGACTTTCATCAAGACAATCGGTTGTTCGAAGACTCTAATGATCGAGTTAGTTACGT / /// / / / / / /// / Hpy188I ||| | | | | DdeI ||CviJI CviRI* ||| | | | Hpy188I ||AluI ||| | | | TsoI |MaeI ||| | | HindIII SetI ||| | CviJI ||| | AluI ||| SetI ||BspCNI |BseMII CviJI L S E S S S V S Q Q A S E I T S S I N A F L K V V L L A N K L L R L L A Q S M Q F * K * F C * P T S F * D Y * L N Q C N ----:----|----:----|----:----|----:----|----:----|----:----| S E S L L E T L W C A E S I V L E I L A A K Q F Y N Q * G V L K Q S * * S L * H K R F T T R N A L L S R L N S A * D I C BseGI | Hpy178III* | | SfaNI | | | AciI | | | SecI* | | | DsaI* | | | | AciI | | | | FnuDII* | | | | NspBII* AluI | | | | |BisI CviJI | | | | |SacII | SetI | | | | ||BlsI | |FokI | | | | |||TauI | || Hpy188I | | | | |||CviJI \ \\ \ \ \ \ \ \\\\ ACAGCTTCCGAATACCATAGCATCCAGACAACCGCGGCTACTCAATCCACAACTCTATCT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCGAAGGCTTATGGTATCGTAGGTCTGTTGGCGCCGATGAGTTAGGTGTTGAGATAGA / / / / / / ///// | | | FokI BseGI | ||||CviJI | | Hpy188I | |||DsaI* | CviJI | |||SecI* | AluI | |||BisI SetI | |||AciI | ||BlsI | |NspBII* | |FnuDII* | |AciI | |TauI | SfaNI | SacII Hpy178III* T A S E Y H S I Q T T A A T Q S T T L S Q L P N T I A S R Q P R L L N P Q L Y L S F R I P * H P D N R G Y S I H N S I F ----:----|----:----|----:----|----:----|----:----|----:----| V A E S Y W L M W V V A A V * D V V R D L L K R I G Y C G S L R P * E I W L E I C S G F V M A D L C G R S S L G C S * R EcoP15I | MaeII | | AjuI | | |AccI | | |SetI | | |TaiI Hpy99I AciI | | ||Hpy166II | HgaI | BsrBI | | ||| MboII \ \ \ \ \ \ \\\ \ TTTACCGACGCAAACAGCAGTTCTGCTTCCGCTCCATTGGAAGTGGCAACGTCTACGCCA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AAATGGCTGCGTTTGTCGTCAAGACGAAGGCGAGGTAACCTTCACCGTTGCAGATGCGGT / / / /// / // / Hpy99I HgaI BsrBI ||| | || MboII AciI ||| | |AccI ||| | Hpy166II ||| MaeII ||TaiI ||SetI |EcoP15I AjuI F T D A N S S S A S A P L E V A T S T P L P T Q T A V L L P L H W K W Q R L R Q Y R R K Q Q F C F R S I G S G N V Y A N ----:----|----:----|----:----|----:----|----:----|----:----| K V S A F L L E A E A G N S T A V D V G K * R R L C C N Q K R E M P L P L T * A K G V C V A T R S G S W Q F H C R R R W AjuI | SfaNI BccI | | FokI BseGI FokI | BseGI | | MnlI | BccI MseI MnlI \ \ \ \ \ \ \ \ \ \ ACCCCATCTTCAAAGGCATCCTCTCTGTTGCTTACACCATCAACATCCTCTTTAAGTCAG 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TGGGGTAGAAGTTTCCGTAGGAGAGACAACGAATGTGGTAGTTGTAGGAGAAATTCAGTC / // / / / / / / / / FokI || AjuI | FokI | BccI | | SetI |BseGI SfaNI BseGI | MnlI BccI MnlI MseI T P S S K A S S L L L T P S T S S L S Q P H L Q R H P L C C L H H Q H P L * V R P I F K G I L S V A Y T I N I L F K S G ----:----|----:----|----:----|----:----|----:----|----:----| V G D E F A D E R N S V G D V D E K L * L G M K L P M R E T A * V M L M R K L D G W R * L C G R Q Q K C W * C G R * T L TatI Hpy99I Bsp1407I TfiI | McrI* |Csp6I HinfI | |Tsp4CI* SetI ||RsaI MseI | TaqI | ||TspGWI \ \\\ \ \ \ \ \\\ GTTGCTACAAATACTAATGTACAGACGAGTTTAACAACGGAATCGACGACCGTTTTAGAA 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGATGTTTATGATTACATGTCTGCTCAAATTGTTGCCTTAGCTGCTGGCAAAATCTT /// / / / / / ||Bsp1407I MseI | | | Tsp4CI* ||TatI | | | TspGWI |Csp6I | | McrI* RsaI | TaqI Hpy99I HinfI TfiI V A T N T N V Q T S L T T E S T T V L E L L Q I L M Y R R V * Q R N R R P F * N C Y K Y * C T D E F N N G I D D R F R T ----:----|----:----|----:----|----:----|----:----|----:----| T A V F V L T C V L K V V S D V V T K S P Q * L Y * H V S S N L L P I S S R K L N S C I S I Y L R T * C R F R R G N * F Tsp4CI* | BsrI | | Csp6I | | |RsaI | | ||MaeII | | ||| SetI MaeIII MaeIII MfeI BccI | | ||| TaiI Tsp45I Tsp45I TspEI \ \ \ \\\ \ \ \ \ CCATCAACGACTAACAGTTCCAGTACGTTTAGTCTGGTCACTTCAAGTGACAACAATTGG 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGTTGCTGATTGTCAAGGTCATGCAAATCAGACCAGTGAAGTTCACTGTTGTTAACC / / / // / / / / / BccI | BsrI || MaeII Tsp45I Tsp45I | BseMII Tsp4CI* |Csp6I MaeIII MaeIII TspEI RsaI MfeI TaiI SetI P S T T N S S S T F S L V T S S D N N W H Q R L T V P V R L V W S L Q V T T I G I N D * Q F Q Y V * S G H F K * Q Q L V ----:----|----:----|----:----|----:----|----:----|----:----| G D V V L L E L V N L R T V E L S L L Q V M L S * C N W Y T * D P * K L H C C N W * R S V T G T R K T Q D S * T V V I P BbvI | Cac8I | |FokI | |HgiCI* | || NlaIV | || | MmeI | || | | MwoI | || | | | TseI | || | | | AluI | || | | | CviJI | || | | | AlwNI | || | | | |BisI | || | | | ||BlsI | || | | | ||SetI | || | | | |||BseGI | || | | | |||CviRI* | || | | | |||| MmeI | || | | | |||| | BtsI | || | | | |||| | MboII | || | | | |||| | | MwoI BseMII | || | | | |||| | | BstAPI |TfiI | || | | | |||| | | | SfaNI MnlI |HinfI | || | | | |||| | | | CviRI* SfaNI |BspCNI DdeI MseI | || | | | |||| | | | | TspRI | Tsp4CI* \\ \ \ \ \\ \ \ \ \\\\ \ \ \ \ \ \ \ TGGATTCCAACTGAGTTAATCACGCAGGCACCAGAAGCTGCATCCACTGCATCTTCTACC 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTAAGGTTGACTCAATTAGTGCGTCCGTGGTCTTCGACGTAGGTGACGTAGAAGATGG / / / / / // / // //// // / / / / | HinfI | MseI | || | || |||| || | | | Tsp4CI* | TfiI DdeI | || | || |||| || | | MnlI BspCNI | || | || |||| || | SfaNI | || | || |||| || CviRI* | || | || |||| |BstAPI | || | || |||| |MboII | || | || |||| |MwoI | || | || |||| TspRI | || | || |||| BtsI | || | || |||CviRI* | || | || |||TseI | || | || |||MmeI | || | || ||BisI | || | || |BseGI | || | || |BlsI | || | || CviJI | || | || AluI | || | |SetI | || | AlwNI | || HgiCI* | || MwoI | || FokI | |NlaIV | |MmeI | BbvI Cac8I W I P T E L I T Q A P E A A S T A S S T G F Q L S * S R R H Q K L H P L H L L P D S N * V N H A G T R S C I H C I F Y R ----:----|----:----|----:----|----:----|----:----|----:----| H I G V S N I V C A G S A A D V A D E V T S E L Q T L * A P V L L Q M W Q M K * P N W S L * D R L C W F S C G S C R R G FatI |CviAII || CviRI* || NlaIII || |MfeI || |TspEI || || TseI || || MwoI || || CviRI* || || |BisI || || ||BlsI || || |||CviJI || || ||||AciI || || ||||BisI || || |||||BlsI || || ||||||TauI || || ||||||FnuDII* || || ||||||| BbvI || || ||||||| | BseMII || || ||||||| | |BspCNI || || ||||||| | ||AvaI || || ||||||| | ||Hpy178III* || || ||||||| | |||BmeT110I || || ||||||| | ||||MnlI \\ \\ \\\\\\\ \ \\\\\ GTTGGAGGAACACAAACTATGACTTTGCCCCATGCAATTGCAGCCGCGACACAAGTTCCC 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| CAACCTCCTTGTGTTTGATACTGAAACGGGGTACGTTAACGTCGGCGCTGTGTTCAAGGG / / // / //////// /// // SfaNI | || | |||||||FnuDII* ||| |Hpy178III* | || | |||||||AciI ||| MnlI | || | ||||||BisI ||BbvI | || | |||||BlsI |BspCNI | || | ||||CviJI BseMII | || | ||||TseI | || | ||||TauI | || | |||BisI | || | ||BlsI | || | |CviRI* | || | TspEI | || | MfeI | || MwoI | |CviRI* | |FatI | CviAII NlaIII V G G T Q T M T L P H A I A A A T Q V P L E E H K L * L C P M Q L Q P R H K F P W R N T N Y D F A P C N C S R D T S S R ----:----|----:----|----:----|----:----|----:----|----:----| T P P V C V I V K G W A I A A A V C T G R Q L F V F * S K A G H L Q L R S V L E N S S C L S H S Q G M C N C G R C L N G HindIII CviJI | AluI | DdeI | CviJI ApoI | SauI* CviJI | | SetI TspEI \ \ \ \ \ \ \ GAGCCTGAGGGCTACACCCTAATCACAATAGGGTTCAAAAAAGCTTTGAACTACGAATTT 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGGACTCCCGATGTGGGATTAGTGTTATCCCAAGTTTTTTCGAAACTTGATGCTTAAA /// / / / / / / ||| | CviJI | | HindIII TspEI ||| SauI* | CviJI ApoI ||| DdeI | AluI ||CviJI SetI |AvaI BmeT110I E P E G Y T L I T I G F K K A L N Y E F S L R A T P * S Q * G S K K L * T T N L A * G L H P N H N R V Q K S F E L R I C ----:----|----:----|----:----|----:----|----:----|----:----| S G S P * V R I V I P N L F A K F * S N R A Q P S C G L * L L T * F L K S S R I L R L A V G * D C Y P E F F S Q V V F K AluI CviJI MboII | SetI Hpy188I |CviJI BciVI Hpy188I | | Hpy188I \ \\ \ \ \ \ \ GTTGTATCAGAACCAAAATCATCGGCTCAAATCTTCGGATACTTGCCTGAAGCTCTGAAC 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| CAACATAGTCTTGGTTTTAGTAGCCGAGTTTAGAAGCCTATGAACGGACTTCGAGACTTG / / / / / / / / Hpy188I | | BciVI Hpy188I | | Hpy188I | CviJI | CviJI MboII | AluI SetI V V S E P K S S A Q I F G Y L P E A L N L Y Q N Q N H R L K S S D T C L K L * T C I R T K I I G S N L R I L A * S S E H ----:----|----:----|----:----|----:----|----:----|----:----| T T D S G F D D A * I K P Y K G S A R F Q Q I L V L I M P E F R R I S A Q L E S N Y * F W F * R S L D E S V Q R F S Q V SetI | MseI | Eco57I | Eco57MI | | MaeII | | | XmnI Tsp4CI* | | | |SetI |Csp6I MlyI | | | |TaiI ||RsaI PleI \ \ \ \\ \\\ \ ACACCTTTTAAGAACGTATTCACAAACATTACGGTACTACAAATAGTGCCATTACAGGAT 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGGAAAATTCTTGCATAAGTGTTTGTAATGCCATGATGTTTATCACGGTAATGTCCTA / / / / / / // // | | | | MaeII | |Csp6I |PleI | | | | XmnI | RsaI MlyI | | | TaiI Tsp4CI* | | | SetI | | MseI | Eco57MI | Eco57I SetI T P F K N V F T N I T V L Q I V P L Q D H L L R T Y S Q T L R Y Y K * C H Y R M T F * E R I H K H Y G T T N S A I T G * ----:----|----:----|----:----|----:----|----:----|----:----| V G K L F T N V F M V T S C I T G N C S C V K * S R I * L C * P V V F L A M V P C R K L V Y E C V N R Y * L Y H W * L I SfeI* | Hin4I | CviRI* | |Eco57I AccI | |Eco57MI HinfI |BssNAI | ||MnlI | BseGI FokI DdeI |Hpy166II | ||PstI \ \ \ \ \\ \ \\\ GACTCACTCAACTACTTAGTAAGTGTTGCTGAAGTATACTTTCCAACTGCAGAAATAGAG 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAGTGAGTTGATGAATCATTCACAACGACTTCATATGAAAGGTTGACGTCTTTATCTC / / / / // / ///// | HinfI | DdeI |AccI | ||||SfeI* BseGI FokI | | |||MnlI | | ||CviRI* | | |Eco57MI | | |Eco57I | | PstI | Hin4I Hpy166II BssNAI D S L N Y L V S V A E V Y F P T A E I E T H S T T * * V L L K Y T F Q L Q K * R L T Q L L S K C C * S I L S N C R N R G ----:----|----:----|----:----|----:----|----:----|----:----| S E S L * K T L T A S T Y K G V A S I S H S V * S S L L H Q Q L I S E L Q L F L V * E V V * Y T N S F Y V K W S C F Y L Ksp632I* | Hin6I BseGI | |GlaI | Csp6I AluI BseRI | |Eco47III | |RsaI CviJI |TspEI | ||HhaI | ||FokI | SetI || MboII | |||HaeII | ||TspGWI | | MmeI || | Hin4I | |||| BccI | ||| BbvI \ \ \ \\ \ \ \ \\\\ \ \ \\\ \ GAGCTGTCAAATCTAATTACCAACTCTTCAAGCGCTTTTTACACGGATGGAATGGGTACA 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGACAGTTTAGATTAATGGTTGAGAAGTTCGCGAAAAATGTGCCTACCTTACCCATGT / / / / / / //// / / /// | | MmeI | | TspEI |||Hin6I BccI BseGI ||Csp6I | CviJI | Hin4I ||Ksp632I* |RsaI | AluI | MboII ||Eco47III TspGWI SetI BseRI ||GlaI |HhaI HaeII E L S N L I T N S S S A F Y T D G M G T S C Q I * L P T L Q A L F T R M E W V Q A V K S N Y Q L F K R F L H G W N G Y S ----:----|----:----|----:----|----:----|----:----|----:----| S S D F R I V L E E L A K * V S P I P V P A T L D L * W S K L R K K C P H F P Y L Q * I * N G V R * A S K V R I S H T C AciI | MnlI TseI | | BsiYI* CviJI | | | AsuI* |BisI BsrDI | | | |BmgT120I ||BlsI | TfiI | | | ||CviJI |||CviRI* | HinfI | | | ||HaeIII MnlI \\\\ \ \ \ \ \ \\\ \ GCAAAATCTATGGCTGCAATGGTTGATTCCTCAATACCGCTAACGGGCCTCTTACACGAT 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTTAGATACCGACGTTACCAACTAAGGAGTTATGGCGATTGCCCGGAGAATGTGCTA / / //// / / /// // / | BbvI |||| BsrDI HinfI ||BsiYI* |AsuI* MnlI FokI |||CviRI* TfiI |AciI BmgT120I |||TseI MnlI HaeIII ||BisI CviJI |BlsI CviJI A K S M A A M V D S S I P L T G L L H D Q N L W L Q W L I P Q Y R * R A S Y T I K I Y G C N G * F L N T A N G P L T R * ----:----|----:----|----:----|----:----|----:----|----:----| A F D I A A I T S E E I G S V P R K C S L L I * P Q L P Q N R L V A L P G R V R C F R H S C H N I G * Y R * R A E * V I MwoI MboII | AciI | | MboI | | BsaXI | | Hin4I | | XhoII | | | DpnI | | | |BstKTI | | | || GsuI | | | || Eco57MI | | | || | BinI* | | | || | |BseRI | | | || | |BinI* | | | || | |Hpy188I | | | || | || MboI | | | || | || BamHI | | | || | || XhoII | | | || | || |EciI | | | || | || ||DpnI | | | || | || ||NlaIV | | | || | || |||BstKTI | | | || | || |||| BinI* | | | || | || |||| | BsrI | | | || | || |||| | | TspGWI | | | || | || |||| | | |MnlI | | | || | || |||| | | |TspEI | | | || | || |||| | | || Eco57I | | | || | || |||| | | || Eco57MI | | | || | || |||| | | || |MnlI | | | || | || |||| | | || ||TaqI | | | || | || |||| | | || ||AsuII | | | || | || |||| | | || ||BsaXI | | | || | || |||| | | || ||| Hin4I | | | || | || |||| | | || ||| | MboII | | | || | || |||| | | || ||| | |DdeI | | | || | || |||| | | || ||| | || Hpy178III* | | | || | || |||| | | || ||| | || | MboI | | | || | || |||| | | || ||| | || | XhoII MaeIII | | | || | || |||| | | || ||| | || | | DpnI \ \ \ \ \\ \ \\ \\\\ \ \ \\ \\\ \ \\ \ \ \ AGTAACAGCAACTCTGGCGGATCTTCGGACGGATCCTCCTCCAGTAATTCGAACTCAGGA 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| TCATTGTCGTTGAGACCGCCTAGAAGCCTGCCTAGGAGGAGGTCATTAAGCTTGAGTCCT / / // / ///// //// / // / // / //// / // //// | | || | ||||| |||| | || | || | |||| | || |||DpnI | | || | ||||| |||| | || | || | |||| | || ||BstKTI | | || | ||||| |||| | || | || | |||| | || |Hpy178III* | | || | ||||| |||| | || | || | |||| | || DdeI | | || | ||||| |||| | || | || | |||| | |MboII | | || | ||||| |||| | || | || | |||| | AsuII | | || | ||||| |||| | || | || | |||| | TaqI | | || | ||||| |||| | || | || | |||| TspEI | | || | ||||| |||| | || | || | |||MnlI | | || | ||||| |||| | || | || | ||Hin4I | | || | ||||| |||| | || | || | ||BsaXI | | || | ||||| |||| | || | || | |Eco57MI | | || | ||||| |||| | || | || | |Eco57I | | || | ||||| |||| | || | || | MnlI | | || | ||||| |||| | || | || TspGWI | | || | ||||| |||| | || | |BinI* | | || | ||||| |||| | || | BsrI | | || | ||||| |||| | || XhoII | | || | ||||| |||| | || BamHI | | || | ||||| |||| | || MboI | | || | ||||| |||| | |NlaIV | | || | ||||| |||| | |DpnI | | || | ||||| |||| | BstKTI | | || | ||||| |||| EciI | | || | ||||| |||BinI* | | || | ||||| ||BinI* | | || | ||||| |Hpy188I | | || | ||||| BseRI | | || | ||||XhoII | | || | ||||MboI | | || | |||Eco57MI | | || | |||GsuI | | || | ||DpnI | | || | |BstKTI | | || | AciI | | || BsaXI | | |Hin4I | | MboII | MwoI MaeIII S N S N S G G S S D G S S S S N S N S G V T A T L A D L R T D P P P V I R T Q D * Q Q L W R I F G R I L L Q * F E L R I ----:----|----:----|----:----|----:----|----:----|----:----| L L L L E P P D E S P D E E L L E F E P Y Y C C S Q R I K P R I R R W Y N S S L T V A V R A S R R V S G G G T I R V * S BstKTI | BinI* | |BspCNI | ||BseMII | |||SetI | |||| Hpy178III* | |||| | MboI | |||| | XhoII BetI* | |||| | | DpnI BetI* BspMII* | |||| | | |BstKTI |MboII |HpaII | |||| | | || TspEI |HpaII |Hpy178III* | |||| | | || | BinI* |TspDTI || ApoI | |||| | | || | |TaqI |BbvII* || TspEI | |||| | | || | |AsuII || MboII || | SfaNI \ \\\\ \ \ \\ \ \\ \\ \ \\ \ \ TCTTCAGGTTCAGGATCTAATTCGAACTCCGGTGTGTCTTCATCTTCCGGAAATTCCTAT 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGTCCAAGTCCTAGATTAAGCTTGAGGCCACACAGAAGTAGAAGGCCTTTAAGGATA / /// /// / / / // //// // / / | ||BinI* ||| | | | || |||MboII || | SfaNI | |BseMII ||| | | | || ||BbvII* || TspEI | BspCNI ||| | | | || |BetI* || ApoI | SetI ||| | | | || HpaII |BspMII* XhoII ||| | | | |MboII |BetI* MboI ||| | | | TspDTI Hpy178III* ||| | | AsuII HpaII ||| | | TaqI ||| | BinI* ||| | TspEI ||| XhoII ||| MboI ||DpnI |BstKTI Hpy178III* S S G S G S N S N S G V S S S S G N S Y L Q V Q D L I R T P V C L H L P E I P I F R F R I * F E L R C V F I F R K F L S ----:----|----:----|----:----|----:----|----:----|----:----| D E P E P D L E F E P T D E D E P F E * I K L N L I * N S S R H T K M K R F N R R * T * S R I R V G T H R * R G S I G I Hpy178III* | Cfr10I | |HpaII | || Csp6I | || |FokI MaeII | || |RsaI SspI | SetI MaeI | || || TspDTI | BseGI | TaiI |BciVI \ \\ \\ \ \ \ \ \ \\ CAAGATGCCGGTACTTTGGAATATTCATCCAAATCTAACTCCAACGTATCCACTTCTAGC 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTACGGCCATGAAACCTTATAAGTAGGTTTAGATTGAGGTTGCATAGGTGAAGATCG / //// / // / / / / | |||| FokI |BseGI | MaeII | MaeI | |||Csp6I SspI TaiI BciVI | ||TspDTI SetI | ||RsaI | |Cfr10I | HpaII Hpy178III* Q D A G T L E Y S S K S N S N V S T S S K M P V L W N I H P N L T P T Y P L L A R C R Y F G I F I Q I * L Q R I H F * Q ----:----|----:----|----:----|----:----|----:----|----:----| * S A P V K S Y E D L D L E L T D V E L D L H R Y K P I N M W I * S W R I W K * L I G T S Q F I * G F R V G V Y G S R A BseGI MmeI SfaNI | TspDTI \ \ \ \ AAATCAAAGAAAAAAATCATTGGTTTAGTTATCGGCGTTGTTGTTGGTGGATGCTTATAT 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGTTTCTTTTTTTAGTAACCAAATCAATAGCCGCAACAACAACCACCTACGAATATA / / / / MmeI SfaNI | TspDTI BseGI K S K K K I I G L V I G V V V G G C L Y N Q R K K S L V * L S A L L L V D A Y I I K E K N H W F S Y R R C C W W M L I Y ----:----|----:----|----:----|----:----|----:----|----:----| L D F F F I M P K T I P T T T P P H K Y C I L S F F * Q N L * R R Q Q Q H I S I F * L F F D N T * N D A N N N T S A * I FatI BspHI |CviAII Hin4II* AciI Hpy178III* |Hpy178III* | Hin4I | TfiI | EciI FokI || NlaIII | Hin4I | HinfI | | TspEI \ \\ \ \ \ \ \ \ \ \ ATTTTATTCATGATTTTTGCTTTCAAGTATATCATAAGAAGGCGGATTCAAAGTCAAGAA 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAATAAGTACTAAAAACGAAAGTTCATATAGTATTCTTCCGCCTAAGTTTCAGTTCTT / / // / / / / / | | |BspHI Hin4II* | HinfI | Hpy178III* | | |FatI Hin4I | TfiI EciI | | Hpy178III* Hin4I AciI | | CviAII | NlaIII FokI I L F M I F A F K Y I I R R R I Q S Q E F Y S * F L L S S I S * E G G F K V K K F I H D F C F Q V Y H K K A D S K S R N ----:----|----:----|----:----|----:----|----:----|----:----| I K N M I K A K L Y I M L L R I * L * S Y K I * S K Q K * T Y * L F A S E F D L N * E H N K S E L I D Y S P P N L T L F Hpy178III* | Hin4I ApoI ApoI | Hin4I TspEI BsrI TspEI TspEI \ \ \ \ \ \ ATTATCAAGAACCCAGAAATTTCCAGTATCAGTTCAAGTGAATTTGGTGGAGAGAAAAAT 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| TAATAGTTCTTGGGTCTTTAAAGGTCATAGTCAAGTTCACTTAAACCACCTCTCTTTTTA / / / / | Hpy178III* TspEI TspEI Hin4I ApoI ApoI Hin4I BsrI TspEI I I K N P E I S S I S S S E F G G E K N L S R T Q K F P V S V Q V N L V E R K I Y Q E P R N F Q Y Q F K * I W W R E K L ----:----|----:----|----:----|----:----|----:----|----:----| I I L F G S I E L I L E L S N P P S F F F * * S G L F K W Y * N L H I Q H L S F N D L V W F N G T D T * T F K T S L F I TspDTI | Hpy178III* ApoI | | TfiI TspEI BccI | | HinfI AjuI EcoRI TspEI \ \ \ \ \ \ TACAATAATGAAAAGAGAATGAGCGTTCAAGAATCCATAACACAATCTATGCGAATTCAA 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTATTACTTTTCTCTTACTCGCAAGTTCTTAGGTATTGTGTTAGATACGCTTAAGTT / / / / / / TspEI TspDTI | HinfI AjuI EcoRI | TfiI TspEI Hpy178III* ApoI Y N N E K R M S V Q E S I T Q S M R I Q T I M K R E * A F K N P * H N L C E F K Q * * K E N E R S R I H N T I Y A N S K ----:----|----:----|----:----|----:----|----:----|----:----| * L L S F L I L T * S D M V C D I R I * N C Y H F S F S R E L I W L V I * A F E V I I F L S H A N L F G Y C L R H S N L BseGI | BseGI | |MaeIII | ||AjuI | |||FokI HindII BssKI | |||| FokI Hpy166II EcoRII | |||| | MaeIII | MlyI | ScrFI | |||| | Tsp45I | PleI HinfI | BseBI \ \\\\ \ \ \ \ \ \ \ AATTGGATGGATGATAGTTACTATGGTCACGGGTTGACAAATAATGACTCAACTCCAACC 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| TTAACCTACCTACTATCAATGATACCAGTGCCCAACTGTTTATTACTGAGTTGAGGTTGG / / / // // / / / // / | | | |BseGI || | | | |PleI HinfI | | | AjuI || | | | MlyI | | BseGI || | | Hpy166II | TspEI || | | HindII BccI || | Tsp45I || | MaeIII || FokI |FokI MaeIII N W M D D S Y Y G H G L T N N D S T P T I G W M I V T M V T G * Q I M T Q L Q P L D G * * L L W S R V D K * * L N S N Q ----:----|----:----|----:----|----:----|----:----|----:----| F Q I S S L * * P * P N V F L S E V G V F N S P H Y N S H D R T S L Y H S L E L I P H I I T V I T V P Q C I I V * S W G Hpy178III* | MfeI | TspEI | | MmeI | | NheI BssKI | | |MaeI SecI* | | ||Cac8I EcoRII ApoI | | ||| BmtI |PasI TaqI MmeI TspEI | | ||| CviJI |SecI* \ \ \ \ \ \\\ \ \\ AGGCACAATACATCGAGTTCCATACCAAAAATTTCAAGACCAATTGCTAGCCAAAACTCC 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| TCCGTGTTATGTAGCTCAAGGTATGGTTTTTAAAGTTCTGGTTAACGATCGGTTTTGAGG / / / / / / /// /// | EcoRII | MmeI | | ||| ||CviJI | BssKI TaqI | | ||| ||NheI BseBI | | ||| |MaeI ScrFI | | ||| Cac8I | | ||BmtI | | |TspEI | | |MfeI | | MmeI | Hpy178III* TspEI ApoI R H N T S S S I P K I S R P I A S Q N S G T I H R V P Y Q K F Q D Q L L A K T P A Q Y I E F H T K N F K T N C * P K L P ----:----|----:----|----:----|----:----|----:----|----:----| L C L V D L E M G F I E L G I A L W F E W A C Y M S N W V L F K L V L Q * G F S P V I C R T G Y W F N * S W N S A L V G ScrFI BseBI | TsoI | |BsiYI* \ \\ CTGGGTTGGAACGAAGTTTGA 3910 3920 ----:----|----:----|- GACCCAACCTTGCTTCAAACT /// ||EcoRII ||BssKI ||SecI* |SecI* |PasI BsiYI* BseBI ScrFI TsoI L G W N E V * W V G T K F X G L E R S L X ----:----|----:----|- R P Q F S T Q G P N S R L K Q T P V F N S # Enzymes that cut Frequency Isoschizomers AarI 2 AccI 6 FblI,XmiI AciI 15 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AgeI 2 AsiGI,BshTI,CspAI,PinAI AjuI 2 AlfI 2 AluI 28 AluBI AlwNI 3 CaiI ApaLI 1 Alw44I,VneI ApoI 10 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 3 Ama87I,BsiHKCI,BsoBI,Eco88I BaeI 1 BamHI 1 BbvI 10 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 13 Bce83I* 11 BpuEI BceAI 1 BcgI 3 BciVI 2 BfuI BdaI 2 BetI* 6 BsaWI BinI* 5 AlwI,BspPI,AclWI BisI 13 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 13 BmeT110I 3 BmgT120I 3 BmtI 7 BspOI BplI 2 BsaXI 2 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 16 BstF5I,BtsCI BseMII 15 BseRI 4 BseSI 1 BaeGI,BstSLI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BsmAI 6 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 15 BspHI 1 CciI,PagI,RcaI BspMI 2 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 1 AccBSI,MbiI BsrDI 3 BseMI,Bse3DI BsrI 16 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BssNAI 2 Bst1107I,BstZ17I BstAPI 2 BstKTI 5 BstXI 2 BtrI 1 BmgBI,AjiI BtsI 6 Cac8I 13 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 3 BsrFI,BssAI,Bse118I Cfr9I 1 TspMI,XmaCI,XmaI CfrI 1 AcoI,EaeI Csp6I 17 CviQI,RsaNI CviAII 5 CviJI 54 CviKI-1 CviRI* 24 HpyCH4V DdeI 16 BstDEI,HpyF3I DpnI 5 MalI DrdI 1 AasI,DseDI DsaI* 1 BtgI,BstDSI EciI 3 Ecl136II 1 EcoICRI Eco47III 2 Aor51HI,AfeI Eco57I 5 AcuI Eco57MI 8 EcoP15I 5 EcoRI 3 EcoRII 3 AjnI,Psp6I,PspGI Esp3I 1 BsmBI FatI 5 FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 16 GlaI 8 GsuI 3 BpmI HaeII 4 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 4 CseI HgiAI* 4 Bbv12I,BsiHKAI,Alw21I HgiCI* 4 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 8 BstHHI,CfoI,AspLEI Hin4I 10 Hin4II* 8 HpyAV Hin6I 8 HinP1I,HspAI HindII 2 HincII HindIII 3 HinfI 12 HpaI 1 KspAI HpaII 8 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 10 Hpy8I Hpy178III* 14 Hpy188III Hpy188I 29 Hpy99I 3 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 17 FspBI,BfaI,XspI MaeII 9 HpyCH4IV MaeIII 7 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 McrI* 2 BsiEI,BstMCI,Bsh1285I MfeI 3 MunI MlyI 4 SchI MmeI 10 MnlI 32 MseI 6 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 15 HpyF10VI,BstMWI NdeI 1 FauNDI NheI 7 AsuNHI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 8 BspLI,BmiI,PspN4I NspBII* 6 MspA1I OliI 2 AleI PasI 1 PleI 4 PpsI PspXI 1 PsrI 4 PstI 2 PvuII 3 RsaI 17 AfaI SacI 1 Psp124BI,SstI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII SauI* 2 Bse21I,Bsu36I,Eco81I,AxyI ScaI 4 BmcAI,AssI,ZrmI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 5 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 57 SfaNI 12 LweI SfeI* 9 BstSFI,SfcI,BfmI SmaI 1 SmlI 12 SmoI SpeI 2 BcuI,AhlI SrfI 1 SspI 1 StuI 1 Eco147I,PceI,SseBI,AatI TaiI 9 TaqI 10 TatI 9 TauI 3 TfiI 8 PfeI TseI 10 ApeKI TsoI 2 Tsp45I 3 NmuCI Tsp4CI* 8 HpyCH4III,TaaI,Bst4CI TspDTI 13 TspEI 21 TasI,Tsp509I,Sse9I TspGWI 6 TspRI 12 TscAI TstI 2 XcmI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 4 BstYI,MflI,PsuI,BstX2I XmaIII* 1 BstZI,EagI,EclXI,Eco52I,BseX3I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AflII AhaIII* AloI ApaI AscI Asp718I AvaII AvrII BalI BarI BbvCI BclI BfiI BglI BglII Bpu10I BsaAI BsaBI BsePI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I BspLU11I* BstEII BtgZI ClaI CspCI DinI DraII DraIII Eam1105I Eco31I EcoNI EcoRV EcoT22I EgeI EheI EspI* FalI FaqI FauI FseI FspAI GsaI KasI KpnI MauBI MluI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NmeAIII NotI NruI NsiI NspI PacI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PvuI RsrII SalI SanDI SapI SexAI SfiI SfoI SgfI SgrAI SgrDI SnaBI SphI SplI* Sse232I* Sse8387I StyI SwaI TaqII Tth111I VspI XbaI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769