Restriction Map of MDS3/YGL197W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MDS3/YGL197W on chromosome VII from coordinates 124698 to 129161.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.30058

HindIII | AluI | CviJI | | SetI FokI BseGI BccI EciI | | | AciI \ \ \ \ \ \ \ \ ATGCCTTTATTACAACCATCCACTTGCTTCTGCTACCCTTTGAAGCTTCCGCCATTACCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGAAATAATGTTGGTAGGTGAACGAAGACGATGGGAAACTTCGAAGGCGGTAATGGT / / / / / / / / / FokI BseGI BccI EciI | | | AciI TspRI | | HindIII | CviJI | AluI SetI M P L L Q P S T C F C Y P L K L P P L P C L Y Y N H P L A S A T L * S F R H Y H A F I T T I H L L L L P F E A S A I T T ----:----|----:----|----:----|----:----|----:----|----:----| X G K N C G D V Q K Q * G K F S G G N G X A K I V V M W K S R S G K S A E A M V H R * * L W G S A E A V R Q L K R W * W Hin6I |GlaI ||HhaI ||BsmI ||BssKI ||EcoRII ||| ScrFI ||| BseBI ||| | MmeI ||| | | BsiYI* ||| | | TspDTI ||| | | | MseI TspRI ||| | | | SetI | Hpy188I ||| | | | |HpaI | |TfiI ||| | | | |HindII | |HinfI ||| | | | |Hpy166II SfeI* \ \\ \\\ \ \ \ \\ \ CTGACTTCCGATTCCAACGAGTTTGATGAATGCGCCAGGAAAAGGTTAACGCTGGACTAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GACTGAAGGCTAAGGTTGCTCAAACTACTTACGCGGTCCTTTTCCAATTGCGACCTGATA / / /// //// / // | HinfI ||| |||| SetI |MseI | TfiI ||| |||TspDTI Hpy166II Hpy188I ||| |||EcoRII HindII ||| |||BssKI HpaI ||| ||BsiYI* ||| |BseBI ||| |ScrFI ||| MmeI ||Hin6I |GlaI BsmI HhaI L T S D S N E F D E C A R K R L T L D Y * L P I P T S L M N A P G K G * R W T I D F R F Q R V * * M R Q E K V N A G L * ----:----|----:----|----:----|----:----|----:----|----:----| S V E S E L S N S S H A L F L N V S S * V S K R N W R T Q H I R W S F T L A P S Q S G I G V L K I F A G P F P * R Q V I TatI Bsp1407I XmnI |Csp6I | SetI ||RsaI | | AciI |||FatI | | NspBII* HgaI ||||FokI | | | MaeIII HphI ||||CviAII | | | Tsp45I | SetI ||||| NlaIII BseGI \ \ \ \ \ \ \\\\\ \ \ AGAACAGGTTCAGCGGTGACGCTAACAAGGTCTAATATATTTGTACATGGTGGTCTAACC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTGTCCAAGTCGCCACTGCGATTGTTCCAGATTATATAAACATGTACCACCAGATTGG / // / / / // / /// /// / | |XmnI | AciI | |SetI HgaI ||| ||FokI BseGI | SetI | | HphI ||| |FatI SfeI* | Tsp45I ||| CviAII | MaeIII ||Bsp1407I NspBII* ||TatI |NlaIII |Csp6I RsaI R T G S A V T L T R S N I F V H G G L T E Q V Q R * R * Q G L I Y L Y M V V * P N R F S G D A N K V * Y I C T W W S N H ----:----|----:----|----:----|----:----|----:----|----:----| L V P E A T V S V L D L I N T C P P R V Y F L N L P S A L L T * Y I Q V H H D L S C T * R H R * C P R I Y K Y M T T * G TsoI | SetI | | BsrI | | | BspMI AluI | | | | ApoI CviRI* CviJI BccI | | | | TspEI |TspEI | SetI \ \ \ \ \ \ \\ \ \ ATCCCGTTGAACCTGCCAGTTGTAAATTCTATGCAATTACAAAAGGAGCTTATTCTCTTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGGCAACTTGGACGGTCAACATTTAAGATACGTTAATGTTTTCCTCGAATAAGAGAAA / / / / / / / / / | | BsrI | | | TspEI | CviJI | TsoI | | CviRI* | AluI | SetI | TspEI SetI BccI | ApoI BspMI I P L N L P V V N S M Q L Q K E L I L F S R * T C Q L * I L C N Y K R S L F S F P V E P A S C K F Y A I T K G A Y S L F ----:----|----:----|----:----|----:----|----:----|----:----| M G N F R G T T F E I C N C F S S I R K W G T S G A L Q L N * A I V F P A * E R D R Q V Q W N Y I R H L * L L L K N E K ApoI TspEI | MseI Esp3I CviRI* Tsp4CI* | |AhaIII* BsmAI \ \ \ \\ \ TTTGCAAAGGAAAAAAACAACGGTAGTTCTTTTAGGAATTTAAACGAGTGGATAAGTAAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGTTTCCTTTTTTTGTTGCCATCAAGAAAATCCTTAAATTTGCTCACCTATTCATTC / / /// / CviRI* Tsp4CI* ||MseI BsmAI |AhaIII* Esp3I TspEI ApoI F A K E K N N G S S F R N L N E W I S K L Q R K K T T V V L L G I * T S G * V R C K G K K Q R * F F * E F K R V D K * G ----:----|----:----|----:----|----:----|----:----|----:----| K A F S F F L P L E K L F K F S H I L L K Q L P F F C R Y N K * S N L R T S L Y K C L F F V V T T R K P I * V L P Y T L Eam1105I | XbaI | |MaeI | |Hpy178III* | || BssKI | || SexAI | || EcoRII | || | ScrFI | || | BseBI | || | |SetI | || | || Csp6I | || | || |FalI | || | || |FalI | || | || |RsaI | || | || || Hin4I MaeII | || | || || Hin4I | SetI | || | || || | HinfI | TaiI | || | || || | | Hpy178III* | Hin4I | || | || || | | | PleI | Hin4I | || | || || | | | |MlyI | | DdeI | || | || || | | | || SetI MnlI \ \ \ \ \\ \ \\ \\ \ \ \ \\ \ \ GAGACGTTTTTCTTAGACTTGATGTCTAGAACCTGGTACAGAGTCAAGACCTCCTTTGAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTGCAAAAAGAATCTGAACTACAGATCTTGGACCATGTCTCAGTTCTGGAGGAAACTG // / / / /// / / /// / // / / || MaeII DdeI | ||| | | ||Csp6I | || PleI MnlI |TaiI | ||| | | |RsaI | || MlyI |SetI | ||| | | EcoRII | |SetI Hin4I | ||| | | SexAI | Hpy178III* Hin4I | ||| | | BssKI HinfI | ||| | Hin4I | ||| | Hin4I | ||| | BseBI | ||| | ScrFI | ||| FalI | ||| FalI | ||SetI | |XbaI | Hpy178III* | MaeI Eam1105I E T F F L D L M S R T W Y R V K T S F D R R F S * T * C L E P G T E S R P P L T D V F L R L D V * N L V Q S Q D L L * P ----:----|----:----|----:----|----:----|----:----|----:----| S V N K K S K I D L V Q Y L T L V E K S P S T K R L S S T * F R T C L * S R R Q L R K E * V Q H R S G P V S D L G G K V MaeI | Hin6I FalI | |GlaI FalI | ||HhaI MnlI | TspEI MseI | |||HaeII \ \ \ \ \ \\\\ CAAAGGACAGAGGAATTATTAAAGGCAGAGAGTTCTAGCGCCAAAGCAGATAATGACACA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTCCTGTCTCCTTAATAATTTCCGTCTCTCAAGATCGCGGTTTCGTCTATTACTGTGT / / / / //// | FalI | MseI |||Hin6I | FalI TspEI ||GlaI MnlI |HhaI HaeII MaeI Q R T E E L L K A E S S S A K A D N D T K G Q R N Y * R Q R V L A P K Q I M T Q K D R G I I K G R E F * R Q S R * * H K ----:----|----:----|----:----|----:----|----:----|----:----| W L V S S N N F A S L E L A L A S L S V G F S L P I I L P L S N * R W L L Y H C L P C L F * * L C L T R A G F C I I V C TspGWI | SetI AciI | | Bce83I* | BsrBI | | | TfiI | |SmlI MseI | | | HinfI | ||MnlI CviJI \ \ \ \ \ \ \\\ \ AACGAGATTAGAACGGACATTAAGAAAGGTAAATCCCTTGAATCTCCGCTCAAGGAGAGG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCTCTAATCTTGCCTGTAATTCTTTCCATTTAGGGAACTTAGAGGCGAGTTCCTCTCC / / / / // / / | | Bce83I* | || SmlI CviJI | TspGWI | |MnlI | SetI | BsrBI MseI | AciI HinfI TfiI N E I R T D I K K G K S L E S P L K E R T R L E R T L R K V N P L N L R S R R G R D * N G H * E R * I P * I S A Q G E A ----:----|----:----|----:----|----:----|----:----|----:----| F S I L V S M L F P L D R S D G S L S L L R S * F P C * S L Y I G Q I E A * P S V L N S R V N L F T F G K F R R E L L P BseRI | BsmAI TstI | Eco31I BccI CviJI BsaXI | | Tsp4CI* \ \ \ \ \ \ CTATTCCATTCCTTATGTTATTTAGATGGCTGTTTATATATATTTGGTGGTCTCACAGTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GATAAGGTAAGGAATACAATAAATCTACCGACAAATATATATAAACCACCAGAGTGTCAC / / / / / / / / BccI CviJI | BsaXI | | | Eco31I TstI | | | BsmAI | | Tsp4CI* | TspRI BseRI L F H S L C Y L D G C L Y I F G G L T V Y S I P Y V I * M A V Y I Y L V V S Q C I P F L M L F R W L F I Y I W W S H S V ----:----|----:----|----:----|----:----|----:----|----:----| S N W E K H * K S P Q K Y I N P P R V T A I G N R I N N L H S N I Y I Q H D * L * E M G * T I * I A T * I Y K T T E C H TspRI | DdeI | BsmAI | | Hpy188I | | | BsiYI* | | | |AciI | | | |BsrBI | | | || MnlI | | | || |BsaXI | | | || || TstI BsrI | | | || || |BspCNI | MseI | | | || || ||BseMII | |AhaIII* \ \ \ \\ \\ \\\ \ \\ TCTCCTCAGAGCGGATATGAGTTGATTGCTACCAATGAGTTGTGGAAACTGGATTTAAAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGAGTCTCGCCTATACTCAACTAACGATGGTTACTCAACACCTTTGACCTAAATTTG /// /// // / // ||| ||| |BseMII BsrI |MseI ||| ||| BspCNI AhaIII* ||| ||MnlI ||| ||AciI ||| |BsaXI ||| |TstI ||| BsrBI ||BsmAI |DdeI Hpy188I BsiYI* S P Q S G Y E L I A T N E L W K L D L N L L R A D M S * L L P M S C G N W I * T S S E R I * V D C Y Q * V V E T G F K H ----:----|----:----|----:----|----:----|----:----|----:----| D G * L P Y S N I A V L S N H F S S K F T E E S R I H T S Q * W H T T S V P N L R R L A S I L Q N S G I L Q P F Q I * V BdaI BdaI BdaI Hin4II* BdaI FatI | MboII | MnlI | SetI |CviAII \ \ \ \ \ \ \\ ACGAAGAAGTGGTCGCTTTTGAGTGATGACCCTCAAATAGCGAGAAGGTTCAACCATACC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTTCTTCACCAGCGAAAACTCACTACTGGGAGTTTATCGCTCTTCCAAGTTGGTATGG / / / / / / | MboII | MnlI BdaI NlaIII BdaI Hin4II* BdaI BdaI SetI T K K W S L L S D D P Q I A R R F N H T R R S G R F * V M T L K * R E G S T I P E E V V A F E * * P S N S E K V Q P Y H ----:----|----:----|----:----|----:----|----:----|----:----| V F F H D S K L S S G * I A L L N L W V C S S T T A K S H H G E F L S F T * G Y R L L P R K Q T I V R L Y R S P E V M G FatI CviRI* NlaIII TspEI |CviAII | MseI ||EcoT22I | VspI ||| NspI | | TspEI Hpy188I ||| NlaIII BsmAI MmeI | | | MnlI | SetI \\\ \ \ \ \ \ \ \ \ \ ATGCATGTAAAGAACGAAAATAACGATAATAGAGACACGAAATTAATAATTGTCGGAGGT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTACATTTCTTGCTTTTATTGCTATTATCTCTGTGCTTTAATTATTAACAGCCTCCA /// // // // / / / / ||| |FatI |MmeI || | | | SetI ||| CviAII BsmAI || | | Hpy188I ||CviRI* || | TspEI ||NlaIII || MnlI ||FatI |VspI ||NspI |MseI |CviAII TspEI EcoT22I M H V K N E N N D N R D T K L I I V G G C M * R T K I T I I E T R N * * L S E V A C K E R K * R * * R H E I N N C R R S ----:----|----:----|----:----|----:----|----:----|----:----| M C T F F S F L S L L S V F N I I T P P W A H L S R F Y R Y Y L C S I L L Q R L H M Y L V F I V I I S V R F * Y N D S T FatI |CviAII || MboI || NlaIII || | DpnI || | |BstKTI || | || CviJI || | || Cfr10I || | || |HpaII || | || ||BinI* MseI || | || ||| Hpy178III* TspEI \ \\ \ \\ \\\ \ \ CTTAATAACATGGATCAGCCGGTCAAGAAAATAGACATCTATAACATCTCACAGAATTGC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GAATTATTGTACCTAGTCGGCCAGTTCTTTTATCTGTAGATATTGTAGAGTGTCTTAACG / / //// / / // / / | | |||| | | || Hpy178III* TspEI | | |||| | | |Cfr10I | | |||| | | BinI* | | |||| | | HpaII | | |||| | CviJI | | |||| MboI | | |||DpnI | | ||BstKTI | | |FatI | | CviAII | NlaIII MseI L N N M D Q P V K K I D I Y N I S Q N C L I T W I S R S R K * T S I T S H R I A * * H G S A G Q E N R H L * H L T E L L ----:----|----:----|----:----|----:----|----:----|----:----| R L L M S * G T L F I S M * L M E C F Q D * Y C P D A P * S F L C R Y C R V S N K I V H I L R D L F Y V D I V D * L I A BccI Cac8I Hpy188I | XcmI BsaBI \ \ \ \ \ TGGCAATCCGAAACCATACCCAAACAACCGATGGAAATCACTACAAATGTCAATGGCATA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| ACCGTTAGGCTTTGGTATGGGTTTGTTGGCTACCTTTAGTGATGTTTACAGTTACCGTAT / / // / Cac8I Hpy188I |XcmI BsaBI BccI W Q S E T I P K Q P M E I T T N V N G I G N P K P Y P N N R W K S L Q M S M A Y A I R N H T Q T T D G N H Y K C Q W H T ----:----|----:----|----:----|----:----|----:----|----:----| Q C D S V M G L C G I S I V V F T L P M S A I R F W V W V V S P F * * L H * H C P L G F G Y G F L R H F D S C I D I A Y MboI | DpnI | |BstKTI | || Hpy188I | || |ApoI CviJI | || |TspEI HaeIII | || || BinI* | AclI | || || | TaqI MnlI | MaeII \ \\ \\ \ \ \ \ \ CCATTAGCATTATCAAAGGATCAGAATTTTTCGATTTTAGTTGAAAATAATGAGGCCAAC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAATCGTAATAGTTTCCTAGTCTTAAAAAGCTAAAATCAACTTTTATTACTCCGGTTG // / // / / / / || | || TaqI MnlI | TaiI || | |TspEI | SetI || | |ApoI HaeIII || | BinI* CviJI || Hpy188I || MboI |DpnI BstKTI P L A L S K D Q N F S I L V E N N E A N H * H Y Q R I R I F R F * L K I M R P T I S I I K G S E F F D F S * K * * G Q R ----:----|----:----|----:----|----:----|----:----|----:----| G N A N D F S * F K E I K T S F L S A L V M L M I L P D S N K S K L Q F Y H P W W * C * * L I L I K R N * N F I I L G V Hin6I |GlaI |Eco47III Hin4I ||HhaI | TspDTI |||HaeII MboI | | Hpy188I ||||Cac8I BclI | | | XmnI SetI ||||| BsmI | DpnI | | | |TfiI TaiI ||||| | Hin4I | |BstKTI | | | |HinfI \ \\\\\ \ \ \ \\ \ \ \ \\ GTTCCAGCGCTGGCATTCTATATGAGAAGTGATCAAATAGACGAATATCTCGGAAAGGAT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGGTCGCGACCGTAAGATATACTCTTCACTAGTTTATCTGCTTATAGAGCCTTTCCTA / ////// // / / / / / | |||||Cac8I || BclI Hin4I | | XmnI | |||||BsmI || MboI | Hpy188I | ||||Hin4I |DpnI TspDTI | |||Hin6I BstKTI | ||Eco47III | ||GlaI | |HhaI | HaeII MaeII AclI V P A L A F Y M R S D Q I D E Y L G K D F Q R W H S I * E V I K * T N I S E R I S S A G I L Y E K * S N R R I S R K G F ----:----|----:----|----:----|----:----|----:----|----:----| T G A S A N * I L L S * I S S Y R P F S R E L A P M R Y S F H D F L R I D R F P N W R Q C E I H S T I L Y V F I E S L I AciI ApoI BisI Hpy188I TspEI |BlsI |TfiI EcoRI SfeI* ||TauI |HinfI \ \ \\\ \\ TCATCAAAGATAAAGGAGAATTCGCCTATAGTGGCGTTGCCGCTATTGTCTGAATCGCAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGTTTCTATTTCCTCTTAAGCGGATATCACCGCAACGGCGATAACAGACTTAGCGTT / / / //// / / / HinfI EcoRI SfeI* |||AciI | | SetI TfiI TspEI ||BisI | HinfI ApoI |BlsI | TfiI TauI Hpy188I S S K I K E N S P I V A L P L L S E S Q H Q R * R R I R L * W R C R Y C L N R K I K D K G E F A Y S G V A A I V * I A R ----:----|----:----|----:----|----:----|----:----|----:----| E D F I F S F E G I T A N G S N D S D C N M L S L P S N A * L P T A A I T Q I A * * L Y L L I R R Y H R Q R * Q R F R L BssKI | HpaII | ScrFI | CauII* AluI SetI BsmI | | MnlI TspGWI CviJI \ \ \ \ \ \ \ GGTATTAGAATGCCCTCAAACCCGGCATTACCGAAAAAACTATTGAATGTTCCGTATGAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAATCTTACGGGAGTTTGGGCCGTAATGGCTTTTTTGATAACTTACAAGGCATACTC / /// / / / BsmI ||BssKI TspGWI | CviJI |HpaII | AluI CauII* SetI ScrFI MnlI G I R M P S N P A L P K K L L N V P Y E V L E C P Q T R H Y R K N Y * M F R M S Y * N A L K P G I T E K T I E C S V * A ----:----|----:----|----:----|----:----|----:----|----:----| P I L I G E F G A N G F F S N F T G Y S L Y * F A R L G P M V S F V I S H E T H T N S H G * V R C * R F F * Q I N R I L MaeIII Tsp45I | SetI HphI Hin4I | | Hin4I |TfiI FokI Hin4I SetI | | Hin4I |HinfI | TspDTI | BseGI TspEI \ \ \ \ \\ \ \ \ \ \ CTATTAGCACCGACAGGTGACTATTTTGGATTCAATATCATAATCGGTGGGTTTCATCCA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GATAATCGTGGCTGTCCACTGATAAAACCTAAGTTATAGTATTAGCCACCCAAAGTAGGT // / / / / / / / |Hin4I | HphI HinfI | | | BseGI |Hin4I Tsp45I TfiI | | Hin4I SetI MaeIII | | Hin4I | FokI TspDTI L L A P T G D Y F G F N I I I G G F H P Y * H R Q V T I L D S I S * S V G F I Q I S T D R * L F W I Q Y H N R W V S S K ----:----|----:----|----:----|----:----|----:----|----:----| S N A G V P S * K P N L I M I P P N * G A I L V S L H S N Q I * Y * L R H T E D * * C R C T V I K S E I D Y D T P K M W BetI* BspMII* |HpaII |Hpy178III* || BsiYI* || | MaeIII || | Tsp45I || | | BsiI* || | | Hpy178III* TspDTI MnlI Hin4I MseI || | | |Hin4I \ \ \ \ \\ \ \ \\ AATTACCAATCCTCTAACTTTCATTGTTTTATATACGATATTAACTCCGGAAAGTGGTCA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTAATGGTTAGGAGATTGAAAGTAACAAAATATATGCTATAATTGAGGCCTTTCACCAGT / / / / / // / | TspDTI | Hin4I MseI || Hin4I TspEI MnlI |BspMII* |BsiYI* |BetI* Hpy178III* HpaII N Y Q S S N F H C F I Y D I N S G K W S I T N P L T F I V L Y T I L T P E S G H L P I L * L S L F Y I R Y * L R K V V T ----:----|----:----|----:----|----:----|----:----|----:----| F * W D E L K * Q K I Y S I L E P F H D L N G I R * S E N N * I R Y * S R F T T I V L G R V K M T K Y V I N V G S L P * TaqI ClaI PleI | MnlI |AciI | TfiI |MlyI | HinfI HinfI || Cac8I MwoI EcoRV | | Hpy178III* \ \\ \ \ \ \ \ \ CGAGTCGCTACCGCCTGCCCTGACTGCGATATCAATAAACATCGATTCTGGAGGGTATTT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GCTCAGCGATGGCGGACGGGACTGACGCTATAGTTATTTGTAGCTAAGACCTCCCATAAA / / / / / / / / // / / | | HinfI | | | MwoI EcoRV || | Hpy178III* | BsiI* | | Cac8I || HinfI | | AciI || TfiI | PleI |ClaI | MlyI |TaqI Hpy178III* MnlI Tsp45I MaeIII R V A T A C P D C D I N K H R F W R V F E S L P P A L T A I S I N I D S G G Y L S R Y R L P * L R Y Q * T S I L E G I C ----:----|----:----|----:----|----:----|----:----|----:----| R T A V A Q G S Q S I L L C R N Q L T N V L R * R R G Q S R Y * Y V D I R S P I S D S G G A R V A I D I F M S E P P Y K Acc65I HgiCI* |Csp6I ||RsaI GsuI Hpy188I ||NlaIV Eco57MI |SfaNI ||| KpnI HphI BfiI \ \\ \\\ \ \ \ GTTTGGAAATCGCATCATCAGACGATTTTGTTGGGTACCAAGACTGATGATTATTATTCA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CAAACCTTTAGCGTAGTAGTCTGCTAAAACAACCCATGGTTCTGACTACTAATAATAAGT / / / / /// / / / Eco57MI | SfaNI | ||HgiCI* HphI BfiI TspRI GsuI Hpy188I | ||Acc65I BsrI | |Csp6I | NlaIV | RsaI KpnI V W K S H H Q T I L L G T K T D D Y Y S F G N R I I R R F C W V P R L M I I I H L E I A S S D D F V G Y Q D * * L L F T ----:----|----:----|----:----|----:----|----:----|----:----| T Q F D C * * V I K N P V L V S S * * E Q K S I A D D S S K T P Y W S Q H N N N N P F R M M L R N Q Q T G L S I I I I * BsrI | DraIII | | TatI | | Bsp1407I | | |Csp6I | | |Hpy166II | | ||RsaI | | |||TspRI | | |||| TfiI | | |||| HinfI | | |||| |TaqII AciI | | |||| || TaqI BccI | NspBII* SspI MseI \ \ \\\\ \\ \ \ \ \ \ \ CCCAGTGTACAAAGATTCGACCATCTTTCCACTTTTGGATTACCGCTGGTAAATATTTTT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GGGTCACATGTTTCTAAGCTGGTAGAAAGGTGAAAACCTAATGGCGACCATTTATAAAAA / //// / / / / / / | |||| | | TaqI BccI NspBII* SspI | |||| | HinfI AciI | |||| | TfiI | |||| TaqII | |||Bsp1407I | |||TatI | ||Csp6I | |RsaI | Hpy166II DraIII P S V Q R F D H L S T F G L P L V N I F P V Y K D S T I F P L L D Y R W * I F L Q C T K I R P S F H F W I T A G K Y F * ----:----|----:----|----:----|----:----|----:----|----:----| G L T C L N S W R E V K P N G S T F I K V W H V F I R G D K W K Q I V A P L Y K G T Y L S E V M K G S K S * R Q Y I N K MboI BccI BglII XhoII | DpnI BinI* | |BstKTI | MboI | ||DdeI | | DpnI | ||| AluI | | |BstKTI | ||| CviJI BspCNI | | || TspEI | ||| | SetI |BseMII \ \ \\ \ \ \\\ \ \ \\ AACAAGACGATCCAATTACCCCATCACAAGATCTCAGCTTCGTCTTTACCAATACCCATA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTCTGCTAGGTTAATGGGGTAGTGTTCTAGAGTCGAAGCAGAAATGGTTATGGGTAT / / // / / // / /// // | | || MboI TspEI || | ||CviJI |BseMII | | |DpnI || | ||AluI BspCNI | | BstKTI || | |DdeI | BinI* || | SetI MseI || XhoII || BglII || MboI |DpnI BstKTI BccI N K T I Q L P H H K I S A S S L P I P I T R R S N Y P I T R S Q L R L Y Q Y P * Q D D P I T P S Q D L S F V F T N T H R ----:----|----:----|----:----|----:----|----:----|----:----| L L V I W N G W * L I E A E D K G I G M * C S S G I V G D C S R L K T K V L V W V L R D L * G M V L D * S R R * W Y G Y SetI AluI TspDTI CviJI FalI | AluI | SetI ApoI FalI | CviJI | FalI TspEI BciVI | MseI | | SetI HphI | FalI \ \ \ \ \ \ \ \ \ \ GAAAATTTTGCGAAGCATAAGGATACTCCATTAAAAAAGGTGAGCTTCACTTCATCAGCT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTAAAACGCTTCGTATTCCTATGAGGTAATTTTTTCCACTCGAAGTGAAGTAGTCGA / / / / / / / / / // / / TspEI BciVI FalI | | | | CviJI HphI || | SetI ApoI FalI | | | | AluI || CviJI | | | SetI || AluI | | TspDTI |SetI | SetI FalI MseI FalI E N F A K H K D T P L K K V S F T S S A K I L R S I R I L H * K R * A S L H Q L K F C E A * G Y S I K K G E L H F I S Y ----:----|----:----|----:----|----:----|----:----|----:----| S F K A F C L S V G N F F T L K V E D A L F N Q S A Y P Y E M L F P S S * K M L F I K R L M L I S W * F L H A E S * * S AluI CviJI | SetI | |AciI | || StyI SetI | || SecI* | TspEI | || | MboII | | MnlI EciI | || | BbvII* AjuI \ \ \ \ \ \\ \ \ \ ACCTCCCAATTTGAAAACTACATTAGATATATAGCTCCGCCCTTGGAAATGTCTTCTATC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAGGGTTAAACTTTTGATGTAATCTATATATCGAGGCGGGAACCTTTACAGAAGATAG / / / / / / / / TspEI EciI | | | | | BbvII* MnlI | | | | | AjuI | | | | SecI* | | | | StyI | | | MboII | | AciI | CviJI | AluI SetI T S Q F E N Y I R Y I A P P L E M S S I P P N L K T T L D I * L R P W K C L L S L P I * K L H * I Y S S A L G N V F Y P ----:----|----:----|----:----|----:----|----:----|----:----| V E W N S F * M L Y I A G G K S I D E I * R G I Q F S C * I Y L E A R P F T K * G G L K F V V N S I Y S R G Q F H R R D Tsp4CI* | FatI | NcoI | StyI | SecI* | DsaI* | |CviAII | ||AjuI | ||| NlaIII | ||| | MaeI SetI HgaI \ \\\ \ \ \ \ CAATCTGTGTTTCCACCGTATGCCATGGTTCTAGGTAAAGACGCTTTAGAGATTTACGGG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAGACACAAAGGTGGCATACGGTACCAAGATCCATTTCTGCGAAATCTCTAAATGCCC / / / // // / | | | || |MaeI HgaI | | | || SetI | | | |DsaI* | | | |SecI* | | | |StyI | | | |NcoI | | | |FatI | | | CviAII | | NlaIII | AjuI Tsp4CI* Q S V F P P Y A M V L G K D A L E I Y G N L C F H R M P W F * V K T L * R F T G I C V S T V C H G S R * R R F R D L R E ----:----|----:----|----:----|----:----|----:----|----:----| W D T N G G Y A M T R P L S A K S I * P G I Q T E V T H W P E L Y L R K L S K R L R H K W R I G H N * T F V S * L N V P HphI SpeI | AccI Hin4II* | |BssNAI | MlyI | |Hpy166II | PleI | || FatI | | MaeIII | || |CviAII Hpy188I | | Tsp45I | || || BseMII | ApoI | | | SetI | || || |BspCNI CviJI | MnlI TspEI |MaeI | | |HinfI | || || |NlaIII \ \ \ \ \\ \ \ \\ \ \\ \\ \\ AAGCCTCTTTCTGATTTTGAATTTATTACTAGTGAAGGTGACTCCATTGGTATACCATGC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TTCGGAGAAAGACTAAAACTTAAATAATGATCACTTCCACTGAGGTAACCATATGGTACG / / / / / // // // / // ///// CviJI | MnlI | | || |SetI || | || ||||FatI Hpy188I | | || |PleI || | || |||CviAII | | || MlyI || | || ||BspCNI | | |SpeI || | || |BseMII | | MaeI || | || NlaIII | Hin4II* || | |AccI TspEI || | Hpy166II ApoI || | BssNAI || HphI |HinfI Tsp45I MaeIII K P L S D F E F I T S E G D S I G I P C S L F L I L N L L L V K V T P L V Y H A A S F * F * I Y Y * * R * L H W Y T M L ----:----|----:----|----:----|----:----|----:----|----:----| F G R E S K S N I V L S P S E M P I G H S A E K Q N Q I * * * H L H S W Q Y V M L R K R I K F K N S T F T V G N T Y W A DdeI AsuI* TaqI BbvCI |NlaIV | FatI Bpu10I |BmgT120I | |CviAII |BceAI ||CviJI | || NspI MnlI || BccI ||HaeIII | || NlaIII \ \\ \ \\\ \ \\ \ TATTTGCTGAGGAAAAGATGGGGCCGTTATTTCGACATGCTTTTATCCCAGAGTTATACA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAACGACTCCTTTTCTACCCCGGCAATAAAGCTGTACGAAAATAGGGTCTCAATATGT / / / /// // // MnlI | BccI ||AsuI* || |FatI Bpu10I |BmgT120I || CviAII BbvCI |HaeIII |NlaIII BceAI |CviJI |NspI DdeI NlaIV TaqI Y L L R K R W G R Y F D M L L S Q S Y T I C * G K D G A V I S T C F Y P R V I Q F A E E K M G P L F R H A F I P E L Y K ----:----|----:----|----:----|----:----|----:----|----:----| * K S L F L H P R * K S M S K D W L * V S N A S S F I P G N N R C A K I G S N Y I Q Q P F S P A T I E V H K * G L T I C HphI | ApoI | TspEI | | Hin4I Hin4I | | Hin4I Hin4I TspDTI | | | TspDTI \ \ \ \ \ \ AAAGTTTGTGCTGATTATGAAACTACTGATACGCAATCTACACTAATAAAATTTTCACCA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCAAACACGACTAATACTTTGATGACTATGCGTTAGATGTGATTATTTTAAAAGTGGT / / / / / Hin4I TspDTI | | TspEI Hin4I | | ApoI | TspDTI Hin4I Hin4I HphI K V C A D Y E T T D T Q S T L I K F S P K F V L I M K L L I R N L H * * N F H H S L C * L * N Y * Y A I Y T N K I F T T ----:----|----:----|----:----|----:----|----:----|----:----| F T Q A S * S V V S V C D V S I F N E G L L K H Q N H F * Q Y A I * V L L I K V F N T S I I F S S I R L R C * Y F K * W XbaI |MaeI |Hpy178III* || XmnI || |Tsp4CI* || || MnlI || || | AluI || || | CviJI || || | | SetI || || | | | Hin4II* || || | | | | MlyI || || | | | | PleI || || | | | | | MboII || || | | | | | TspDTI || || | | | | | |AccI || || | | | | | |SetI || || | | | | | ||Hpy166II || || | | | | BarI | |||HinfI Ksp632I* \\ \\ \ \ \ \ \ \ \\\\ \ CATTCATCTAGAAACAGTTCTAAAGCTGTGAGGCAAGAAGGTAGACTCTCTTCATCGGGT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAGTAGATCTTTGTCAAGATTTCGACACTCCGTTCTTCCATCTGAGAGAAGTAGCCCA // / // / / / /// // / / // || | || | | Hin4II* ||| || HinfI | |BarI || | || | BarI ||| |AccI | TspRI || | || CviJI ||| Hpy166II Ksp632I* || | || AluI ||MboII || | |SetI |TspDTI || | MnlI |PleI || Tsp4CI* SetI || XmnI MlyI |XbaI Hpy178III* MaeI H S S R N S S K A V R Q E G R L S S S G I H L E T V L K L * G K K V D S L H R V F I * K Q F * S C E A R R * T L F I G F ----:----|----:----|----:----|----:----|----:----|----:----| C E D L F L E L A T L C S P L S E E D P V N M * F C N * L Q S A L L Y V R K M P M * R S V T R F S H P L F T S E R * R T Hpy166II | BarI | | BsrI SecI* | | TspRI TaqI |Hpy188I | | |TspEI AsuII MnlI || AsuI* \ \ \\ \ \ \\ \ TCACTGGACAATTATTTCGAAAAAAACTTCCCAATCTTTGCGAGAACAAGTGTTTCCGAG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGACCTGTTAATAAAGCTTTTTTTGAAGGGTTAGAAACGCTCTTGTTCACAAAGGCTC / / / / / / / | BsrI TspEI AsuII MnlI | SecI* Hpy166II TaqI Hpy188I S L D N Y F E K N F P I F A R T S V S E H W T I I S K K T S Q S L R E Q V F P R T G Q L F R K K L P N L C E N K C F R G ----:----|----:----|----:----|----:----|----:----|----:----| E S S L * K S F F K G I K A L V L T E S N V P C N N R F F S G L R Q S F L H K R * Q V I I E F F V E W D K R S C T N G L SetI |SfaNI || MnlI MaeI CviJI DdeI || | BspCNI AluI |SetI HaeIII SauI* || | |BseMII CviJI || Csp6I BmgT120I |SetI || | || BsmI | SetI || |RsaI \ \\ \\ \ \\ \ \ \ \\ \\ GCCCAGAACACACAACCTCAGGTAGCGAATGCTGATGCGAAAGCTCCAAATACACCTAGT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CGGGTCTTGTGTGTTGGAGTCCATCGCTTACGACTACGCTTTCGAGGTTTATGTGGATCA /// / // / // / / / / / / ||AsuI* SetI || | || BsmI | CviJI SetI | RsaI |BmgT120I || | |BseMII | AluI | TaiI HaeIII || | BspCNI SetI | SetI CviJI || | SfaNI MaeI || MnlI |SauI* |DdeI SetI A Q N T Q P Q V A N A D A K A P N T P S P R T H N L R * R M L M R K L Q I H L V P E H T T S G S E C * C E S S K Y T * Y ----:----|----:----|----:----|----:----|----:----|----:----| A W F V C G * T A F A S A F A G F V G L P G S C V V E P L S H Q H S L E L Y V * G L V C L R L Y R I S I R F S W I C R T MaeII | SetI | TaiI | | Hpy188I | | | MboII | | | | BseRI | | | | | AluI | | | | | CviJI | | | | | | SetI | | | | | | |MboII MnlI | | | | | | || TspDTI Hpy188I | | | | | | || |SapI Ksp632I* Hin4I | | | | | | || |Ksp632I* | MnlI | MnlI | | | | | | || ||Hin4I | | BseRI | |MaeII \ \ \ \ \ \ \\ \\\ \ \ \ \ \\ ACGTCAGATGAACCAAGCTCTTCCTCCTCTTCCGATTTATACTCCACTCCTCATTACCAA 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TGCAGTCTACTTGGTTCGAGAAGGAGGAGAAGGCTAAATATGAGGTGAGGAGTAATGGTT / / / / / / / /// / / // / // | | | | | | | ||| | | |Ksp632I* Hin4I |TaiI | | | | | | | ||| | | |BseRI |SetI | | | | | | | ||| | | MnlI MnlI | | | | | | | ||| | Hpy188I | | | | | | | ||| | MnlI | | | | | | | ||| Ksp632I* | | | | | | | ||| SapI | | | | | | | ||TspDTI | | | | | | | |Hin4I | | | | | | | MboII | | | | | | CviJI | | | | | | AluI | | | | | SetI | | | | BseRI | | | MboII | | Hpy188I | MaeII Csp6I T S D E P S S S S S S D L Y S T P H Y Q R Q M N Q A L P P L P I Y T P L L I T N V R * T K L F L L F R F I L H S S L P T ----:----|----:----|----:----|----:----|----:----|----:----| V D S S G L E E E E E S K Y E V G * * W Y T L H V L S K R R K R N I S W E E N G R * I F W A R G G R G I * V G S R M V L BseGI |MboII ||TspDTI |||AsuI* |||AvaII |||DraII |||PpuMI ||||BmgT120I |||||BssKI |||||NlaIV |||||| FokI |||||| HpaII SetI Ksp632I* |||||| ScrFI TaiI |MnlI MnlI |||||| CauII* CviJI \ \\ \ \\\\\\ \ \ CGTAATAATGATGAAGAGGATGACGAGGACCCGGTTTCCCCGAAGCCTGTATCAAAATCA 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GCATTATTACTACTTCTCCTACTGCTCCTGGGCCAAAGGGGCTTCGGACATAGTTTTAGT / / / / / / // //// / MaeII | | MnlI | | || |||FokI CviJI | Ksp632I* | | || ||BssKI MnlI | | || |HpaII | | || CauII* | | || ScrFI | | |PpuMI | | |DraII | | |AvaII | | |AsuI* | | BmgT120I | | NlaIV | TspDTI | MboII BseGI R N N D E E D D E D P V S P K P V S K S V I M M K R M T R T R F P R S L Y Q N Q * * * * R G * R G P G F P E A C I K I K ----:----|----:----|----:----|----:----|----:----|----:----| R L L S S S S S S S G T E G F G T D F D V Y Y H H L P H R P G P K G S A Q I L I T I I I F L I V L V R N G R L R Y * F * Tsp4CI* | SfeI* TspDTI MboII \ \ \ \ AACAGTATCTATAGACCCATTAGAAAGACAGAAAGTTCATCAACAACGAGTTCTTCAAAC 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTCATAGATATCTGGGTAATCTTTCTGTCTTTCAAGTAGTTGTTGCTCAAGAAGTTTG / / / / / Tsp4CI* SfeI* TspDTI MboII Tsp4CI* N S I Y R P I R K T E S S S T T S S S N T V S I D P L E R Q K V H Q Q R V L Q T Q Y L * T H * K D R K F I N N E F F K R ----:----|----:----|----:----|----:----|----:----|----:----| F L I * L G M L F V S L E D V V L E E F L C Y R Y V W * F S L F N M L L S N K L V T D I S G N S L C F T * * C R T R * V AciI |BisI ||BlsI |||TauI |||CviJI Hpy188I |||| MaeIII | Csp6I |||| | MaeII | |RsaI |||| | | SetI TspRI Tsp4CI* | || SetI |||| | | TaiI |CviJI \ \ \\ \ \\\\ \ \ \ \\ GGTATGATTTTCAGAGTACCTTTCAAGGAAAAAGCGGCTGTAACGTCAAACACTGAAGCC 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| CCATACTAAAAGTCTCATGGAAAGTTCCTTTTTCGCCGACATTGCAGTTTGTGACTTCGG / // //// / // / / | |Csp6I |||| | || TspRI CviJI | RsaI |||| | |MaeII | SetI |||| | MaeIII Hpy188I |||| TaiI |||| SetI |||CviJI ||BisI ||AciI |BlsI TauI G M I F R V P F K E K A A V T S N T E A V * F S E Y L S R K K R L * R Q T L K P Y D F Q S T F Q G K S G C N V K H * S P ----:----|----:----|----:----|----:----|----:----|----:----| P I I K L T G K L S F A A T V D F V S A R Y S K * L V K * P F L P Q L T L C Q L T H N E S Y R E L F F R S Y R * V S F G HinfI | MnlI MboI | | Eco57I | DpnI | | Eco57MI | |FokI | | |PleI | |BstKTI | | ||MlyI Hpy178III* | || MboII | | |||SetI | TspEI CviJI | || | MboII BseGI \ \ \\\\ \ \ \ \ \\ \ \ \ CTCTTGGAGTCAAACCTTTCACTTCAAGAATTGAGCCGAAGAAGATCATCACTTATGAGC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| GAGAACCTCAGTTTGGAAAGTGAAGTTCTTAACTCGGCTTCTTCTAGTAGTGAATACTCG // // / / / / // / // / / || || PleI | | CviJI || | || | BseGI || || MlyI | TspEI || | || MboII || |SetI Hpy178III* || | |FokI || Eco57MI || | MboII || Eco57I || MboI |HinfI |DpnI MnlI BstKTI L L E S N L S L Q E L S R R R S S L M S S W S Q T F H F K N * A E E D H H L * A L G V K P F T S R I E P K K I I T Y E H ----:----|----:----|----:----|----:----|----:----|----:----| R K S D F R E S * S N L R L L D D S I L G R P T L G K V E L I S G F F I M V * S E Q L * V K * K L F Q A S S S * * K H A SfaNI | Hpy166II | | DdeI FokI | | | HphI |MaeII | | | |AsuI* || SetI | | | |AvaII || TaiI | | | |DraII || | Hpy99I | | | |PpuMI MnlI || | Eco57I | | | ||BmgT120I Hpy188I || | Eco57MI | | | |||SetI | AciI || | | CviRI* \ \ \ \\\\ \ \ \\ \ \ \ ATCCCGTCTGGTGAACTTCTAAGGTCCTCTATATCTGAAGCGGAACATCAACGTCGTGCA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGGCAGACCACTTGAAGATTCCAGGAGATATAGACTTCGCCTTGTAGTTGCAGCACGT // // // / / // // / || || |PpuMI | AciI || || CviRI* || || |DraII Hpy188I || |Eco57MI || || |AvaII MnlI || |Eco57I || || |AsuI* || |FokI || || BmgT120I || MaeII || |DdeI |Hpy99I || HphI TaiI || SetI SetI |Hpy166II SfaNI I P S G E L L R S S I S E A E H Q R R A S R L V N F * G P L Y L K R N I N V V H P V W * T S K V L Y I * S G T S T S C I ----:----|----:----|----:----|----:----|----:----|----:----| M G D P S S R L D E I D S A S C * R R A C G T Q H V E L T R * I Q L P V D V D H D R R T F K * P G R Y R F R F M L T T C BseGI AlfI AciI | TspDTI AlfI |BisI | | SfaNI AciI NlaIV ||BlsI | | | HphI | BsrBI |MboII |||TauI \ \ \ \ \ \ \\ \\\\ TCTCATCCACTCACTTCATCACCGCTCTTTGAAGATAGTGGAACCCCTTGCGGCAAACAA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGTAGGTGAGTGAAGTAGTGGCGAGAAACTTCTATCACCTTGGGGAACGCCGTTTGTT / / // / / / /// | TspDTI |SfaNI BsrBI | MboII ||BisI BseGI HphI AciI | NlaIV ||AciI AlfI |BlsI AlfI TauI S H P L T S S P L F E D S G T P C G K Q L I H S L H H R S L K I V E P L A A N N S S T H F I T A L * R * W N P L R Q T T ----:----|----:----|----:----|----:----|----:----|----:----| D * G S V E D G S K S S L P V G Q P L C M E D V * K M V A R Q L Y H F G K R C V R M W E S * * R E K F I T S G R A A F L MnlI CviRI* | BssKI | MwoI | SecI* | BstAPI | | HpaII | | CviRI* | | ScrFI | | | AlfI | | CauII* | | | AlfI MnlI | | |TsoI \ \ \ \ \ \ \ \\ CTGCAACAACTGCAACAACATACTATACAAAATCCTCATAACCATTTGTCGCCCCGGAGG 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| GACGTTGTTGACGTTGTTGTATGATATGTTTTAGGAGTATTGGTAAACAGCGGGGCCTCC / / / / / / / /// | | | AlfI MnlI | | ||BssKI | | | AlfI | | ||SetI | | CviRI* | | |SecI* | BstAPI | | |HpaII | MwoI | | CauII* CviRI* | | ScrFI | TsoI MnlI L Q Q L Q Q H T I Q N P H N H L S P R R C N N C N N I L Y K I L I T I C R P G G A T T A T T Y Y T K S S * P F V A P E V ----:----|----:----|----:----|----:----|----:----|----:----| S C C S C C C V I C F G * L W K D G R L V A V V A V V Y * V F D E Y G N T A G S Q L L Q L L M S Y L I R M V M Q R G P P Hpy188I MboII | MaeII MaeII | |BtrI |BsaAI | || SetI SetI || SetI | || TaiI | Hpy178III* || TaiI | || | ApoI | | CviRI* TspEI || MboII | || | TspEI \ \ \ \ \\ \ \ \\ \ \ TTTTCAAGAAGTGCAAGAAGTTCAATTTCCTACGTGAGTTCTTCTTCCGATAGACGTGGA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAGTTCTTCACGTTCTTCAAGTTAAAGGATGCACTCAAGAAGAAGGCTATCTGCACCT / / / / // / / // | CviRI* | | |MaeII | | |MaeII Hpy178III* | | |MboII | | BtrI | | BsaAI | TaiI | MboII | SetI | TaiI Hpy188I | SetI TspEI F S R S A R S S I S Y V S S S S D R R G F Q E V Q E V Q F P T * V L L P I D V E F K K C K K F N F L R E F F F R * T W K ----:----|----:----|----:----|----:----|----:----|----:----| N E L L A L L E I E * T L E E E S L R P T K L F H L F N L K R R S N K K R Y V H K * S T C S T * N G V H T R R G I S T S AluI CspCI SduI CviJI TspEI MaeI HgiAI* | SetI BsrI BsiYI* \ \ \ \ \ \ \ AATTCAATTTCTAGCAGGAGCACAAGCGATAGCTTTGGAACTCCACCAGTTTTGGGCGTT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGTTAAAGATCGTCCTCGTGTTCGCTATCGAAACCTTGAGGTGGTCAAAACCCGCAA / / / / / / / / | | MaeI HgiAI* | CviJI BsrI BsiYI* | TspEI SduI | AluI TspEI CspCI ApoI SetI N S I S S R S T S D S F G T P P V L G V I Q F L A G A Q A I A L E L H Q F W A F F N F * Q E H K R * L W N S T S F G R F ----:----|----:----|----:----|----:----|----:----|----:----| F E I E L L L V L S L K P V G G T K P T F N L K * C S C L R Y S Q F E V L K P R I * N R A P A C A I A K S S W W N Q A N SetI | FatI Csp6I | |CviAII CspCI | |TspDTI |RsaI MnlI | || MnlI |BseRI SetI | MnlI SetI | || NlaIII \\ \ \ \ \ \ \\ \ TTGAATGTACCATTACCTCCTCAAACAAGAGAACCTAATGAACCACCTCCACCATGTCCT 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTACATGGTAATGGAGGAGTTTGTTCTCTTGGATTACTTGGTGGAGGTGGTACAGGA // // / / / / / // // || || SetI | | SetI SetI || |FatI || |Csp6I | MnlI || CviAII || RsaI MnlI || MnlI |BseRI |NlaIII CspCI TspDTI L N V P L P P Q T R E P N E P P P P C P * M Y H Y L L K Q E N L M N H L H H V L E C T I T S S N K R T * * T T S T M S C ----:----|----:----|----:----|----:----|----:----|----:----| K F T G N G G * V L S G L S G G G G H G K S H V M V E E F L L V * H V V E V M D Q I Y W * R R L C S F R I F W R W W T R Csp6I BsrDI |RsaI BsmI ||Cfr10I CviRI* |||HpaII MseI | EcoT22I CviRI* |||| CviJI SetI | | TspGWI \ \\\\ \ \ \ \ \ GCAATGAGTACCGGCTCAAATACAAGGCGAAGCAACACCTTAACGGATTATATGCATTCT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTACTCATGGCCGAGTTTATGTTCCGCTTCGTTGTGGAATTGCCTAATATACGTAAGA / / // // / / / / / | | || |Cfr10I SetI MseI | | TspGWI | | || |CviJI | CviRI* | | || HpaII EcoT22I | | |Csp6I BsmI | | RsaI | BsrDI CviRI* A M S T G S N T R R S N T L T D Y M H S Q * V P A Q I Q G E A T P * R I I C I L N E Y R L K Y K A K Q H L N G L Y A F * ----:----|----:----|----:----|----:----|----:----|----:----| A I L V P E F V L R L L V K V S * I C E Q L S Y R S L Y L A F C C R L P N Y A N C H T G A * I C P S A V G * R I I H M R AccI |Hpy166II || MaeII || | SetI NheI || | TaiI CviJI || | | MaeI |MaeI || | | | TatI ||Cac8I MboI || | | | |Csp6I ||| BmtI | DpnI || | | | ||RsaI ||| MboII | |BstKTI || | | | |||Hpy166II ||| CviJI | || Hpy99I || | | | |||| BetI* \\\ \ \ \\ \ \\ \ \ \ \\\\ \ AACAAGGCTAGCCCGTTTTCTTCTCGTAGATCGTCGCATATCGGTAGACGTTCTAGTACA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTCCGATCGGGCAAAAGAAGAGCATCTAGCAGCGTATAGCCATCTGCAAGATCATGT / /// //// // / / /// | ||CviJI |||MboI || | | ||TatI | ||NheI ||Hpy99I || | | |Hpy166II | |MboII |DpnI || | | |Csp6I | |MaeI BstKTI || | | RsaI | Cac8I || | MaeI CviJI || MaeII BmtI |AccI |TaiI |SetI Hpy166II N K A S P F S S R R S S H I G R R S S T T R L A R F L L V D R R I S V D V L V H Q G * P V F F S * I V A Y R * T F * Y T ----:----|----:----|----:----|----:----|----:----|----:----| L L A L G N E E R L D D C I P L R E L V * C P * G T K K E Y I T A Y R Y V N * Y V L S A R K R R T S R R M D T S T R T C MwoI BstAPI BseGI TspGWI | BccI | FokI | | DdeI HpaII BsmI | |CviRI* | | | SfaNI \ \ \ \\ \ \ \ \ CCGGAAACGGAAAACGCATTCTCTGCAACACCAAGAGCATCCTTAGATGGTCAAATGTTA 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| GGCCTTTGCCTTTTGCGTAAGAGACGTTGTGGTTCTCGTAGGAATCTACCAGTTTACAAT // / // / / / / / / |BetI* BsmI || | FokI BseGI | DdeI SfaNI HpaII || CviRI* BccI |TspGWI BstAPI MwoI P E T E N A F S A T P R A S L D G Q M L R K R K T H S L Q H Q E H P * M V K C * G N G K R I L C N T K S I L R W S N V R ----:----|----:----|----:----|----:----|----:----|----:----| G S V S F A N E A V G L A D K S P * I N V P F P F R M R Q L V L L M R L H D F T R F R F V C E R C C W S C G * I T L H * TatI Tsp4CI* |Csp6I ||RsaI |||Hpy166II |||| CviJI Hin4II* |||| |StyI BseGI | Hin4II* SetI |||| |SecI* | XmnI FokI \ \ \ \\\\ \\ \ \ \ GGAAAATCTTTGAAGGAAGGTTCTACATCACAGTACACACAGCCAAGGATGAACTCTTTC 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTTTAGAAACTTCCTTCCAAGATGTAGTGTCATGTGTGTCGGTTCCTACTTGAGAAAG / / / / /// / / / / | Hin4II* SetI | ||TatI | | | XmnI Hin4II* | || | | BseGI | || | SecI* | || | StyI | || CviJI | |Hpy166II | |Csp6I | RsaI Tsp4CI* G K S L K E G S T S Q Y T Q P R M N S F E N L * R K V L H H S T H S Q G * T L S K I F E G R F Y I T V H T A K D E L F P ----:----|----:----|----:----|----:----|----:----|----:----| P F D K F S P E V D C Y V C G L I F E K L F I K S P L N * M V T C V A L S S S K S F R Q L F T R C * L V C L W P H V R E TspGWI TspDTI BceAI |NlaIV | CviJI TspDTI | TaqII ||CviJI TspDTI \ \ \ \ \ \\\ \ CCAAAGGCTAATGAAACCATACAAACACCCACATCATCAAACAATGAATGGAGCCGTCAA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTCCGATTACTTTGGTATGTTTGTGGGTGTAGTAGTTTGTTACTTACCTCGGCAGTT / / / / / / // / | | CviJI TspDTI TaqII | || TspDTI | FokI BceAI | |CviJI TspDTI | NlaIV TspGWI P K A N E T I Q T P T S S N N E W S R Q Q R L M K P Y K H P H H Q T M N G A V N K G * * N H T N T H I I K Q * M E P S I ----:----|----:----|----:----|----:----|----:----|----:----| G F A L S V M C V G V D D F L S H L R * G L P * H F W V F V W M M L C H I S G D W L S I F G Y L C G C * * V I F P A T L Tsp4CI* | CviRI* | | MmeI MaeIII | | | TspEI \ \ \ \ \ TCCGTTACTTCAAATACAGATAGTTTTGACAGTTTGCAATCTAATTTTGCGTTAGAGTTG 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCAATGAAGTTTATGTCTATCAAAACTGTCAAACGTTAGATTAAAACGCAATCTCAAC / / / / MaeIII | CviRI* TspEI | MmeI Tsp4CI* S V T S N T D S F D S L Q S N F A L E L P L L Q I Q I V L T V C N L I L R * S W R Y F K Y R * F * Q F A I * F C V R V G ----:----|----:----|----:----|----:----|----:----|----:----| D T V E F V S L K S L K C D L K A N S N I R * K L Y L Y N Q C N A I * N Q T L T G N S * I C I T K V T Q L R I K R * L Q StyI SecI* SecI* | CfrI | MaeIII | | BalI Tsp4CI* MseI | Tsp45I | | CviJI | TaqI NlaIV |MnlI | | SetI | | HaeIII SetI | MnlI \ \\ \ \ \ \ \ \ \ \ \ GAACCACTTTTAACACCGAGGTCACTTTATATGCCTTGGCCAACCTCCACAGTTCGAGCA 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGGTGAAAATTGTGGCTCCAGTGAAATATACGGAACCGGTTGGAGGTGTCAAGCTCGT / / / / / / // // / / / NlaIV | MseI | | Tsp45I || |SetI | | TaqI MnlI | | MaeIII || CfrI | MnlI | SecI* |HaeIII Tsp4CI* SetI |CviJI |BalI SecI* StyI E P L L T P R S L Y M P W P T S T V R A N H F * H R G H F I C L G Q P P Q F E H T T F N T E V T L Y A L A N L H S S S I ----:----|----:----|----:----|----:----|----:----|----:----| S G S K V G L D S * I G Q G V E V T R A P V V K L V S T V K Y A K A L R W L E L F W K * C R P * K I H R P W G G C N S C BsrI HgiCI* TspRI | NlaIV AciI | BfiI | | BsrI | ApoI | |Hpy166II | | | MwoI | TspEI | || Tsp4CI* CviJI | | | BstAPI \ \ \ \\ \ \ \ \ \ \ TTTGCGGAATTTTTTTACACTGGGCAAGTAAACAGTAAATGGCTTTTGGCACCAGTTGCT 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGCCTTAAAAAAATGTGACCCGTTCATTTGTCATTTACCGAAAACCGTGGTCAACGA / / / / / / / / / / AciI | TspRI BsrI | | Tsp4CI* CviJI | HgiCI* TspEI | Hpy166II | BstAPI ApoI BfiI | MwoI NlaIV BsrI F A E F F Y T G Q V N S K W L L A P V A L R N F F T L G K * T V N G F W H Q L L C G I F L H W A S K Q * M A F G T S C S ----:----|----:----|----:----|----:----|----:----|----:----| N A S N K * V P C T F L L H S K A G T A M Q P I K K C Q A L L C Y I A K P V L Q K R F K K V S P L Y V T F P K Q C W N S TspDTI Tsp4CI* | BinI* CfrI | |TspEI | BalI | || MboI | CviJI | || | DpnI Hpy178III* | HaeIII | || | |BstKTI \ \ \ \ \\ \ \\ CTTGATTTATTAGTAATGGCCAAGATTTATGAAATACCATTACTGTATAAATTGATCCTT 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTAAATAATCATTACCGGTTCTAAATACTTTATGGTAATGACATATTTAACTAGGAA / / / // / /// / Hpy178III* | CfrI || | ||| MboI HaeIII || | ||DpnI CviJI || | |BstKTI BalI || | TspEI || BinI* |Tsp4CI* TspDTI L D L L V M A K I Y E I P L L Y K L I L L I Y * * W P R F M K Y H Y C I N * S L * F I S N G Q D L * N T I T V * I D P * ----:----|----:----|----:----|----:----|----:----|----:----| R S K N T I A L I * S I G N S Y L N I R E Q N I L L P W S K H F V M V T Y I S G K I * * Y H G L N I F Y W * Q I F Q D K TsoI | TaqI TatI | | TfiI MboII |Csp6I | | HinfI CviJI | MseI ||RsaI \ \ \ \ \ \ \\\ GAAGTTTTATATTCGATTCTGGCTAAAAAAGAAGAAAGTTTATCCTTAATATGTACTTCG 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCAAAATATAAGCTAAGACCGATTTTTTCTTCTTTCAAATAGGAATTATACATGAAGC / / / / / / /// TsoI | | CviJI MboII MseI ||TatI | HinfI |Csp6I | TfiI RsaI TaqI E V L Y S I L A K K E E S L S L I C T S K F Y I R F W L K K K K V Y P * Y V L R S F I F D S G * K R R K F I L N M Y F V ----:----|----:----|----:----|----:----|----:----|----:----| S T K Y E I R A L F S S L K D K I H V E Q L K I N S E P * F L L F N I R L I Y K F N * I R N Q S F F F F T * G * Y T S R MseI BsmAI Eco31I SetI Hpy188I SetI HphI \ \ \ \ \ TTAATGGAGACCTTTCGCACCAAAACTCTGAACTCCTATAAAGGTGATGAAGAAAAAACA 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| AATTACCTCTGGAAAGCGTGGTTTTGAGACTTGAGGATATTTCCACTACTTCTTTTTTGT / / / / / / / | | SetI Hpy188I SetI HphI TspDTI | Eco31I MboII | BsmAI MseI L M E T F R T K T L N S Y K G D E E K T * W R P F A P K L * T P I K V M K K K Q N G D L S H Q N S E L L * R * * R K N K ----:----|----:----|----:----|----:----|----:----|----:----| N I S V K R V L V R F E * L P S S S F V T L P S R E C W F E S S R Y L H H L F F * H L G K A G F S Q V G I F T I F F F C BsaBI | Hpy178III* | | AlwNI | | | Tsp4CI* MboII | | | | TspEI |TspDTI | | | | | MseI \\ \ \ \ \ \ \ AATACTTATTTGACTTCAAACGATAACTATCAGGAACTGTTGAAATTAAAAGTGTCGCTG 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGAATAAACTGAAGTTTGCTATTGATAGTCCTTGACAACTTTAATTTTCACAGCGAC / / / // BsaBI | Tsp4CI* |MseI Hpy178III* TspEI AlwNI N T Y L T S N D N Y Q E L L K L K V S L I L I * L Q T I T I R N C * N * K C R W Y L F D F K R * L S G T V E I K S V A G ----:----|----:----|----:----|----:----|----:----|----:----| F V * K V E F S L * * S S N F N F T D S L Y K N S K L R Y S D P V T S I L L T A I S I Q S * V I V I L F Q Q F * F H R Q Tsp4CI* | Hpy178III* | | MboII | | BbvII* | | | SduI GsuI | | | HgiAI* TaqI Eco57MI MaeIII | | | | Tsp4CI* \ \ \ \ \ \ \ \ GAGAATATCGACAATGGGTATTATGACCCAGATTTGTTACGCAAACAGTCAAGAGCACAG 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTATAGCTGTTACCCATAATACTGGGTCTAAACAATGCGTTTGTCAGTTCTCGTGTC / / / / // // TaqI Eco57MI | | || |Tsp4CI* GsuI | | || BbvII* | | |HgiAI* | | |SduI | | Hpy178III* | | MboII | Tsp4CI* MaeIII E N I D N G Y Y D P D L L R K Q S R A Q R I S T M G I M T Q I C Y A N S Q E H S E Y R Q W V L * P R F V T Q T V K S T V ----:----|----:----|----:----|----:----|----:----|----:----| S F I S L P Y * S G S K N R L C D L A C P S Y R C H T N H G L N T V C V T L L V L I D V I P I I V W I Q * A F L * S C L CviRI* | BceAI | | MwoI | | |Hin6I | | ||GlaI BtsI | | ||BsrI TspRI | | |||HhaI |BcgI | | ||||HaeII || CviRI* | | |||||Cac8I \\ \ \ \ \\\\\\ TCTTCAAGCACACAAGAAAGCAGTGGTAGTGCAAACGGCGAAAAAACTGCAACTGGCGCT 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGTTCGTGTGTTCTTTCGTCACCATCACGTTTGCCGCTTTTTTGACGTTGACCGCGA / // / / // //// / TspRI |BcgI CviRI* | || |||| Cac8I BtsI | || |||| BcgI | || |||Hin6I | || ||GlaI | || |HhaI | || HaeII | || BsrI | |BceAI | MwoI CviRI* S S S T Q E S S G S A N G E K T A T G A L Q A H K K A V V V Q T A K K L Q L A L F K H T R K Q W * C K R R K N C N W R W ----:----|----:----|----:----|----:----|----:----|----:----| D E L V C S L L P L A F P S F V A V P A T K L C V L F C H Y H L R R F F Q L Q R R * A C L F A T T T C V A F F S C S A S BcgI Cac8I CviJI GsuI | AciI | BsmAI Eco57MI | | AsuI* | | Hpy178III* | SfeI* | | AvaII | | |MboII | | BslFI | | |BmgT120I | | || BslFI | | |Tsp4CI* | | ||NlaIV \ \ \\ \ \ \ \\ \ \ \\\ GGCTCTCTGGAGACTTCTTCAACCAATGTCCCTACAGTATTTGCTGGCGGTCCCAGAGAT 3490 3500 3510 3520 3530 3540 ----:----|----:----|----:----|----:----|----:----|----:----| CCGAGAGACCTCTGAAGAAGTTGGTTACAGGGATGTCATAAACGACCGCCAGGGTCTCTA / /// / / // / / / // | ||| BslFI Eco57MI || BslFI | | |AvaII | ||Hpy178III* GsuI |SfeI* | | |AsuI* | |BsmAI Tsp4CI* | | BmgT120I | MboII | | NlaIV CviJI | AciI Cac8I G S L E T S S T N V P T V F A G G P R D A L W R L L Q P M S L Q Y L L A V P E I L S G D F F N Q C P Y S I C W R S Q R * ----:----|----:----|----:----|----:----|----:----|----:----| P E R S V E E V L T G V T N A P P G L S Q S E P S K K L W H G * L I Q Q R D W L A R Q L S R * G I D R C Y K S A T G S I CviJI TsoI |SmlI CviJI |CviJI Tsp4CI* ||TspDTI | TspEI ||NlaIV | Bce83I* |||Hpy178III* \ \ \\\ \ \ \\\\ AGCCACAATTCAGTAGGCTCCATTGGTTTTCCAAACAGTATGAATATACAAGGCTCAAGA 3550 3560 3570 3580 3590 3600 ----:----|----:----|----:----|----:----|----:----|----:----| TCGGTGTTAAGTCATCCGAGGTAACCAAAAGGTTTGTCATACTTATATGTTCCGAGTTCT / / / // // / / CviJI | | |NlaIV |Bce83I* | Hpy178III* | | CviJI Tsp4CI* | SmlI | TsoI TspDTI TspEI CviJI S H N S V G S I G F P N S M N I Q G S R A T I Q * A P L V F Q T V * I Y K A Q E P Q F S R L H W F S K Q Y E Y T R L K K ----:----|----:----|----:----|----:----|----:----|----:----| L W L E T P E M P K G F L I F I C P E L Y G C N L L S W Q N E L C Y S Y V L S L A V I * Y A G N T K W V T H I Y L A * S TaqI | AluI | CviJI | |SmlI MboI | |AflII | DpnI | ||MseI | |TaqI | ||SetI | |BstKTI MluI | ||| TspDTI | || BsaBI AflIII | ||| | BinI* | || | MboII | FnuDII* | ||| | | MboI | || | Hpy178III* | | MseI | ||| | | XhoII \ \\ \ \ \ \ \ \ \\\ \ \ \ AGATCGACATCAGGATTTTCTCCACGCGTTAAGATGAAATCGAGCTTAAGCAAGGAAATA 3610 3620 3630 3640 3650 3660 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAGCTGTAGTCCTAAAAGAGGTGCGCAATTCTACTTTAGCTCGAATTCGTTCCTTTAT // // / / / / / / / /// / || || | Hpy178III* | | MseI | | ||AflII BinI* || || MboII | AflIII | | ||SmlI || |BsaBI | MluI | | |MseI || |TaqI FnuDII* | | TspDTI || MboI | CviJI |DpnI | AluI BstKTI TaqI SetI R S T S G F S P R V K M K S S L S K E I D R H Q D F L H A L R * N R A * A R K * I D I R I F S T R * D E I E L K Q G N R ----:----|----:----|----:----|----:----|----:----|----:----| L D V D P N E G R T L I F D L K L L S I F I S M L I K E V R * S S I S S L C P F S R C * S K R W A N L H F R A * A L F Y MnlI |MboII DpnI Csp6I ||TspDTI |BstKTI Ksp632I* |RsaI ||| BsiYI* \\ \ \\ \\\ \ GATCCCAAAACTTTTTATGAAGAGTACGAACCAAAAGAGGGCAAAAGTTTTGATGATAAC 3670 3680 3690 3700 3710 3720 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGGGTTTTGAAAAATACTTCTCATGCTTGGTTTTCTCCCGTTTTCAAAACTACTATTG // / / // // / || XhoII | || || BsiYI* || MboI | || |TspDTI |DpnI | || |MboII BstKTI | || MnlI | |Csp6I | RsaI Ksp632I* D P K T F Y E E Y E P K E G K S F D D N I P K L F M K S T N Q K R A K V L M I T S Q N F L * R V R T K R G Q K F * * * R ----:----|----:----|----:----|----:----|----:----|----:----| S G L V K * S S Y S G F S P L L K S S L L D W F K K H L T R V L L P C F N Q H Y I G F S K I F L V F W F L A F T K I I V MboI BclI Hpy188I | DpnI | TspDTI | |BstKTI | | MseI SetI Hin4II* TspEI NlaIV \ \\ \ \ \ \ \ \ \ GATGATCAACAAACCAACATCGGAAGTTTTAACCTTCATTTGTTTGATATGAATTATGGT 3730 3740 3750 3760 3770 3780 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTAGTTGTTTGGTTGTAGCCTTCAAAATTGGAAGTAAACAAACTATACTTAATACCA // / / / / / / / || BclI | TspDTI MseI Hin4II* | NlaIV || MboI Hpy188I SetI TspEI |DpnI BstKTI D D Q Q T N I G S F N L H L F D M N Y G M I N K P T S E V L T F I C L I * I M V * S T N Q H R K F * P S F V * Y E L W F ----:----|----:----|----:----|----:----|----:----|----:----| S S * C V L M P L K L R * K N S I F * P R H D V F W C R F N * G E N T Q Y S N H I I L L G V D S T K V K M Q K I H I I T TspDTI MwoI | TseI | EcoP15I | |BisI | | EcoP15I | ||BlsI | | | Ksp632I* | ||BccI BbvI | | | |BtsI FalI | ||| MwoI | MwoI | | | |TspRI FalI MboII \ \\\ \ \ \ \ \ \ \\ \ \ TCCATCAGCAGCAGTAGCACTAACAGCATTAGTAGCAGTGATTTAGAAGAGAAAGAAGAA 3790 3800 3810 3820 3830 3840 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTAGTCGTCGTCATCGTGATTGTCGTAATCATCGTCACTAAATCTTCTCTTTCTTCTT / /// / / / / / // / / / TspDTI ||BccI | BbvI | | | || | FalI MboII ||MwoI MwoI | | | || | FalI ||TseI | | | || Ksp632I* |BisI | | | |EcoP15I BlsI | | | BtsI | | EcoP15I | TspRI MwoI S I S S S S T N S I S S S D L E E K E E P S A A V A L T A L V A V I * K R K K N H Q Q Q * H * Q H * * Q * F R R E R R T ----:----|----:----|----:----|----:----|----:----|----:----| E M L L L L V L L M L L L S K S S F S S N W * C C Y C * C C * Y C H N L L S L L G D A A T A S V A N T A T I * F L F F F DdeI | MboII | |MboI | |BglII BseMII | |XhoII |BspCNI | || DpnI Hpy178III* FalI ||TfiI | || |BstKTI MboII | EcoP15I FalI ||HinfI | || ||DdeI \ \ \ \ \\\ \ \\ \\\ CAAGAGCAACTTCAAGATTTATTGGAAATAGAAAGAGAAGATTCTGCTGAGATCTTAGAC 3850 3860 3870 3880 3890 3900 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTCGTTGAAGTTCTAAATAACCTTTATCTTTCTCTTCTAAGACGACTCTAGAATCTG / / / / // / / /// / / MboII | | FalI || | | ||| | DdeI | | FalI || | | ||| XhoII | EcoP15I || | | ||| BglII Hpy178III* || | | ||| MboI || | | ||DpnI || | | |BstKTI || | | DdeI || | MboII || HinfI || TfiI |BspCNI BseMII Q E Q L Q D L L E I E R E D S A E I L D K S N F K I Y W K * K E K I L L R S * T R A T S R F I G N R K R R F C * D L R R ----:----|----:----|----:----|----:----|----:----|----:----| C S C S * S K N S I S L S S E A S I K S V L A V E L N I P F L F L L N Q Q S R L L L L K L I * Q F Y F S F I R S L D * V TfiI MaeIII HinfI Tsp45I | HgaI Hin4II* | | Hpy188I |MboII \ \ \ \\ GCAAGATTCAGAAACAAAGAAGATGATAAAGTGACGAAGGATATATCAAATGACAAGAAA 3910 3920 3930 3940 3950 3960 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTCTAAGTCTTTGTTTCTTCTACTATTTCACTGCTTCCTATATAGTTTACTGTTCTTT // / // / || HgaI || Tsp45I |Hpy188I || MaeIII HinfI |MboII TfiI Hin4II* A R F R N K E D D K V T K D I S N D K K Q D S E T K K M I K * R R I Y Q M T R N K I Q K Q R R * * S D E G Y I K * Q E T ----:----|----:----|----:----|----:----|----:----|----:----| A L N L F L S S S L T V F S I D F S L F R L I * F C L L H Y L S S P Y I L H C S C S E S V F F I I F H R L I Y * I V L F TspDTI AciI | CviJI | FatI | Hin4II* Esp3I | |CviAII | |StyI BsmAI TspEI | || NlaIII | |SecI* SetI | MaeI \ \ \\ \ \ \\ \ \ \ CGCAATTACTTACCGCATGAAAAAAATAACTTGAAAGCCAAGGAAGGTAAGGAAACTAGA 3970 3980 3990 4000 4010 4020 ----:----|----:----|----:----|----:----|----:----|----:----| GCGTTAATGAATGGCGTACTTTTTTTATTGAACTTTCGGTTCCTTCCATTCCTTTGATCT / / // / // / / // TspEI | |FatI | || | SetI |MaeI | CviAII | || SecI* BsmAI NlaIII | || StyI Esp3I AciI | |CviJI | Hin4II* TspDTI R N Y L P H E K N N L K A K E G K E T R A I T Y R M K K I T * K P R K V R K L E Q L L T A * K K * L E S Q G R * G N * R ----:----|----:----|----:----|----:----|----:----|----:----| R L * K G C S F F L K F A L S P L S V L V C N S V A H F F Y S S L W P L Y P F * A I V * R M F F I V Q F G L F T L F S S ApoI MaeII TspEI |MnlI EcoRI || SetI | BseRI || TaiI | |TaqI XmnI || |MnlI | || BseRI |AjuI || || MnlI AjuI | || | MboII ||BsmI \\ \\ \ \ \ \\ \ \ \\\ GACGTAAGGGAGGAGGAGGAAGAATTCGATTTTGGTTTGGGAATGCTTTCGCTCAATAAA 4030 4040 4050 4060 4070 4080 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCATTCCCTCCTCCTCCTTCTTAAGCTAAAACCAAACCCTTACGAAAGCGAGTTATTT // // // / / / / / / || || |AjuI | | | MboII | BsmI || || MnlI | | TaqI | XmnI || |MnlI | BseRI AjuI || MaeII | EcoRI |MnlI | TspEI TaiI | ApoI SetI BseRI D V R E E E E E F D F G L G M L S L N K T * G R R R K N S I L V W E C F R S I K R K G G G G R I R F W F G N A F A Q * N ----:----|----:----|----:----|----:----|----:----|----:----| S T L S S S S S N S K P K P I S E S L L L R L P P P P L I R N Q N P F A K A * Y V Y P L L L F F E I K T Q S H K R E I F SetI CviJI |Hpy166II | FatI || TfiI | |CviAII || HinfI | || NspI || | SfeI* MseI | || NlaIII || | | AccI |SwaI | || |TaqI || | | |Hpy166II |AhaIII* \ \\ \\ \\ \ \ \\ \\ ATAAAAAGAGAAGCCAAGCATGTCGATAAGGTGGACGATTCTGTAGACCCTTTATTTAAA 4090 4100 4110 4120 4130 4140 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTTTCTCTTCGGTTCGTACAGCTATTCCACCTGCTAAGACATCTGGGAAATAAATTT / / // / / / / // // | | || | SetI | | |AccI |MseI | | || TaqI | | Hpy166II AhaIII* | | |FatI | | SfeI* SwaI | | CviAII | HinfI | NlaIII | TfiI | NspI Hpy166II CviJI I K R E A K H V D K V D D S V D P L F K * K E K P S M S I R W T I L * T L Y L N K K R S Q A C R * G G R F C R P F I * I ----:----|----:----|----:----|----:----|----:----|----:----| I F L S A L C T S L T S S E T S G K N L F L F L L W A H R Y P P R N Q L G K I * Y F S F G L M D I L H V I R Y V R * K F SpeI MnlI AccI |MaeI BslFI | TaqI |Hpy166II ||XmnI \ \ \ \\ \\\ TCATCTGCTTTCCCTCAAAGTCCCATTCGAGCATACGGGTCTACCACAAGAACTAGTTCG 4150 4160 4170 4180 4190 4200 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGACGAAAGGGAGTTTCAGGGTAAGCTCGTATGCCCAGATGGTGTTCTTGATCAAGC / / / // /// BslFI MnlI TaqI |AccI ||SpeI Hpy166II |MaeI XmnI S S A F P Q S P I R A Y G S T T R T S S H L L S L K V P F E H T G L P Q E L V R I C F P S K S H S S I R V Y H K N * F G ----:----|----:----|----:----|----:----|----:----|----:----| D D A K G * L G M R A Y P D V V L V L E I M Q K G E F D W E L M R T * W L F * N * R S E R L T G N S C V P R G C S S T R CviJI | Hpy178III* BslFI CviRI* | | CviJI TspDTI |MseI | EcoT22I HgaI \ \ \ \ \\ \ \ \ GCTTCTGGAAAGCCATTCAGGGACAATCGTTCATTTAATGCATTTTCTGTTTTGACATTA 4210 4220 4230 4240 4250 4260 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGACCTTTCGGTAAGTCCCTGTTAGCAAGTAAATTACGTAAAAGACAAAACTGTAAT / / / / // / CviJI | CviJI TspDTI || CviRI* Hpy178III* |EcoT22I |BslFI MseI A S G K P F R D N R S F N A F S V L T L L L E S H S G T I V H L M H F L F * H * F W K A I Q G Q S F I * C I F C F D I R ----:----|----:----|----:----|----:----|----:----|----:----| A E P F G N L S L R E N L A N E T K V N P K Q F A M * P C D N M * H M K Q K S M S R S L W E P V I T * K I C K R N Q C * AcyI CviRI* SetI MnlI \ \ \ \ GAAAATATGGCGTCTGCAAATGCCCTACCTCCCGTTGATTATGTCATAAAATCAATATAC 4270 4280 4290 4300 4310 4320 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTATACCGCAGACGTTTACGGGATGGAGGGCAACTAATACAGTATTTTAGTTATATG / / / / / HgaI | CviRI* SetI MnlI AcyI E N M A S A N A L P P V D Y V I K S I Y K I W R L Q M P Y L P L I M S * N Q Y T K Y G V C K C P T S R * L C H K I N I Q ----:----|----:----|----:----|----:----|----:----|----:----| S F I A D A F A R G G T S * T M F D I Y L F Y P T Q L H G V E R Q N H * L I L I F I H R R C I G * R G N I I D Y F * Y V BdaI BdaI | FatI | CviRI* | |CviAII | || NlaIII BdaI | || | MwoI BdaI Hpy166II | || | BstAPI | Tsp4CI* | EcoRV | || | | CviRI* | | TspRI | | Hpy188I | || | | | TspEI \ \ \ \ \ \ \ \\ \ \ \ \ AGAACCACTGTGTTAGTGAACGATATCAGACTAATGGTTCGTTGCATGGATTGCATTGAA 4330 4340 4350 4360 4370 4380 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTGGTGACACAATCACTTGCTATAGTCTGATTACCAAGCAACGTACCTAACGTAACTT // / / / / / / // / || Tsp4CI* | | Hpy188I BdaI | |FatI CviRI* |BdaI | EcoRV BdaI | BstAPI |BdaI Hpy166II | CviAII TspRI | MwoI CviRI* NlaIII R T T V L V N D I R L M V R C M D C I E E P L C * * T I S D * W F V A W I A L N N H C V S E R Y Q T N G S L H G L H * I ----:----|----:----|----:----|----:----|----:----|----:----| L V V T N T F S I L S I T R Q M S Q M S C F W Q T L S R Y * V L P E N C P N C Q S G S H * H V I D S * H N T A H I A N F Hin6I |GlaI |Eco47III ||HhaI TaqI Bce83I* |||SmlI AsuII | ApoI |||HaeII | TspEI | TspEI |||| Hpy178III* | MboII \ \ \\\\ \ \ \ TTATCTAAAAATTTACGAGCGCTCAAGAAAAAAACTATGGAAGATATTTCGAAATTGAAA 4390 4400 4410 4420 4430 4440 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGATTTTTAAATGCTCGCGAGTTCTTTTTTTGATACCTTCTATAAAGCTTTAACTTT / / / //// / / / | Bce83I* | |||| Hpy178III* | TspEI TspEI | |||| SmlI MboII | |||Hin6I AsuII | ||Eco47III TaqI | ||GlaI | |HhaI | HaeII TspEI ApoI L S K N L R A L K K K T M E D I S K L K Y L K I Y E R S R K K L W K I F R N * K I * K F T S A Q E K N Y G R Y F E I E R ----:----|----:----|----:----|----:----|----:----|----:----| N D L F K R A S L F F V I S S I E F N F I I * F N V L A * S F F * P L Y K S I S * R F I * S R E L F F S H F I N R F Q F HphI | SfaNI | | MaeIII | | Tsp45I | | Tsp4CI* \ \ \ GGCATCTCTAAACCGTCACCATAG 4450 4460 ----:----|----:----|---- CCGTAGAGATTTGGCAGTGGTATC / / / / HphI | | Tsp45I | | MaeIII | SfaNI Tsp4CI* G I S K P S P * A S L N R H H X H L * T V T I X ----:----|----:----|---- P M E L G D G Y L C R * V T V M A D R F R * W L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 5 FblI,XmiI AciI 15 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 1 AhaIII* 3 DraI AjuI 2 AlfI 2 AluI 12 AluBI AlwNI 1 CaiI ApoI 11 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 3 Bme18I,Eco47I,SinI,VpaK11BI BalI 2 MlsI,MluNI,MscI,Msp20I BarI 1 BbvCI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 9 Bce83I* 3 BpuEI BceAI 3 BcgI 1 BciVI 1 BfuI BclI 2 FbaI,Ksp22I BdaI 4 BetI* 2 BsaWI BfiI 2 BmrI,BmuI BglII 2 BinI* 5 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmgT120I 5 BmtI 1 BspOI Bpu10I 1 BsaAI 1 BstBAI,Ppu21I BsaBI 3 Bse8I,BseJI BsaXI 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 8 BstF5I,BtsCI BseMII 5 BseRI 6 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 5 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 7 Alw26I,BstMAI BsmI 7 BsaMI,Mva1269I,PctI Bsp1407I 2 BsrGI,BstAUI BspCNI 5 BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 3 AccBSI,MbiI BsrDI 1 BseMI,Bse3DI BsrI 8 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 4 BstKTI 12 BtrI 1 BmgBI,AjiI BtsI 2 Cac8I 6 BstC8I CauII* 3 BcnI,BpuMI,NciI,AsuC2I Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 12 CviQI,RsaNI CspCI 1 CviAII 11 CviJI 41 CviKI-1 CviRI* 17 HpyCH4V DdeI 9 BstDEI,HpyF3I DpnI 12 MalI DraII 2 EcoO109I DraIII 1 AdeI DsaI* 1 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI EciI 2 Eco31I 2 Bso31I,BspTNI,BsaI Eco47III 2 Aor51HI,AfeI Eco57I 2 AcuI Eco57MI 5 EcoP15I 3 EcoRI 2 EcoRII 2 AjnI,Psp6I,PspGI EcoRV 2 Eco32I EcoT22I 3 Mph1103I,NsiI,Zsp2I Esp3I 2 BsmBI FalI 6 FatI 11 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 8 GlaI 5 GsuI 3 BpmI HaeII 4 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 4 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HhaI 5 BstHHI,CfoI,AspLEI Hin4I 9 Hin4II* 8 HpyAV Hin6I 5 HinP1I,HspAI HindII 1 HincII HindIII 1 HinfI 16 HpaI 1 KspAI HpaII 7 HapII,BsiSI,MspI HphI 10 AsuHPI Hpy166II 14 Hpy8I Hpy178III* 18 Hpy188III Hpy188I 19 Hpy99I 2 KpnI 1 Ksp632I* 6 Eam1104I,EarI,Bst6I MaeI 11 FspBI,BfaI,XspI MaeII 10 HpyCH4IV MaeIII 10 MboI 12 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 25 MluI 1 MlyI 5 SchI MmeI 3 MnlI 36 MseI 20 Tru1I,Tru9I MwoI 9 HpyF10VI,BstMWI NcoI 1 Bsp19I NheI 1 AsuNHI NlaIII 11 Hin1II,Hsp92II,FaeI NlaIV 10 BspLI,BmiI,PspN4I NspBII* 2 MspA1I NspI 3 BstNSI,XceI PleI 5 PpsI PpuMI 2 Psp5II,PspPPI RsaI 12 AfaI SapI 1 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 8 BseDI,BssECI,BsaJI SetI 58 SexAI 1 MabI SfaNI 6 LweI SfeI* 5 BstSFI,SfcI,BfmI SmlI 4 SmoI SpeI 2 BcuI,AhlI SspI 1 StyI 5 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 10 TaqI 14 TaqII 2 TatI 5 TauI 3 TfiI 11 PfeI TseI 1 ApeKI TsoI 4 Tsp45I 7 NmuCI Tsp4CI* 18 HpyCH4III,TaaI,Bst4CI TspDTI 25 TspEI 31 TasI,Tsp509I,Sse9I TspGWI 5 TspRI 9 TscAI TstI 1 VspI 1 PshBI,AseI XbaI 2 XcmI 1 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 6 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AgeI AloI ApaI ApaLI AscI AvaI AvrII BaeI BamHI BglI BmeT110I BplI BsePI BseSI BseYI BsgI Bsp120I BspHI BspLU11I* BstEII BstXI BtgZI Cfr9I DinI DrdI Ecl136II EcoICRI EcoNI EgeI EheI EspI* FauI FseI FspAI GsaI HgiJII* KasI MauBI McrI* MfeI MroNI MslI MstI* NaeI NarI NdeI NgoMIV NmeAIII NotI NruI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI ScaI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI TspMI Tth111I XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769