Restriction Map of HXK2/YGL253W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

HXK2/YGL253W on chromosome VII from coordinates 23935 to 25395.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.26638

XmnI | NlaIV | | FatI | | NcoI | | StyI | | SecI* | | DsaI* | | |CviAII AsuI* | | || CfrI AvaII | | || |NlaIII |BmgT120I | | || ||CviJI ||SetI CviJI | | || ||HaeIII SfaNI \\\ \ \ \ \\ \\\ \ ATGGTTCATTTAGGTCCAAAAAAACCACAAGCCAGAAAGGGTTCCATGGCCGATGTGCCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAAGTAAATCCAGGTTTTTTTGGTGTTCGGTCTTTCCCAAGGTACCGGCTACACGGT / // / / / / /// / | |AvaII CviJI | | | ||| CfrI | |AsuI* | | | ||HaeIII | BmgT120I | | | ||CviJI SetI | | | |DsaI* | | | |SecI* | | | |StyI | | | |NcoI | | | |FatI | | | CviAII | | NlaIII | NlaIV XmnI M V H L G P K K P Q A R K G S M A D V P W F I * V Q K N H K P E R V P W P M C Q G S F R S K K T T S Q K G F H G R C A K ----:----|----:----|----:----|----:----|----:----|----:----| X T * K P G F F G C A L F P E M A S T G X P E N L D L F V V L W F P N W P R H A H N M * T W F F W L G S L T G H G I H W Tsp4CI* CviRI* ApoI ApoI | TspRI TspEI | TspEI TspEI TspEI | | BceAI \ \ \ \ \ \ \ \ AAGGAATTGATGCAACAAATTGAGAATTTTGAAAAAATTTTCACTGTTCCAACTGAAACT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTTAACTACGTTGTTTAACTCTTAAAACTTTTTTAAAAGTGACAAGGTTGACTTTGA / / / / / / / / | | CviRI* TspEI TspEI | Tsp4CI* BceAI | TspEI ApoI TspEI SfaNI TspRI ApoI K E L M Q Q I E N F E K I F T V P T E T R N * C N K L R I L K K F S L F Q L K L G I D A T N * E F * K N F H C S N * N F ----:----|----:----|----:----|----:----|----:----|----:----| F S N I C C I S F K S F I K V T G V S V L P I S A V F Q S N Q F F K * Q E L Q F L F Q H L L N L I K F F N E S N W S F S CviJI | MaeIII | |TstI | || TspDTI Hpy188I CspCI | || |MmeI |TspEI | TstI Hin4II* \ \\ \\ \\ \ \ \ TTACAAGCCGTTACCAAGCACTTCATTTCCGAATTGGAAAAGGGTTTGTCCAAGAAGGGT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AATGTTCGGCAATGGTTCGTGAAGTAAAGGCTTAACCTTTTCCCAAACAGGTTCTTCCCA / / // / / / / / | | || MaeIII | | CspCI Hin4II* | | |MmeI | | TstI | | TspDTI | TspEI | CviJI Hpy188I TstI L Q A V T K H F I S E L E K G L S K K G Y K P L P S T S F P N W K R V C P R R V T S R Y Q A L H F R I G K G F V Q E G W ----:----|----:----|----:----|----:----|----:----|----:----| K C A T V L C K M E S N S F P K D L F P K V L R * W A S * K R I P F P N T W S P * L G N G L V E N G F Q F L T Q G L L T MslI | CspCI | |TfiI | |HinfI | || BssKI BsrI | || EcoRII | TfiI | || | ScrFI | HinfI | || | BseBI | | BetI* MaeIII | || | | SetI | | |HpaII \ \ \\ \ \ \ \ \ \\ GGTAACATTCCAATGATTCCAGGTTGGGTTATGGATTTCCCAACTGGTAAGGAATCCGGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CCATTGTAAGGTTACTAAGGTCCAACCCAATACCTAAAGGGTTGACCATTCCTTAGGCCA / / / / // / / / // | | CspCI | || EcoRII BsrI | |BetI* | MslI | || BssKI | HpaII MaeIII | |BseBI HinfI | |ScrFI TfiI | SetI HinfI TfiI G N I P M I P G W V M D F P T G K E S G V T F Q * F Q V G L W I S Q L V R N P V * H S N D S R L G Y G F P N W * G I R * ----:----|----:----|----:----|----:----|----:----|----:----| P L M G I I G P Q T I S K G V P L S D P H Y C E L S E L N P * P N G L Q Y P I R T V N W H N W T P N H I E W S T L F G T Acc65I CfrI HgiCI* | BalI |Csp6I | HphI ||RsaI | TaqII ||NlaIV | CviJI ||| KpnI Bce83I* | HaeIII BstXI ||| | SmlI DdeI | AciI \ \ \ \\\ \ \ \ \ \ GATTTCTTGGCCATTGATTTGGGTGGTACCAACTTGAGAGTTGTCTTAGTCAAGTTGGGC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAGAACCGGTAACTAAACCCACCATGGTTGAACTCTCAACAGAATCAGTTCAACCCG /// / / / /// / / / ||| | BstXI | ||HgiCI* SmlI | Bce83I* ||| CfrI | ||Acc65I DdeI ||HaeIII | |Csp6I ||CviJI | NlaIV ||BalI | RsaI |HphI KpnI TaqII D F L A I D L G G T N L R V V L V K L G I S W P L I W V V P T * E L S * S S W A F L G H * F G W Y Q L E S C L S Q V G R ----:----|----:----|----:----|----:----|----:----|----:----| S K K A M S K P P V L K L T T K T L N P H N R P W Q N P H Y W S S L Q R L * T P I E Q G N I Q T T G V Q S N D * D L Q A MaeIII Tsp45I BstEII | BdaI DdeI | BdaI | TatI | | Tsp4CI* | |Csp6I | | |Csp6I | ||RsaI | | ||RsaI | ||| SfaNI | | ||| SetI | ||| | BdaI BplI | | ||| HphI | ||| | BdaI BplI \ \ \\\ \ \ \\\ \ \ \ GGTGACCGTACCTTTGACACCACTCAATCTAAGTACAGATTACCAGATGCTATGAGAACT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTGGCATGGAAACTGTGGTGAGTTAGATTCATGTCTAATGGTCTACGATACTCTTGA // / // / / /// / || | || HphI | ||| SfaNI || | |Csp6I | ||| BplI || | RsaI | ||| BplI || | SetI | ||BdaI || Tsp4CI* | ||BdaI || BstEII | ||TatI || Tsp45I | |Csp6I || MaeIII | RsaI |BdaI DdeI |BdaI AciI G D R T F D T T Q S K Y R L P D A M R T V T V P L T P L N L S T D Y Q M L * E L * P Y L * H H S I * V Q I T R C Y E N Y ----:----|----:----|----:----|----:----|----:----|----:----| P S R V K S V V * D L Y L N G S A I L V R H G Y R Q C W E I * T C I V L H * S F T V T G K V G S L R L V S * W I S H S S Hpy178III* | TspEI HindIII | |XcmI | AluI | |BplI ApoI MlyI | CviJI | |BplI TspEI PleI HinfI | | SetI \ \\ \ \ \ \ \ \ ACTCAAAATCCAGACGAATTGTGGGAATTTATTGCCGACTCTTTGAAAGCTTTTATTGAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGAGTTTTAGGTCTGCTTAACACCCTTAAATAACGGCTGAGAAACTTTCGAAAATAACTA / / / / // / / / / | | TspEI | |PleI HinfI | | HindIII | XcmI | MlyI | CviJI Hpy178III* TspEI | AluI BplI ApoI SetI BplI T Q N P D E L W E F I A D S L K A F I D L K I Q T N C G N L L P T L * K L L L M S K S R R I V G I Y C R L F E S F Y * * ----:----|----:----|----:----|----:----|----:----|----:----| V * F G S S N H S N I A S E K F A K I S * E F D L R I T P I * Q R S K S L K * Q S L I W V F Q P F K N G V R Q F S K N I DdeI BseMII |Hpy188I |BspCNI || CviJI TspEI || SetI || | TspEI HphI SetI BseYI \ \\ \ \\ \ \ \ \ \ GAGCAATTCCCACAAGGTATCTCTGAGCCAATTCCATTGGGTTTCACCTTTTCTTTCCCA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGTTAAGGGTGTTCCATAGAGACTCGGTTAAGGTAACCCAAAGTGGAAAAGAAAGGGT / /// / // / / / / / | ||SetI | |CviJI | HphI SetI | SetI | |BspCNI | DdeI TspEI GsaI | BseMII Hpy188I TspEI E Q F P Q G I S E P I P L G F T F S F P S N S H K V S L S Q F H W V S P F L S Q A I P T R Y L * A N S I G F H L F F P S ----:----|----:----|----:----|----:----|----:----|----:----| S C N G C P I E S G I G N P K V K E K G H A I G V L Y R Q A L E M P N * R K K G L L E W L T D R L W N W Q T E G K R E W AluI GsaI BccI CviJI |CviRI* | SetI Hin4II* SetI || TspDTI SetI \ \ \ \ \\ \ \ GCTTCTCAAAACAAAATCAATGAAGGTATCTTGCAAAGATGGACTAAAGGTTTTGATATT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGAGTTTTGTTTTAGTTACTTCCATAGAACGTTTCTACCTGATTTCCAAAACTATAA / / / / / BseYI Hin4II* SetI TspDTI SetI CviJI CviRI* AluI BccI A S Q N K I N E G I L Q R W T K G F D I L L K T K S M K V S C K D G L K V L I F F S K Q N Q * R Y L A K M D * R F * Y S ----:----|----:----|----:----|----:----|----:----|----:----| A E * F L I L S P I K C L H V L P K S I L K E F C F * H L Y R A F I S * L N Q Y S R L V F D I F T D Q L S P S F T K I N MnlI CviRI* | DdeI \ \ \ CCAAACATTGAAAACCACGATGTTGTTCCAATGTTGCAAAAGCAAATCACTAAGAGGAAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTGTAACTTTTGGTGCTACAACAAGGTTACAACGTTTTCGTTTAGTGATTCTCCTTA / / / CviRI* MnlI DdeI P N I E N H D V V P M L Q K Q I T K R N Q T L K T T M L F Q C C K S K S L R G I K H * K P R C C S N V A K A N H * E E Y ----:----|----:----|----:----|----:----|----:----|----:----| G F M S F W S T T G I N C F C I V L L F E L C Q F G R H Q E L T A F A F * * S S W V N F V V I N N W H Q L L L D S L P I AgeI BetI* Cfr10I |HpaII MfeI || Csp6I TspEI BaeI || |RsaI \ \ \\ \\ ATCCCAATTGAAGTTGTTGCTTTGATAAACGACACTACCGGTACTTTGGTTGCTTCTTAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGGTTAACTTCAACAACGAAACTATTTGCTGTGATGGCCATGAAACCAACGAAGAATG / / //// / TspEI BaeI |||Csp6I TspRI MfeI ||RsaI BaeI |Cfr10I |BetI* |AgeI HpaII I P I E V V A L I N D T T G T L V A S Y S Q L K L L L * * T T L P V L W L L L T P N * S C C F D K R H Y R Y F G C F L L ----:----|----:----|----:----|----:----|----:----|----:----| I G I S T T A K I F S V V P V K T A E * Y G L Q L Q Q K S L R C * R Y K P Q K K D W N F N N S Q Y V V S G T S Q N S R V BaeI | TspRI | | TaqII | | | BccI MboII Csp6I | | | | DdeI | BaeI |RsaI BsrI \ \ \ \ \ \ \ \\ \ TACACTGACCCAGAAACTAAGATGGGTGTTATCTTCGGTACTGGTGTCAATGGTGCTTAC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTGACTGGGTCTTTGATTCTACCCACAATAGAAGCCATGACCACAGTTACCACGAATG / / / // // / / | | | |BaeI || BsrI BaeI | | | MboII |Csp6I | | DdeI RsaI | BccI TaqII Y T D P E T K M G V I F G T G V N G A Y T L T Q K L R W V L S S V L V S M V L T H * P R N * D G C Y L R Y W C Q W C L L ----:----|----:----|----:----|----:----|----:----|----:----| * V S G S V L I P T I K P V P T L P A * S C Q G L F * S P H * R R Y Q H * H H K V S V W F S L H T N D E T S T D I T S V Hpy188I AluI | EcoRV CviJI BaeI | | TaqI | SetI Hpy188I \ \ \ \ \ \ \ TACGATGTTTGTTCCGATATCGAAAAGCTACAAGGAAAACTATCTGATGACATTCCACCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCTACAAACAAGGCTATAGCTTTTCGATGTTCCTTTTGATAGACTACTGTAAGGTGGT / / / / / / | | | | CviJI Hpy188I | | | | AluI | | | SetI | | TaqI | EcoRV Hpy188I Y D V C S D I E K L Q G K L S D D I P P T M F V P I S K S Y K E N Y L M T F H H R C L F R Y R K A T R K T I * * H S T I ----:----|----:----|----:----|----:----|----:----|----:----| * S T Q E S I S F S C P F S D S S M G G S R H K N R Y R F A V L F V I Q H C E V V I N T G I D F L * L S F * R I V N W W Hin4II* BccI | FatI | MwoI | AflIII | |CfrI | BspLU11I* | || BalI Tsp4CI* | |CviAII | || CviJI BccI | NlaIV | || NspI | || HaeIII Tsp4CI* | | TaqI | || NlaIII TspDTI \ \\ \ \ \ \ \ \ \\ \ \ TCTGCTCCAATGGCCATCAACTGTGAATACGGTTCCTTCGATAATGAACATGTCGTTTTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGACGAGGTTACCGGTAGTTGACACTTATGCCAAGGAAGCTATTACTTGTACAGCAAAAC / / / / / / / / / / // / BccI | CfrI | BccI | NlaIV | | | || TspDTI MwoI HaeIII Tsp4CI* Tsp4CI* | | | |BspLU11I* CviJI | | | |AflIII BalI | | | |FatI | | | CviAII | | NlaIII | | NspI | Hin4II* TaqI S A P M A I N C E Y G S F D N E H V V L L L Q W P S T V N T V P S I M N M S F C C S N G H Q L * I R F L R * * T C R F A ----:----|----:----|----:----|----:----|----:----|----:----| D A G I A M L Q S Y P E K S L S C T T K M Q E L P W * S H I R N R R Y H V H R K R S W H G D V T F V T G E I I F M D N Q MboII |TspDTI ||BssKI ||EcoRII |||BsiYI* ||||ScrFI ||||BseBI ||||| CviJI EcoRV ||||| HaeIII |Hin4I TfiI ||||| |Hin4I HphI |Hin4I HinfI ||||| |Hin4I \ \\ \ \\\\\ \\ CCAAGAACTAAATACGATATCACCATTGATGAAGAATCTCCAAGACCAGGCCAACAAACC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTCTTGATTTATGCTATAGTGGTAACTACTTCTTAGAGGTTCTGGTCCGGTTGTTTGG / / / / // / / / / | | EcoRV | || | | EcoRII SetI | Hin4I | || | | HaeIII | Hin4I | || | | BssKI HphI | || | | CviJI | || | BseBI | || | ScrFI | || Hin4I | || Hin4I | |BsiYI* | TspDTI | MboII HinfI TfiI P R T K Y D I T I D E E S P R P G Q Q T Q E L N T I S P L M K N L Q D Q A N K P K N * I R Y H H * * R I S K T R P T N L ----:----|----:----|----:----|----:----|----:----|----:----| G L V L Y S I V M S S S D G L G P W C V A L F * I R Y * W Q H L I E L V L G V F W S S F V I D G N I F F R W S W A L L G SetI FatI | MboII SetI BccI AflIII | BbvII* | ApoI |CviJI BspLU11I* | | TsoI MaeIII DdeI | TspEI HphI |HaeIII |CviAII \ \ \ \ \ \ \ \ \\ \\ TTTGAAAAAATGTCTTCTGGTTACTACTTAGGTGAAATTTTGCGTTTGGCCTTGATGGAC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTTTTTTACAGAAGACCAATGATGAATCCACTTTAAAACGCAAACCGGAACTACCTG / / / / // / / / / | | BbvII* | |DdeI | HphI HaeIII NlaIII | TsoI | SetI TspEI CviJI NspI MboII MaeIII ApoI BccI F E K M S S G Y Y L G E I L R L A L M D L K K C L L V T T * V K F C V W P * W T * K N V F W L L L R * N F A F G L D G H ----:----|----:----|----:----|----:----|----:----|----:----| K S F I D E P * * K P S I K R K A K I S R Q F F T K Q N S S L H F K A N P R S P K F F H R R T V V * T F N Q T Q G Q H V TatI Bsp1407I |NspI |Csp6I |NlaIII ||RsaI ||| TspDTI ||| | MboII ||| | | SetI Hpy178III* DdeI TaqI CviJI \\\ \ \ \ \ \ \ \ ATGTACAAACAAGGTTTCATCTTCAAGAACCAAGACTTGTCTAAGTTCGACAAGCCTTTC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TACATGTTTGTTCCAAAGTAGAAGTTCTTGGTTCTGAACAGATTCAAGCTGTTCGGAAAG ///// / / / / / ||||| MboII Hpy178III* DdeI TaqI CviJI ||||| SetI ||||Bsp1407I ||||TatI |||Csp6I ||TspDTI ||RsaI |BspLU11I* |AflIII |FatI CviAII M Y K Q G F I F K N Q D L S K F D K P F C T N K V S S S R T K T C L S S T S L S V Q T R F H L Q E P R L V * V R Q A F R ----:----|----:----|----:----|----:----|----:----|----:----| M Y L C P K M K L F W S K D L N S L G K C T C V L N * R * S G L S T * T R C A K H V F L T E D E L V L V Q R L E V L R E BseYI | GsaI | CviJI | | MnlI | | | TfiI | | | HinfI | | | | TaqI | | | | | BinI* | | | | | | MboI | | | | | | XhoII | | | | | | | DpnI | | | | | | | |BstKTI | | | | | | | || TaqI FatI | | | | | | | || |Hpy178III* |CviAII | | | | | | | || || MaeI || NlaIII | | | | | | | || ||MboII |SetI \\ \ \ \ \ \ \ \ \ \\ \\\ \\ GTCATGGACACTTCTTACCCAGCCAGAATCGAGGAAGATCCATTCGAGAACCTAGAAGAT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTACCTGTGAAGAATGGGTCGGTCTTAGCTCCTTCTAGGTAAGCTCTTGGATCTTCTA / // / // / // // / /// / / | |FatI | |MnlI | || || | ||| SetI MaeI | CviAII | BseYI | || || | ||Hpy178III* NlaIII | CviJI | || || | |TaqI GsaI | || || | MboII | || || XhoII | || || MboI | || |DpnI | || BstKTI | |BinI* | TaqI HinfI TfiI V M D T S Y P A R I E E D P F E N L E D S W T L L T Q P E S R K I H S R T * K I H G H F L P S Q N R G R S I R E P R R Y ----:----|----:----|----:----|----:----|----:----|----:----| T M S V E * G A L I S S S G N S F R S S R * P C K K G L W F R P L D M R S G L L D H V S R V W G S D L F I W E L V * F I Tsp4CI* | Hpy178III* | | MaeII | | | SetI | | | TaiI | | | |TspEI | | | || MboI MboII | | | || BclI \ \ \ \ \\ \ ACCGATGACTTGTTCCAAAATGAGTTCGGTATCAACACTACTGTTCAAGAACGTAAATTG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCTACTGAACAAGGTTTTACTCAAGCCATAGTTGTGATGACAAGTTCTTGCATTTAAC / / / / / // MboII | | | MaeII |BstKTI | | TaiI TspEI | | SetI | Hpy178III* Tsp4CI* T D D L F Q N E F G I N T T V Q E R K L P M T C S K M S S V S T L L F K N V N * R * L V P K * V R Y Q H Y C S R T * I D ----:----|----:----|----:----|----:----|----:----|----:----| V S S K N W F S N P I L V V T * S R L N Y R H S T G F H T R Y * C * Q E L V Y I G I V Q E L I L E T D V S S N L F T F Q TseI AluI MwoI DpnI CviJI |BstKTI |BisI || Hpy188I ||BlsI || | MaeII Hpy188I ||SetI || | | SetI |TspEI ||TspGWI || | | TaiI || BbvI MaeI ||| MaeI BbvI \\ \ \ \ \\ \ \ \\\ \ \ ATCAGACGTTTATCTGAATTGATTGGTGCTAGAGCTGCTAGATTGTCCGTTTGTGGTATT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTCTGCAAATAGACTTAACTAACCACGATCTCGACGATCTAACAGGCAAACACCATAA / / / / / / / // //// / / | | | MaeII | | BbvI || |||| MaeI BbvI | | TaiI | TspEI || |||TseI | | SetI Hpy188I || ||BisI | Hpy188I || |BlsI | BclI || TspGWI | MboI || CviJI DpnI || AluI |SetI MwoI MaeI I R R L S E L I G A R A A R L S V C G I S D V Y L N * L V L E L L D C P F V V L Q T F I * I D W C * S C * I V R L W Y C ----:----|----:----|----:----|----:----|----:----|----:----| I L R K D S N I P A L A A L N D T Q P I S * V N I Q I S Q H * L Q * I T R K H Y D S T * R F Q N T S S S S S Q G N T T N TseI |BisI BbvI |SfeI* |AgeI ||BlsI |BetI* ||TspGWI |Cfr10I |||CviRI* TseI MaeIII ||HpaII |||| PstI |BisI | SetI ||| MaeIII |||| | Tsp4CI* BaeI ||BlsI MnlI | BtgZI ||| Tsp45I |||| | | NlaIV Hpy166II \\\ \ \ \ \\\ \ \\\\ \ \ \ \ GCTGCTATCTGTCAAAAGAGAGGTTACAAGACCGGTCACATCGCTGCAGACGGTTCCGTT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGATAGACAGTTTTCTCTCCAATGTTCTGGCCAGTGTAGCGACGTCTGCCAAGGCAA /// / / // // / //// / / // / ||TseI MnlI SetI |BtgZI || | |||| | | |BaeI Hpy166II |BisI MaeIII || | |||| | | NlaIV BlsI || | |||| | Tsp4CI* || | |||| SfeI* || | |||CviRI* || | |||TseI || | ||BisI || | |BlsI || | |PstI || | TspGWI || Tsp45I || MaeIII |Cfr10I |BetI* |AgeI HpaII BbvI A A I C Q K R G Y K T G H I A A D G S V L L S V K R E V T R P V T S L Q T V P F C Y L S K E R L Q D R S H R C R R F R L ----:----|----:----|----:----|----:----|----:----|----:----| A A I Q * F L P * L V P * M A A S P E T Q Q * R D F S L N C S R D C R Q L R N R S S D T L L S T V L G T V D S C V T G N TseI BssKI CviJI SecI* |BisI EcoRII ||BlsI | ScrFI ||BaeI | BseBI ||| BarI MlyI | | BbvI ||| MwoI PleI | | SetI ||| | Hin4II* | CviJI \ \ \ \\\ \ \ \ \ TACAACAGATACCCAGGTTTCAAAGAAAAGGCTGCCAATGCTTTGAAGGACATTTACGGC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTTGTCTATGGGTCCAAAGTTTCTTTTCCGACGGTTACGAAACTTCCTGTAAATGCCG //// / / //// / /// |||| BbvI | |||| Hin4II* ||CviJI |||EcoRII | |||MwoI |PleI |||BssKI | |||TseI MlyI ||SecI* | ||BisI |BseBI | |BlsI |ScrFI | |BarI SetI | CviJI BaeI Y N R Y P G F K E K A A N A L K D I Y G T T D T Q V S K K R L P M L * R T F T A Q Q I P R F Q R K G C Q C F E G H L R L ----:----|----:----|----:----|----:----|----:----|----:----| * L L Y G P K L S F A A L A K F S M * P K C C I G L N * L F P Q W H K S P C K R V V S V W T E F F L S G I S Q L V N V A BarI | BceAI | |SetI | || MaeI NlaIV | || EcoP15I |BetI* HinfI | || | MnlI Hpy178III* BccI ||HpaII \ \ \\ \ \ \ \ \\\ TGGACTCAAACCTCACTAGACGACTACCCAATCAAGATTGTTCCTGCTGAAGATGGTTCC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ACCTGAGTTTGGAGTGATCTGCTGATGGGTTAGTTCTAACAAGGACGACTTCTACCAAGG / / / / / / / / / / | | SetI | | MnlI Hpy178III* BccI | MboII | HinfI | EcoP15I NlaIV BarI | MaeI BceAI W T Q T S L D D Y P I K I V P A E D G S G L K P H * T T T Q S R L F L L K M V P D S N L T R R L P N Q D C S C * R W F R ----:----|----:----|----:----|----:----|----:----|----:----| Q V * V E S S S * G I L I T G A S S P E S S E F R V L R S G L * S Q E Q Q L H N P S L G * * V V V W D L N N R S F I T G HgiCI* |Eco57I |Eco57MI ||BbvI ||NlaIV |||MwoI ||||AciI ||||BisI |||||BlsI ||||||TauI ||||||NspBII* ||||||| MwoI ||||||| | TseI ||||||| | |BisI ||||||| | ||BlsI ||||||| | ||| MwoI ||||||| | ||| | AsuI* TspEI ||||||| | ||| | |CviJI | Hin4II* ||||||| | ||| | |HaeIII | | TspGWI MboII ||||||| | ||| | |BmgT120I | | | SetI \ \\\\\\\ \ \\\ \ \\ \ \ \ \ GGTGCTGGTGCCGCTGTTATTGCTGCTTTGGCCCAAAAAAGAATTGCTGAAGGTAAGTCC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CCACGACCACGGCGACAATAACGACGAAACCGGGTTTTTTCTTAACGACTTCCATTCAGG // // ///// / /// /// / // / || || ||||| MwoI ||MwoI ||AsuI* | || SetI || || ||||NspBII* ||TseI |BmgT120I | |TspGWI || || ||||AciI |BisI HaeIII | TspEI || || ||||BbvI BlsI CviJI Hin4II* || || |||BisI || || ||HgiCI* || || ||BlsI || || |TauI || || NlaIV || |MwoI || Eco57MI || Eco57I |BetI* HpaII G A G A A V I A A L A Q K R I A E G K S V L V P L L L L L W P K K E L L K V S P C W C R C Y C C F G P K K N C * R * V R ----:----|----:----|----:----|----:----|----:----|----:----| P A P A A T I A A K A W F L I A S P L D R H Q H R Q * Q Q K P G F F F Q Q L Y T T S T G S N N S S Q G L F S N S F T L G Eco57I Eco57MI MseI \ \ GTTGGTATCATCGGTGCTTAA 1450 1460 ----:----|----:----|- CAACCATAGTAGCCACGAATT / / Eco57MI MseI Eco57I V G I I G A * L V S S V L X W Y H R C L X ----:----|----:----|- T P I M P A * R Q Y * R H K N T D D T S L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AciI 2 BspACI,SsiI AflIII 2 AgeI 2 AsiGI,BshTI,CspAI,PinAI AluI 4 AluBI ApoI 4 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 3 BalI 2 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 6 Bce83I* 1 BpuEI BceAI 2 BclI 1 FbaI,Ksp22I BdaI 2 BetI* 4 BsaWI BinI* 1 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmgT120I 2 BplI 2 BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseMII 1 BseYI 2 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BspLU11I* 2 PscI,PciI BsrI 2 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 2 BstXI 1 BtgZI 1 Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 3 AcoI,EaeI Csp6I 6 CviQI,RsaNI CspCI 1 CviAII 4 CviJI 17 CviKI-1 CviRI* 4 HpyCH4V DdeI 7 BstDEI,HpyF3I DpnI 2 MalI DsaI* 1 BtgI,BstDSI Eco57I 2 AcuI Eco57MI 2 EcoP15I 1 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 2 Eco32I FatI 4 GsaI 2 HaeIII 6 BsnI,BsuRI,BshFI,PhoI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I Hin4I 2 Hin4II* 5 HpyAV HindIII 1 HinfI 6 HpaII 4 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 6 KpnI 1 MaeI 4 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 6 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 7 MfeI 1 MunI MlyI 2 SchI MmeI 1 MnlI 4 MseI 1 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 6 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 2 BstNSI,XceI PleI 2 PpsI PstI 1 RsaI 6 AfaI ScrFI 3 BmrFI,MspR9I,Bme1390I SecI* 2 BseDI,BssECI,BsaJI SetI 21 SfaNI 2 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 5 TaqII 2 TatI 2 TauI 1 TfiI 4 PfeI TseI 5 ApeKI TsoI 1 Tsp45I 2 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 14 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 2 TscAI TstI 1 XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AccI AclI AcyI AflII AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvrII BamHI BbvCI BcgI BciVI BfiI BglI BglII BmeT110I BmtI Bpu10I BsaAI BsaBI BsaXI BseGI BsePI BseRI BseSI BsgI BsiI* BslFI BsmAI BsmFI BsmI Bsp120I BspHI BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstF5I BstZ17I BtrI BtsCI BtsI Cac8I CauII* Cfr9I ClaI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRI EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FokI FseI FspAI GlaI GsuI HaeII HgaI HgiAI* HgiJII* HhaI Hin6I HindII HinP1I HpaI Hpy99I HspAI KasI Ksp632I* MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TspMI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769