Restriction Map of ZRT1/YGL255W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ZRT1/YGL255W on chromosome VII from coordinates 20978 to 22108.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.26264

AsuI* AvaII DraII PpuMI SanDI BceAI |NlaIV | AclI |BmgT120I | MaeII || Hpy188I | |MaeIII ||FalI | MaeIII | || SetI SecI* ||FalI | |BslFI | || TaiI DsaI* ||NlaIV | ||Hin4II* \ \\ \ \ \\\ \ \\\ ATGAGCAACGTTACTACGCCGTGGTGGAAACAATGGGACCCTTCTGAAGTTACACTTGCC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCGTTGCAATGATGCGGCACCACCTTTGTTACCCTGGGAAGACTTCAATGTGAACGG / / / / / / /// / / / | | | MaeIII DsaI* | ||| | | MaeIII | | MaeII SecI* | ||| | | BslFI | | AclI | ||| | Hin4II* | TaiI | ||| Hpy188I | SetI | ||SanDI BceAI | ||PpuMI | ||DraII | ||AvaII | ||AsuI* | |BmgT120I | |NlaIV | NlaIV FalI FalI M S N V T T P W W K Q W D P S E V T L A * A T L L R R G G N N G T L L K L H L P E Q R Y Y A V V E T M G P F * S Y T C R ----:----|----:----|----:----|----:----|----:----|----:----| X L L T V V G H H F C H S G E S T V S A X S C R * * A T T S V I P G K Q L * V Q H A V N S R R P P F L P V R R F N C K G SetI BbvII* | MboII Eco57I | | CviRI* Eco57MI | | | SetI | FalI | | | | TstI | FalI TstI | | | | |Hpy166II \ \ \ \ \ \ \ \\ GATAAAACCCCTGATGATGTGTGGAAGACCTGTGTTTTGCAAGGTGTTTACTTTGGTGGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTTGGGGACTACTACACACCTTCTGGACACAAAACGTTCCACAAATGAAACCACCT / / / / / / // / | FalI TstI SetI | | |TstI Hpy166II | FalI | | SetI Eco57MI | CviRI* Eco57I BbvII* MboII D K T P D D V W K T C V L Q G V Y F G G I K P L M M C G R P V F C K V F T L V E * N P * * C V E D L C F A R C L L W W K ----:----|----:----|----:----|----:----|----:----|----:----| S L V G S S T H F V Q T K C P T * K P P R Y F G Q H H T S S R H K A L H K S Q H I F G R I I H P L G T N Q L T N V K T S MaeIII | DdeI | | HgiCI* | | | SetI | | | NlaIV TatI | | | | MboII |Csp6I | | | | |TspGWI ||RsaI | | | | || XmnI Hpy178III* \\\ \ \ \ \ \\ \ \ AACGAGTACAATGGTAACTTAGGTGCCAGAATATCTTCCGTCTTTGTTATTCTTTTCGTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTCATGTTACCATTGAATCCACGGTCTTATAGAAGGCAGAAACAATAAGAAAAGCAC /// / // /// / / ||TatI | || ||HgiCI* XmnI Hpy178III* |Csp6I | || |TspGWI RsaI | || |MboII | || NlaIV | |DdeI | SetI MaeIII N E Y N G N L G A R I S S V F V I L F V T S T M V T * V P E Y L P S L L F F S * R V Q W * L R C Q N I F R L C Y S F R E ----:----|----:----|----:----|----:----|----:----|----:----| F S Y L P L K P A L I D E T K T I R K T F R T C H Y S L H W F I K R R Q * E K R V L V I T V * T G S Y R G D K N N K E H TatI |Csp6I ||HphI FatI ApoI ||RsaI |CviAII MseI BplI TspEI ||ScaI || NlaIII VspI BplI EcoRI \\\ \\ \ \ \ \ AGTACTTTTTTCACCATGTTCCCATTAATCTCAACAAAAGTGAAAAGATTGAGAATTCCT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCATGAAAAAAGTGGTACAAGGGTAATTAGAGTTGTTTTCACTTTTCTAACTCTTAAGGA //// / // / / / |||TatI | |FatI VspI BplI EcoRI ||Csp6I | CviAII MseI BplI TspEI |ScaI NlaIII ApoI |RsaI HphI S T F F T M F P L I S T K V K R L R I P V L F S P C S H * S Q Q K * K D * E F L Y F F H H V P I N L N K S E K I E N S S ----:----|----:----|----:----|----:----|----:----|----:----| L V K K V M N G N I E V F T F L N L I G S Y K K * W T G M L R L L L S F I S F E T S K E G H E W * D * C F H F S Q S N R MnlI |Hpy166II || SetI NlaIV || BplI |BetI* CviRI* || BplI ||HpaII | AciI \\ \ \\\ \ \ CTATATGTTTACCTTTTCGCAAAGTATTTTGGTTCCGGTGTTATTGTTGCAACCGCATTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GATATACAAATGGAAAAGCGTTTCATAAAACCAAGGCCACAATAACAACGTTGGCGTAAA / // / // / / | |SetI | |BetI* | AciI | Hpy166II | HpaII CviRI* | BplI NlaIV | BplI MnlI L Y V Y L F A K Y F G S G V I V A T A F Y M F T F S Q S I L V P V L L L Q P H L I C L P F R K V F W F R C Y C C N R I Y ----:----|----:----|----:----|----:----|----:----|----:----| R Y T * R K A F Y K P E P T I T A V A N E I H K G K R L T N Q N R H * Q Q L R M * I N V K E C L I K T G T N N N C G C K MseI | PflMI Acc65I | BsiYI* HgiCI* | | AsuI* |Csp6I AgeI | | AvaII ||RsaI BetI* | | |BmgT120I BsiYI* ||NlaIV Cfr10I | | ||NlaIV | MwoI ||| KpnI |HpaII \ \ \\\ \ \ \\\ \ \\ ATCCACTTAATGGACCCTGCTTATGGTGCGATTGGTGGTACCACTTGTGTAGGACAAACC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGTGAATTACCTGGGACGAATACCACGCTAACCACCATGGTGAACACATCCTGTTTGG / / // / / / /// | MseI || | MwoI | ||HgiCI* BsiYI* || BsiYI* | ||Acc65I PflMI |AvaII | |Csp6I |AsuI* | NlaIV BmgT120I | RsaI NlaIV KpnI I H L M D P A Y G A I G G T T C V G Q T S T * W T L L M V R L V V P L V * D K P P L N G P C L W C D W W Y H L C R T N R ----:----|----:----|----:----|----:----|----:----|----:----| I W K I S G A * P A I P P V V Q T P C V * G S L P G Q K H H S Q H Y W K H L V F D V * H V R S I T R N T T G S T Y S L G MaeIII BfiI | BsiYI* | FatI | | TspDTI | |CviAII | | | BsrI | || NlaIII SetI \ \ \ \ \ \\ \ \ GGTAACTGGGGTCTTTATTCATGGTGTCCTGCCATTATGCTAACGAGTTTGACCTTCACT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTGACCCCAGAAATAAGTACCACAGGACGGTAATACGATTGCTCAAACTGGAAGTGA // / / / / // / || | BsrI BfiI | |FatI SetI || MaeIII | CviAII || TspDTI NlaIII |Cfr10I |BsiYI* |BetI* |AgeI HpaII G N W G L Y S W C P A I M L T S L T F T V T G V F I H G V L P L C * R V * P S L * L G S L F M V S C H Y A N E F D L H F ----:----|----:----|----:----|----:----|----:----|----:----| P L Q P R * E H H G A M I S V L K V K V R Y S P D K N M T D Q W * A L S N S R * T V P T K I * P T R G N H * R T Q G E S Hin4II* | MboI | | DpnI FatI | | |HgaI |CviAII | | |BstKTI || NlaIII \ \ \\ \\ \ TTCCTTACTGATCTATTCAGTAGCGTCTGGGTTGAAAGAAAGTATGGTCTTTCCCATGAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGAATGACTAGATAAGTCATCGCAGACCCAACTTTCTTTCATACCAGAAAGGGTACTG / // / / / // Hin4II* || | HgaI | |FatI || MboI | CviAII |DpnI NlaIII BstKTI F L T D L F S S V W V E R K Y G L S H D S L L I Y S V A S G L K E S M V F P M T P Y * S I Q * R L G * K K V W S F P * P ----:----|----:----|----:----|----:----|----:----|----:----| K R V S R N L L T Q T S L F Y P R E W S K G * Q D I * Y R R P Q F F T H D K G H E K S I * E T A D P N F S L I T K G M V BtsI | SfeI* | | TseI | | CviRI* | | |BisI | | ||BlsI | | ||PstI | | ||TspRI TspDTI | | |||AluI |Tsp4CI* | | |||CviJI ||OliI | | |||PvuII TspEI ||MslI | | |||NspBII* | MseI ||| TspRI | | |||| SetI BbvI \ \ \\\ \ \ \ \\\\ \ \ CATACCCACGATGAAATTAAAGACACTGTTGTGAGAAACACTGCAGCTGTTTCAAGTGAG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GTATGGGTGCTACTTTAATTTCTGTGACAACACTCTTTGTGACGTCGACAAAGTTCACTC // / / / / / / //// / || | | | MslI | | |||NspBII* BbvI || | | | OliI | | |||PvuII || | | Tsp4CI* | | |||CviJI || | TspDTI | | |||TseI || TspRI | | |||AluI |MseI | | ||SfeI* TspEI | | ||BisI | | |BlsI | | |SetI | | CviRI* | PstI TspRI BtsI H T H D E I K D T V V R N T A A V S S E I P T M K L K T L L * E T L Q L F Q V R Y P R * N * R H C C E K H C S C F K * E ----:----|----:----|----:----|----:----|----:----|----:----| W V W S S I L S V T T L F V A A T E L S G Y G R H F * L C Q Q S F C Q L Q K L H M G V I F N F V S N H S V S C S N * T L Csp6I |RsaI || CviRI* || | MboI || | XhoII || | | DpnI || | | |BstKTI || | | || FatI || | | || BspHI || | | || |CviAII || | | || |Hpy178III* || | | || || BinI* || | | || || |NlaIII \\ \ \ \\ \\ \\ AATGACAATGAGAATGGTACTGCAAATGGATCTCATGACACCAAGAACGGAGTAGAGTAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTGTTACTCTTACCATGACGTTTACCTAGAGTACTGTGGTTCTTGCCTCATCTCATA // / // // // // || CviRI* || || |BinI* |TspGWI |Csp6I || || |BspHI Hin4I RsaI || || |FatI Hin4I || || Hpy178III* || || CviAII || |NlaIII || XhoII || MboI |DpnI BstKTI N D N E N G T A N G S H D T K N G V E Y M T M R M V L Q M D L M T P R T E * S I * Q * E W Y C K W I S * H Q E R S R V L ----:----|----:----|----:----|----:----|----:----|----:----| F S L S F P V A F P D * S V L F P T S Y S H C H S H Y Q L H I E H C W S R L L T I V I L I T S C I S R M V G L V S Y L I TspGWI | Hin4I | Hin4I | | FokI | | |TfiI | | |HinfI | | || Hpy188I | | || | MboII | | || | |TspDTI | | || | || BseGI | | || | || | HgaI | | || | || | |FatI | | || | || | |NcoI | | || | || | |StyI | | || | || | |SecI* | | || | || | |DsaI* | | || | || | ||CviAII | | || | || | ||| NlaIII | | || | || | ||| | BseGI | | || | || | ||| | | Hin4I | | || | || | ||| | | Hin4I | | || | || | ||| | | | FokI TspEI \ \ \\ \ \\ \ \\\ \ \ \ \ \ TATGAAGATTCAGACGCTACATCCATGGATGTTGTTCAATCATTTCAAGCACAATTTTAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTTCTAAGTCTGCGATGTAGGTACCTACAACAAGTTAGTAAAGTTCGTGTTAAAATA // / / / // / / / || | BseGI | || Hin4I FokI TspEI || TspDTI | || Hin4I || MboII | || BseGI |Hpy188I | |DsaI* HinfI | |SecI* TfiI | |HgaI FokI | |StyI | |NcoI | |FatI | CviAII NlaIII Y E D S D A T S M D V V Q S F Q A Q F Y M K I Q T L H P W M L F N H F K H N F M * R F R R Y I H G C C S I I S S T I L C ----:----|----:----|----:----|----:----|----:----|----:----| * S S E S A V D M S T T * D N * A C N * N H L N L R * M W P H Q E I M E L V I K I F I * V S C G H I N N L * K L C L K I BssKI EcoRII |SecI* ApoI MboI ||ScrFI MseI TspEI | DpnI ||BseBI |TspEI EcoRI TspGWI TaqII | |BstKTI |||SetI \\ \ \ \ \ \\ \\\\ GCCTTTTTAATTTTAGAATTCGGTGTGATTTTCCACTCCGTTATGATCGGTCTAAACCTG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGGAAAAATTAAAATCTTAAGCCACACTAAAAGGTGAGGCAATACTAGCCAGATTTGGAC / / / / / // / / / | TspEI | TspGWI TaqII || MboI | BseBI MseI EcoRI |DpnI | ScrFI TspEI BstKTI | Hin4I ApoI SetI A F L I L E F G V I F H S V M I G L N L P F * F * N S V * F S T P L * S V * T W L F N F R I R C D F P L R Y D R S K P G ----:----|----:----|----:----|----:----|----:----|----:----| A K K I K S N P T I K W E T I I P R F R H R K L K L I R H S K G S R * S R D L G G K * N * F E T H N E V G N H D T * V Q MnlI | Hin4I Hin4I | | DdeI | BplI | | BplI Hin4II* | BplI BseRI HphI | | BplI |BccI \ \ \ \ \ \ \ \\ GGAAGTGTTGGTGATGAGTTCTCCTCCCTATACCCTGTCTTAGTGTTCCATCAATCATTT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTCACAACCACTACTCAAGAGGAGGGATATGGGACAGAATCACAAGGTAGTTAGTAAA // / / // / / / / |BplI BseRI HphI || BplI DdeI | BccI |BplI || BplI Hin4II* EcoRII |MnlI BssKI Hin4I SecI* G S V G D E F S S L Y P V L V F H Q S F E V L V M S S P P Y T L S * C S I N H L K C W * * V L L P I P C L S V P S I I * ----:----|----:----|----:----|----:----|----:----|----:----| P L T P S S N E E R Y G T K T N W * D N P F H Q H H T R R G I G Q R L T G D I M S T N T I L E G G * V R D * H E M L * K MaeI | MboI ApoI | | DpnI TspEI | | |BstKTI SetI SetI CviRI* CviJI EcoRI | | ||BccI \ \ \ \ \ \ \ \\\ GAAGGTTTAGGTATTGGTGCAAGATTGTCAGCCATTGAATTCCCTAGATCAAAGAGATGG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCCAAATCCATAACCACGTTCTAACAGTCGGTAACTTAAGGGATCTAGTTTCTCTACC / / / / / /// // SetI SetI CviRI* CviJI | ||| |BccI | ||| MboI | ||DpnI | |BstKTI | MaeI EcoRI TspEI ApoI E G L G I G A R L S A I E F P R S K R W K V * V L V Q D C Q P L N S L D Q R D G R F R Y W C K I V S H * I P * I K E M V ----:----|----:----|----:----|----:----|----:----|----:----| S P K P I P A L N D A M S N G L D F L H Q L N L Y Q H L I T L W Q I G * I L S I F T * T N T C S Q * G N F E R S * L S P CfrI | BalI | CviJI | HaeIII | |FatI | |NcoI | |StyI | |SecI* | |DsaI* | ||CviAII | ||| AsuI* | ||| NlaIII | ||| Bsp120I | ||| |AsuI* | ||| |DraII | ||| |BmgT120I | ||| ||CviJI | ||| ||NlaIV | ||| ||HaeIII TsoI | ||| ||BmgT120I CspCI | CfrI | ||| ||| ApaI | MseI | | BalI | ||| ||| SduI | |HpaI | | TaqII | ||| ||| BseSI | |HindII | | CviJI | ||| ||| HgiJII* | |Hpy166II | | HaeIII BstXI \ \\\ \\\ \ \ \\ \ \ \ \ TGGCCATGGGCCCTATGTGTTGCGTATGGGTTAACCACACCAATCTGTGTGGCCATCGGT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| ACCGGTACCCGGGATACACAACGCATACCCAATTGGTGTGGTTAGACACACCGGTAGCCA /// // /// / // / / / / / ||| || ||Bsp120I | |MseI | | | | BstXI ||| || ||DraII | Hpy166II | | | CfrI ||| || ||AsuI* | HindII | | HaeIII ||| || |BmgT120I | HpaI | | CviJI ||| || |AsuI* CspCI | | BalI ||| || BmgT120I | TaqII ||| || HaeIII TsoI ||| || NlaIV ||| || CviJI ||| |HgiJII* ||| |DsaI* ||| |SecI* ||| |BseSI ||| |StyI ||| |NcoI ||| |FatI ||| |SduI ||| |ApaI ||| CviAII ||CfrI |NlaIII HaeIII CviJI BalI W P W A L C V A Y G L T T P I C V A I G G H G P Y V L R M G * P H Q S V W P S V A M G P M C C V W V N H T N L C G H R F ----:----|----:----|----:----|----:----|----:----|----:----| H G H A R H T A Y P N V V G I Q T A M P T A M P G I H Q T H T L W V L R H P W R P W P G * T N R I P * G C W D T H G D T MaeII Hin6I | SetI |GlaI | TaiI ||HhaI BccI Csp6I | | AciI ||TspRI | CspCI |RsaI | | NspBII* BtsI ||| EcoP15I SfaNI \ \ \\ \ \ \ \ \\\ \ \ TTGGGTGTTCGTACCAGATACGTCAGCGGTTCTTACACTGCGCTTGTTATCTCTGGTGTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCACAAGCATGGTCTATGCAGTCGCCAAGAATGTGACGCGAACAATAGAGACCACAA / // / / / / / /// / / CspCI |Csp6I | | | AciI TspRI ||Hin6I EcoP15I SfaNI BccI RsaI | | | BtsI |GlaI | | NspBII* HhaI | MaeII TaiI SetI L G V R T R Y V S G S Y T A L V I S G V W V F V P D T S A V L T L R L L S L V F G C S Y Q I R Q R F L H C A C Y L W C F ----:----|----:----|----:----|----:----|----:----|----:----| K P T R V L Y T L P E * V A S T I E P T N P H E Y W I R * R N K C Q A Q * R Q H Q T N T G S V D A T R V S R K N D R T N TatI Bsp1407I |Csp6I ||RsaI BseGI |||Hpy166II | MwoI |||| BsrI MaeI | | FokI |||| TspRI |BsmAI \ \ \ \\\\ \ \\ TTGGATGCCATTTCTGCTGGTATCTTATTGTACACTGGTTTGGTTGAACTACTAGCAAGA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTACGGTAAAGACGACCATAGAATAACATGTGACCAAACCAACTTGATGATCGTTCT / / / //// / / / | MwoI FokI |||| BsrI | BsmAI BseGI |||Bsp1407I MaeI |||TatI ||Hpy166II ||Csp6I |RsaI TspRI L D A I S A G I L L Y T G L V E L L A R W M P F L L V S Y C T L V W L N Y * Q E G C H F C W Y L I V H W F G * T T S K R ----:----|----:----|----:----|----:----|----:----|----:----| K S A M E A P I K N Y V P K T S S S A L K P H W K Q Q Y R I T C Q N P Q V V L L Q I G N R S T D * Q V S T Q N F * * C S MnlI | MboI | XhoII BcgI | | DpnI | AclI | | |BstKTI | MaeII | | ||DdeI | | SetI | | ||| BinI* | | TaiI | | ||| | TspEI | | |Hin4II* \ \ \\\ \ \ \ \ \\ GACTTTATATTCAATCCTCAAAGAACAAAGGATCTAAGAGAATTGTCCTTCAACGTTATA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAAATATAAGTTAGGAGTTTCTTGTTTCCTAGATTCTCTTAACAGGAAGTTGCAATAT / // / / / / / / // MnlI || | | | | | | |Hin4II* || | | | | | | MaeII || | | | | | | AclI || | | | | | TaiI || | | | | | SetI || | | | | BcgI || | | | TspEI || | | BinI* || | DdeI || XhoII || MboI |DpnI BstKTI D F I F N P Q R T K D L R E L S F N V I T L Y S I L K E Q R I * E N C P S T L Y L Y I Q S S K N K G S K R I V L Q R Y M ----:----|----:----|----:----|----:----|----:----|----:----| S K I N L G * L V F S R L S N D K L T I L S * I * D E F F L P D L L I T R * R * V K Y E I R L S C L I * S F Q G E V N Y FatI |CviAII ||BcgI ||| NlaIII ||| |CviJI ||| || MboI ||| || | DpnI CviJI CviRI* ||| || | |BstKTI | MseI \ \\\ \\ \ \\ \ \ TGCACTCTTTTCGGTGCTGGTATCATGGCTTTGATCGGTAAGTGGGCTTAA 1090 1100 1110 1120 1130 ----:----|----:----|----:----|----:----|----:----|- ACGTGAGAAAAGCCACGACCATAGTACCGAAACTAGCCATTCACCCGAATT / / /// // / / / CviRI* | ||| || MboI | MseI | ||| |DpnI CviJI | ||| BstKTI | ||CviJI | |FatI | CviAII NlaIII BcgI C T L F G A G I M A L I G K W A * A L F S V L V S W L * S V S G L X H S F R C W Y H G F D R * V G L X ----:----|----:----|----:----|----:----|----:----|- H V R K P A P I M A K I P L H A * I C E K R H Q Y * P K S R Y T P K A S K E T S T D H S Q D T L P S L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AciI 2 BspACI,SsiI AclI 2 Psp1406I AgeI 1 AsiGI,BshTI,CspAI,PinAI AluI 1 AluBI ApaI 1 ApoI 3 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 2 MlsI,MluNI,MscI,Msp20I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 BceAI 1 BcgI 1 BetI* 2 BsaWI BfiI 1 BmrI,BmuI BinI* 2 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 4 BplI 4 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseRI 1 BseSI 1 BaeGI,BstSLI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI Bsp120I 1 PspOMI Bsp1407I 1 BsrGI,BstAUI BspHI 1 CciI,PagI,RcaI BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 6 BstXI 1 BtsI 2 Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 6 CviQI,RsaNI CspCI 1 CviAII 7 CviJI 7 CviKI-1 CviRI* 6 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 6 MalI DraII 2 EcoO109I DsaI* 3 BtgI,BstDSI Eco57I 1 AcuI Eco57MI 1 EcoP15I 1 EcoRI 3 EcoRII 1 AjnI,Psp6I,PspGI FalI 2 FatI 7 FokI 3 GlaI 1 HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 4 HpyAV Hin6I 1 HinP1I,HspAI HindII 1 HincII HinfI 1 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 2 Hpy188III Hpy188I 2 KpnI 1 MaeI 2 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 4 MboI 6 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MnlI 3 MseI 6 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NcoI 2 Bsp19I NlaIII 7 Hin1II,Hsp92II,FaeI NlaIV 7 BspLI,BmiI,PspN4I NspBII* 2 MspA1I OliI 1 AleI PflMI 1 BasI,AccB7I,Van91I PpuMI 1 Psp5II,PspPPI PstI 1 PvuII 1 RsaI 6 AfaI SanDI 1 ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 12 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqII 2 TatI 3 TfiI 1 PfeI TseI 1 ApeKI TsoI 1 Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 7 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 4 TscAI TstI 1 VspI 1 PshBI,AseI XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AccI AcyI AflII AflIII AhaIII* AjuI AlfI AloI AlwNI ApaLI AscI AsuII AvaI AvrII BaeI BamHI BarI BbvCI Bce83I* BciVI BclI BdaI BglI BglII BmeT110I BmtI Bpu10I BsaAI BsaBI BsaXI BseMII BsePI BseYI BsgI BsiI* BsmI BspCNI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtrI Cac8I CauII* Cfr9I ClaI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRV EcoT22I EgeI EheI Esp3I EspI* FauI FnuDII* FseI FspAI GsaI GsuI HaeII HgiAI* HindIII Hpy99I KasI Ksp632I* MauBI McrI* MfeI MluI MlyI MmeI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI PacI PasI PfoI PleI PmaCI PmeI PpiI PshAI PsiI PspXI PsrI PvuI RsrII SacI SacII SalI SapI SauI* SchI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqI TauI Tsp45I TspMI Tth111I XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769