Restriction Map of PMR1/YGL167C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PMR1/YGL167C on chromosome VII from coordinates 190468 to 187616.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.15898

EMBOSS_001 MseI | MboII | BbvII* | | HinfI | | |Hin4I | | ||Hin4I | | ||| MnlI | | ||| |Hpy178III* | | ||| ||PleI | | ||| |||MlyI MaeIII | | ||| ||||MlyI SfaNI Tsp45I | | ||| ||||PleI HinfI Tsp4CI* Hin4I \ \ \ \\\ \\\\\ \ \ \ ATGAGTGACAATCCATTTAATGCGAGTCTTCTTGACGAGGACTCAAACCGTGAGAGAGAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCACTGTTAGGTAAATTACGCTCAGAAGAACTGCTCCTGAGTTTGGCACTCTCTCTT / //// / / / /// / / / Tsp45I |||| | | | ||PleI | | Hin4I MaeIII |||| | | | |MlyI | Tsp4CI* |||| | | | | HinfI |||| | | | Hpy178III* |||| | | | PleI |||| | | | MlyI |||| | | MnlI |||| | HinfI |||| BbvII* |||Hin4I ||Hin4I |MseI MboII M S D N P F N A S L L D E D S N R E R E * V T I H L M R V F L T R T Q T V R E K E * Q S I * C E S S * R G L K P * E R N ----:----|----:----|----:----|----:----|----:----|----:----| X L S L G N L A L R R S S S E F R S L S X S H C D M * H S D E Q R P S L G H S L H T V I W K I R T K K V L V * V T L S F AsuI* DraII EcoP15I |CviJI | Hin4II* |HaeIII | | TspGWI |BmgT120I | | |TatI || FalI | | ||Csp6I || FalI | | |||RsaI || |TaqI | | |||| FalI MaeI MnlI || |AsuII CviJI | | |||| FalI \ \ \\ \\ \ \ \ \\\\ \ ATACTAGATGCCACAGCAGAGGCCCTTTCGAAACCAAGCCCTTCTTTAGAGTATTGTACT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TATGATCTACGGTGTCGTCTCCGGGAAAGCTTTGGTTCGGGAAGAAATCTCATAACATGA / / / /// / / / / / / /// | MaeI MnlI ||DraII AsuII CviJI | | | | ||TatI SfaNI ||AsuI* TaqI | | | | |Csp6I |BmgT120I | | | | RsaI HaeIII | | | FalI CviJI | | | FalI FalI | | TspGWI FalI | Hin4II* EcoP15I I L D A T A E A L S K P S P S L E Y C T Y * M P Q Q R P F R N Q A L L * S I V L T R C H S R G P F E T K P F F R V L Y F ----:----|----:----|----:----|----:----|----:----|----:----| I S S A V A S A R E F G L G E K S Y Q V F V L H W L L P G K S V L G K K L T N Y Y * I G C C L G K R F W A R R * L I T S SecI* DsaI* | Hpy166II | | AluI | | CviJI | | | XbaI Tsp4CI* | | | SetI | Hpy166II | | | |MaeI | | MboI | | | |Hpy178III* | | | DpnI | | | || CspCI | | | |BstKTI | | | || | BsrI TspRI | | | || MnlI \ \ \ \\ \ \ \ \ \ \ \\ \ TTATCCGTGGACGAAGCTCTAGAAAAACTGGACACTGACAAAAACGGTGGTTTACGATCA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGGCACCTGCTTCGAGATCTTTTTGACCTGTGACTGTTTTTGCCACCAAATGCTAGT / / / // / / / / // // | | | || | TspRI | | || |CspCI | | | || | BsrI | | || MboI | | | || CspCI | | || MnlI | | | |XbaI | | |DpnI | | | Hpy178III* | | BstKTI | | | MaeI | Hpy166II | | CviJI Tsp4CI* | | AluI | SetI Hpy166II DsaI* SecI* L S V D E A L E K L D T D K N G G L R S Y P W T K L * K N W T L T K T V V Y D H I R G R S S R K T G H * Q K R W F T I I ----:----|----:----|----:----|----:----|----:----|----:----| K D T S S A R S F S S V S L F P P K R D K I R P R L E L F V P C Q C F R H N V I * G H V F S * F F Q V S V F V T T * S * AsuI* BsiYI* |CviJI | MboI |HaeIII CviJI | | DpnI |BmgT120I Tsp4CI* CspCI HaeIII | | |BstKTI ||NlaIV | TspDTI \ \ \ \ \\ \\\ \ \ TCTAACGAGGCCAACAATAGGAGATCACTTTATGGCCCCAATGAAATAACCGTAGAAGAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGATTGCTCCGGTTGTTATCCTCTAGTGAAATACCGGGGTTACTTTATTGGCATCTTCTA / / // / /// / / | BsiYI* || MboI ||AsuI* | TspDTI HaeIII |DpnI |BmgT120I Tsp4CI* CviJI BstKTI |NlaIV HaeIII CviJI S N E A N N R R S L Y G P N E I T V E D L T R P T I G D H F M A P M K * P * K M * R G Q Q * E I T L W P Q * N N R R R * ----:----|----:----|----:----|----:----|----:----|----:----| D L S A L L L L D S * P G L S I V T S S M * R P W C Y S I V K H G W H F L R L L R V L G V I P S * K I A G I F Y G Y F I FalI FalI | MboI | | DpnI Hpy178III* | | |TaqI | TspDTI | | |BstKTI FalI | | ApoI | | || BinI* FalI | | TspEI | | || |TfiI MboII | TspDTI | | MnlI | | || |HinfI TstI \ \ \ \ \ \ \ \ \\ \\ \ GATGAAAGTCTTTTCAAGAAGTTCTTGTCAAATTTCATTGAGGATCGAATGATTCTACTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTTCAGAAAAGTTCTTCAAGAACAGTTTAAAGTAACTCCTAGCTTACTAAGATGAA / / / / / / / // // / / | MboII | | TspDTI | TspEI || || | HinfI FalI | Hpy178III* | FalI || || | TfiI FalI TspDTI | FalI || || | TstI | ApoI || || BinI* MnlI || |TaqI || MboI |DpnI BstKTI D E S L F K K F L S N F I E D R M I L L M K V F S R S S C Q I S L R I E * F Y F * K S F Q E V L V K F H * G S N D S T F ----:----|----:----|----:----|----:----|----:----|----:----| S S L R K L F N K D F K M S S R I I R S H H F D K * S T R T L N * Q P D F S E V I F T K E L L E Q * I E N L I S H N * K MseI |BinI* || MboI || BamHI || XhoII || | DpnI || | NlaIV || | |BstKTI || | ||AciI || | ||| BinI* || | ||| | BtsI || | ||| | TspRI TstI || | ||| | | BsmAI | MaeIII || | ||| | | Eco31I | | SfaNI \\ \ \\\ \ \ \ \ \ \ TTAATAGGATCCGCAGTGGTCTCTCTTTTTATGGGTAACATTGATGATGCTGTTAGTATC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AATTATCCTAGGCGTCACCAGAGAGAAAAATACCCATTGTAACTACTACGACAATCATAG / // / / / / / / // / | || | | | BtsI | Eco31I |SfaNI TspRI | || | | BinI* | BsmAI MaeIII | || | AciI TstI | || XhoII | || BamHI | || TspRI | || MboI | |NlaIV | |DpnI | BstKTI BinI* MseI L I G S A V V S L F M G N I D D A V S I * * D P Q W S L F L W V T L M M L L V S N R I R S G L S F Y G * H * * C C * Y H ----:----|----:----|----:----|----:----|----:----|----:----| K I P D A T T E R K I P L M S S A T L I K L L I R L P R E K * P Y C Q H H Q * Y * Y S G C H D R K K H T V N I I S N T D TspDTI | CfrI | | BalI | | CviJI MaeIII | | HaeIII Tsp45I | | |BsrI | Tsp4CI* SetI | | |TspRI | | TspRI | Hpy188I \ \ \\ \ \ \ \ \ ACACTGGCCATTTTCATAGTTGTCACTGTCGGTTTTGTCCAAGAATATAGGTCTGAAAAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGACCGGTAAAAGTATCAACAGTGACAGCCAAAACAGGTTCTTATATCCAGACTTTTT / // / / / / / | || CfrI | Tsp4CI* SetI Hpy188I | |HaeIII | Tsp45I | |CviJI | MaeIII | |BalI TspRI | BsrI TspDTI T L A I F I V V T V G F V Q E Y R S E K H W P F S * L S L S V L S K N I G L K N T G H F H S C H C R F C P R I * V * K I ----:----|----:----|----:----|----:----|----:----|----:----| V S A M K M T T V T P K T W S Y L D S F * V P W K * L Q * Q R N Q G L I Y T Q F C Q G N E Y N D S D T K D L F I P R F F EcoP15I MaeIII | XbaI Tsp45I | |MaeI | Hin4I | |Hpy178III* TspEI NlaIV | | MseI Hpy178III* \ \\ \ \ \ \ \ \ TCTCTAGAAGCGTTGAATAAATTGGTTCCTGCTGAATGTCACTTAATGAGATGTGGTCAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGATCTTCGCAACTTATTTAACCAAGGACGACTTACAGTGAATTACTCTACACCAGTT / // / / / / / / | |XbaI | NlaIV Hin4I | MseI Hpy178III* | Hpy178III* TspEI Tsp45I | MaeI MaeIII EcoP15I S L E A L N K L V P A E C H L M R C G Q L * K R * I N W F L L N V T * * D V V K S R S V E * I G S C * M S L N E M W S R ----:----|----:----|----:----|----:----|----:----|----:----| D R S A N F L N T G A S H * K I L H P * I E L L T S Y I P E Q Q I D S L S I H D R * F R Q I F Q N R S F T V * H S T T L HinfI | FatI ApaLI | |CviAII |TstI | || TatI StyI ||CviRI* | || |Csp6I SecI* ||Hpy166II | || |NlaIII | SetI |||HphI | || ||RsaI | | NlaIV ||||SduI | || ||PleI | | |BssKI ||||BseSI | || ||Hin4I | | |EcoRII ||||HgiAI* | || |||TstI | | || ScrFI ||||| Hpy188I | || |||MlyI | | || BseBI ||||| | MaeIII | || |||| CviJI | | || |Eco57I ||||| | Tsp45I | || |||| |BsrI | | || |Eco57MI ||||| | | SetI \ \\ \\\\ \\ \ \ \\ \\ \\\\\ \ \ \ GAGAGTCATGTACTGGCTTCCACCTTGGTTCCTGGTGATTTAGTGCACTTCAGAATAGGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTCAGTACATGACCGAAGGTGGAACCAAGGACCACTAAATCACGTGAAGTCTTATCCA // ///// // / / / / / / / / / / / / || ||||| || SetI | | | | | | | | | | SetI || ||||| |CviJI | | | | | | | | | Hpy188I || ||||| BsrI | | | | | | | | ApaLI || ||||TatI | | | | | | | Hpy166II || |||Csp6I | | | | | | | CviRI* || |||PleI | | | | | | | HphI || |||MlyI | | | | | | HgiAI* || ||RsaI | | | | | | BseSI || |FatI | | | | | | SduI || CviAII | | | | | TstI |TstI | | | | EcoRII NlaIII | | | | BssKI Hin4I | | | BseBI HinfI | | | ScrFI | | Eco57MI | | Eco57I | NlaIV SecI* StyI E S H V L A S T L V P G D L V H F R I G R V M Y W L P P W F L V I * C T S E * V E S C T G F H L G S W * F S A L Q N R * ----:----|----:----|----:----|----:----|----:----|----:----| S L * T S A E V K T G P S K T C K L I P L S D H V P K W R P E Q H N L A S * F L L T M Y Q S G G Q N R T I * H V E S Y T TfiI HinfI | HphI TaqI TaqI | |AciI FauI TspEI ClaI ClaI BccI TspEI \ \\ \ \ \ \ \ \ GACAGAATCCCCGCAGACATTAGAATTATTGAAGCAATCGATTTATCCATCGATGAAAGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTCTTAGGGGCGTCTGTAATCTTAATAACTTCGTTAGCTAAATAGGTAGCTACTTTCA / // / / / / / / | || AciI FauI TspEI ClaI | BccI | |HphI TaqI ClaI | HinfI TaqI | TfiI Tsp45I MaeIII D R I P A D I R I I E A I D L S I D E S T E S P Q T L E L L K Q S I Y P S M K V Q N P R R H * N Y * S N R F I H R * K * ----:----|----:----|----:----|----:----|----:----|----:----| S L I G A S M L I I S A I S K D M S S L H C F G R L C * F * Q L L R N I W R H F V S D G C V N S N N F C D I * G D I F T MboI AgeI |MnlI BetI* ||DpnI Cfr10I |||TaqI |HphI |||PvuI MseI |HpaII |||MboII | TspDTI || Csp6I TspDTI |||McrI* | | BsrI || |RsaI | SetI |||BstKTI \ \ \ \\ \\ \ \ \\\\ AATTTAACTGGTGAAAATGAACCGGTACATAAAACCTCACAAACGATCGAAAAATCTTCC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAATTGACCACTTTTACTTGGCCATGTATTTTGGAGTGTTTGCTAGCTTTTTAGAAGG / / / / //// / / /// // | | BsrI | |||| | SetI ||| |TaqI | TspDTI | |||| TspDTI ||| MboI | MseI | |||Csp6I ||MboII TspEI | ||RsaI ||DpnI | |Cfr10I |BstKTI | |BetI* |McrI* | |AgeI |PvuI | HpaII MnlI HphI N L T G E N E P V H K T S Q T I E K S S I * L V K M N R Y I K P H K R S K N L P F N W * K * T G T * N L T N D R K I F L ----:----|----:----|----:----|----:----|----:----|----:----| L K V P S F S G T C L V E C V I S F D E Y N L Q H F H V P V Y F R V F S R F I K I * S T F I F R Y M F G * L R D F F R G MseI | MboI | | DpnI | | |BstKTI | | || CviJI | | || | TspEI DdeI | | || | | MfeI |Hpy188I | | || | | TspEI || MboI | | || | | | Csp6I || BglII AluI | | || | | | |RsaI || XhoII CviJI | | || | | | |BseMII || | DpnI |BaeI | | || | | | ||BspCNI || | |BstKTI ||SetI \ \ \\ \ \ \ \\\ \\ \ \\ \\\ TTTAACGATCAGCCTAATTCAATTGTACCGATTTCTGAGAGATCTTGTATAGCTTATATG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTGCTAGTCGGATTAAGTTAACATGGCTAAAGACTCTCTAGAACATATCGAATATAC / // / / / //// / / // / / / / | || | CviJI | |||Csp6I | | || | | | CviJI | || MboI | ||RsaI | | || | | | AluI | |DpnI | |BspCNI | | || | | SetI | BstKTI | BseMII | | || | BaeI MseI | TspEI | | || XhoII | MfeI | | || BglII TspEI | | || MboI | | |DpnI | | BstKTI | DdeI Hpy188I F N D Q P N S I V P I S E R S C I A Y M L T I S L I Q L Y R F L R D L V * L I W * R S A * F N C T D F * E I L Y S L Y G ----:----|----:----|----:----|----:----|----:----|----:----| K L S * G L E I T G I E S L D Q I A * I R * R D A * N L Q V S K Q S I K Y L K Y K V I L R I * N Y R N R L S R T Y S I H FatI Csp6I SetI |RsaI |CviAII |SetI Csp6I || NlaIII Hpy99I || BceAI |RsaI Hin4II* || |BaeI | FokI || | BseGI \\ \ \\ \\ \ \ \\ \ \ GGTACATTAGTCAAGGAAGGTCATGGTAAGGGTATCGTCGTAGGAACAGGTACAAACACA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGTAATCAGTTCCTTCCAGTACCATTCCCATAGCAGCATCCTTGTCCATGTTTGTGT // / / / // / / / // // || Hin4II* | | |FatI Hpy99I | | || |BceAI |Csp6I | | CviAII | | || BseGI RsaI | NlaIII | | |Csp6I | BaeI | | RsaI SetI | FokI SetI G T L V K E G H G K G I V V G T G T N T V H * S R K V M V R V S S * E Q V Q T H Y I S Q G R S W * G Y R R R N R Y K H I ----:----|----:----|----:----|----:----|----:----|----:----| P V N T L S P * P L P I T T P V P V F V P Y M L * P L D H Y P Y R R L F L Y L C T C * D L F T M T L T D D Y S C T C V C HinfI | BsrDI TspDTI | BbvII* HgiCI* | MlyI | | MboII | NlaIV SspI | PleI | | CviRI* \ \ \ \ \ \ \ \ TCCTTTGGTGCCGTTTTTGAAATGATGAATAATATTGAAAAACCGAAGACTCCATTGCAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAAACCACGGCAAAAACTTTACTACTTATTATAACTTTTTGGCTTCTGAGGTAACGTC / / / / // // // | HgiCI* SspI | |PleI || |CviRI* NlaIV | MlyI || BbvII* TspDTI || MboII |HinfI BsrDI S F G A V F E M M N N I E K P K T P L Q P L V P F L K * * I I L K N R R L H C S L W C R F * N D E * Y * K T E D S I A V ----:----|----:----|----:----|----:----|----:----|----:----| D K P A T K S I I F L I S F G F V G N C M R Q H R K Q F S S Y Y Q F V S S E M A G K T G N K F H H I I N F F R L S W Q L TsoI | MaeIII | Tsp45I | | TspDTI | | | BsrI MseI | | | TspRI |HpaI | | | | AluI |HindII | | | | CviJI |Hpy166II TspEI | | | | | SetI \\ \ \ \ \ \ \ \ TTAACAATGGACAAATTGGGAAAGGACTTGTCACTGGTTAGCTTCATAGTTATTGGTATG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AATTGTTACCTGTTTAACCCTTTCCTGAACAGTGACCAATCGAAGTATCAATAACCATAC // / / / / / / / / |MseI TspEI TsoI | | | | | CviJI Hpy166II | | | | | AluI HindII | | | | SetI HpaI | | | BsrI | | Tsp45I | | MaeIII | TspDTI TspRI L T M D K L G K D L S L V S F I V I G M * Q W T N W E R T C H W L A S * L L V * N N G Q I G K G L V T G * L H S Y W Y D ----:----|----:----|----:----|----:----|----:----|----:----| N V I S L N P F S K D S T L K M T I P I T L L P C I P F P S T V P * S * L * Q Y * C H V F Q S L V Q * Q N A E Y N N T H TsoI | SetI | |MboI | |BglII | |XhoII | || DpnI BsiYI* | || |BstKTI | BbvI \ \\ \\ \ \ ATTTGTTTAGTTGGTATCATACAAGGTAGATCTTGGTTAGAAATGTTCCAAATATCGGTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TAAACAAATCAACCATAGTATGTTCCATCTAGAACCAATCTTTACAAGGTTTATAGCCAT // // / / |SetI || XhoII BsiYI* TsoI || BglII || MboI |DpnI BstKTI I C L V G I I Q G R S W L E M F Q I S V F V * L V S Y K V D L G * K C S K Y R Y L F S W Y H T R * I L V R N V P N I G I ----:----|----:----|----:----|----:----|----:----|----:----| I Q K T P I M C P L D Q N S I N W I D T S K N L Q Y * V L Y I K T L F T G F I P N T * N T D Y L T S R P * F H E L Y R Y DdeI Bpu10I | AciI | | BciVI | | | TseI | | | MwoI | | | |BisI | | | ||BlsI MaeIII | | | ||| Hin4II* Tsp45I | | | ||| | Hpy178III* | MaeIII | | | ||| | | MaeIII | Tsp4CI* | | | ||| | | BstEII | | TspRI | | | ||| | | | TspEI | | |TaqII \ \ \ \\\ \ \ \ \ \ \ \\ TCCTTAGCGGTTGCTGCTATTCCAGAAGGGTTACCAATTATTGTCACTGTTACTTTGGCA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| AGGAATCGCCAACGACGATAAGGTCTTCCCAATGGTTAATAACAGTGACAATGAAACCGT / / /// /// / / / / / / / / // | | ||| ||| | | | | | | | | |BspCNI | | ||| ||| | | | | | | | | BseMII | | ||| ||| | | | | | | | MaeIII | | ||| ||| | | | | | | TaqII | | ||| ||| | | | | | Tsp4CI* | | ||| ||| | | | | | Tsp45I | | ||| ||| | | | | | MaeIII | | ||| ||| | | | | TspRI | | ||| ||| | | | TspEI | | ||| ||| | | BstEII | | ||| ||| | | MaeIII | | ||| ||| | Hpy178III* | | ||| ||| Hin4II* | | ||| ||TseI | | ||| |BisI | | ||| BlsI | | ||MwoI | | |AciI | | BciVI | Bpu10I | DdeI BbvI S L A V A A I P E G L P I I V T V T L A P * R L L L F Q K G Y Q L L S L L L W H L S G C C Y S R R V T N Y C H C Y F G I ----:----|----:----|----:----|----:----|----:----|----:----| D K A T A A I G S P N G I I T V T V K A I R L P Q Q * E L L T V L * Q * Q * K P G * R N S S N W F P * W N N D S N S Q C CviJI DdeI | Hin4II* |Hpy188I | |Hpy178III* || CfrI | || BccI || | BalI | || | MaeIII BseMII || | CviJI | || | BstEII |BspCNI || | HaeIII | || | | SetI TaqI \\ \\ \ \ \ \\ \ \ \ \ TTGGGTGTTCTGAGAATGGCCAAGCGTAAAGCCATCGTGAGAAGGTTACCAAGTGTCGAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCACAAGACTCTTACCGGTTCGCATTTCGGTAGCACTCTTCCAATGGTTCACAGCTT / / / / / / / // / / | DdeI | CfrI | | | |SetI BstEII TaqI Hpy188I HaeIII | | | BccI MaeIII CviJI | | Hpy178III* BalI | Hin4II* CviJI L G V L R M A K R K A I V R R L P S V E W V F * E W P S V K P S * E G Y Q V S K G C S E N G Q A * S H R E K V T K C R N ----:----|----:----|----:----|----:----|----:----|----:----| N P T R L I A L R L A M T L L N G L T S M P H E S F P W A Y L W R S F T V L H R Q T N Q S H G L T F G D H S P * W T D F HindII Hpy166II | AclI Csp6I | MaeII |RsaI FatI | | SetI |SetI SetI |MnlI CviJI | | TaiI Hpy188I ||Hpy166II |MmeI |CviAII \ \ \ \ \ \\\ \\ \\ ACTTTAGGCTCTGTCAACGTTATCTGCTCCGACAAAACAGGTACACTAACCTCAAACCAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAATCCGAGACAGTTGCAATAGACGAGGCTGTTTTGTCCATGTGATTGGAGTTTGGTG / // / / / // / / / CviJI || MaeII Hpy188I | || | MmeI NlaIII || AclI | || SetI MnlI |TaiI | |Hpy166II |SetI | |Csp6I Hpy166II | RsaI HindII SetI T L G S V N V I C S D K T G T L T S N H L * A L S T L S A P T K Q V H * P Q T T F R L C Q R Y L L R Q N R Y T N L K P H ----:----|----:----|----:----|----:----|----:----|----:----| V K P E T L T I Q E S L V P V S V E F W F K L S Q * R * R S R C F L Y V L R L G S * A R D V N D A G V F C T C * G * V V AluI CviJI | SetI | | MaeII | | |Hin4I | | |Hin4I NlaIII Hin4I Tsp4CI* | | || SetI | Tsp4CI* Hin4I | Eam1105I | | || TaiI \ \ \ \ \ \ \ \\ \ ATGACCGTATCTAAACTTTGGTGCTTGGACAGTATGTCCAATAAGCTAAACGTCCTCTCA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGGCATAGATTTGAAACCACGAACCTGTCATACAGGTTATTCGATTTGCAGGAGAGT // / / / / / // / / || Tsp4CI* Hin4I | Eam1105I | || | MaeII |FatI Hin4I Tsp4CI* | || TaiI CviAII | || SetI | |Hin4I | |Hin4I | CviJI | AluI SetI M T V S K L W C L D S M S N K L N V L S * P Y L N F G A W T V C P I S * T S S H D R I * T L V L G Q Y V Q * A K R P L I ----:----|----:----|----:----|----:----|----:----|----:----| M V T D L S Q H K S L I D L L S F T R E C S R I * V K T S P C Y T W Y A L R G R H G Y R F K P A Q V T H G I L * V D E * BbvII* | ApoI | TspEI ApoI MnlI | | MboII TspEI \ \ \ \ \ TTAGACAAAAATAAGAAGACTAAAAATTCTAATGGAAATTTGAAAAACTATTTGACTGAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTGTTTTTATTCTTCTGATTTTTAAGATTACCTTTAAACTTTTTGATAAACTGACTT / / / / MnlI | TspEI TspEI | ApoI ApoI BbvII* MboII L D K N K K T K N S N G N L K N Y L T E * T K I R R L K I L M E I * K T I * L K R Q K * E D * K F * W K F E K L F D * R ----:----|----:----|----:----|----:----|----:----|----:----| N S L F L F V L F E L P F K F F * K V S M L C F Y S S * F N * H F N S F S N S Q * V F I L L S F I R I S I Q F V I Q S F Bce83I* | CviRI* MaeII | | EcoT22I | SetI | | | SfaNI | TaiI | | | |SmlI | BbvII* Eco57I | | | || Hpy178III* | | MboII Eco57MI | | | || | FatI \ \ \ \ \ \ \ \\ \ \ GACGTTAGGGAAACTCTAACTATCGGTAATCTCTGTAATAATGCATCTTTCTCTCAAGAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCAATCCCTTTGAGATTGATAGCCATTAGAGACATTATTACGTAGAAAGAGAGTTCTT / / / / / / / // / | | | Eco57MI | | CviRI* || NlaIII | | | Eco57I | EcoT22I || NspI | | BbvII* Bce83I* |Hpy178III* | | MboII |SmlI | MaeII SfaNI TaiI SetI D V R E T L T I G N L C N N A S F S Q E T L G K L * L S V I S V I M H L S L K N R * G N S N Y R * S L * * C I F L S R T ----:----|----:----|----:----|----:----|----:----|----:----| S T L S V R V I P L R Q L L A D K E * S L R * P F E L * R Y D R Y Y H M K R E L V N P F S * S D T I E T I I C R E R L F CviAII AluI | NspI CviJI MfeI | NlaIII BstXI | SetI TspEI \ \ \ \ \ \ CATGCCATATTTCTGGGAAATCCTACTGATGTAGCTCTTTTAGAGCAATTGGCAAACTTT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GTACGGTATAAAGACCCTTTAGGATGACTACATCGAGAAAATCTCGTTAACCGTTTGAAA // / / / / || BstXI | CviJI TspEI |FatI | AluI MfeI CviAII SetI H A I F L G N P T D V A L L E Q L A N F M P Y F W E I L L M * L F * S N W Q T L C H I S G K S Y * C S S F R A I G K L * ----:----|----:----|----:----|----:----|----:----|----:----| C A M N R P F G V S T A R K S C N A F K V H W I E P F D * Q H L E K L A I P L S M G Y K Q S I R S I Y S K * L L Q C V K EcoRV | Hpy188I Tsp4CI* Hpy178III* MseI TaqI \ \ \ \ \ \ GAAATGCCTGATATCAGAAACACCGTTCAAAAAGTTCAGGAACTTCCATTTAACTCGAAA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTACGGACTATAGTCTTTGTGGCAAGTTTTTCAAGTCCTTGAAGGTAAATTGAGCTTT / / / / / / | Hpy188I Tsp4CI* Hpy178III* MseI TaqI EcoRV E M P D I R N T V Q K V Q E L P F N S K K C L I S E T P F K K F R N F H L T R K N A * Y Q K H R S K S S G T S I * L E K ----:----|----:----|----:----|----:----|----:----|----:----| S I G S I L F V T * F T * S S G N L E F Q F A Q Y * F C R E F L E P V E M * S S F H R I D S V G N L F N L F K W K V R F TatI SalI Bsp1407I |TaqI |Csp6I TspEI |AccI |Hpy166II | MseI TfiI ||HindII ||RsaI | VspI HinfI ||Hpy166II ||| Tsp4CI* MseI \ \ \ \\\ \\\ \ \ AGAAAATTAATGGCAACCAAGATTCTCAACCCTGTCGACAATAAGTGTACAGTTTATGTT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTTAATTACCGTTGGTTCTAAGAGTTGGGACAGCTGTTATTCACATGTCAAATACAA // / /// //// |VspI HinfI ||SalI |||Bsp1407I |MseI TfiI |AccI |||Tsp4CI* TspEI |TaqI |||TatI Hpy166II ||Csp6I HindII |RsaI Hpy166II R K L M A T K I L N P V D N K C T V Y V E N * W Q P R F S T L S T I S V Q F M L K I N G N Q D S Q P C R Q * V Y S L C * ----:----|----:----|----:----|----:----|----:----|----:----| L F N I A V L I R L G T S L L H V T * T F F I L P L W S E * G Q R C Y T Y L K H S F * H C G L N E V R D V I L T C N I N ApoI XmnI TspEI EcoRI | SmlI | Hpy178III* | | TatI | | |Csp6I SetI | | ||RsaI |CviRI* | | ||ScaI Bce83I* \\ \ \ \\\ \ AAAGGTGCATTTGAAAGAATTCTTGAGTACTCCACAAGTTATTTGAAATCAAAGGGTAAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCCACGTAAACTTTCTTAAGAACTCATGAGGTGTTCAATAAACTTTAGTTTCCCATTT // / / / / / /// / |SetI CviRI* | | | | ||TatI Bce83I* MseI | | | | |Csp6I | | | | ScaI | | | | RsaI | | | SmlI | | Hpy178III* | EcoRI | TspEI | ApoI XmnI K G A F E R I L E Y S T S Y L K S K G K K V H L K E F L S T P Q V I * N Q R V K R C I * K N S * V L H K L F E I K G * K ----:----|----:----|----:----|----:----|----:----|----:----| L P A N S L I R S Y E V L * K F D F P L * L H M Q F F E Q T S W L N N S I L P Y F T C K F S N K L V G C T I Q F * L T F Hin6I |GlaI MwoI |MstI* HindII | AluI ||HhaI Hpy166II | CviJI Eco57I ||| ApoI | CviJI | | SetI Eco57MI ||| TspEI \ \ \ \ \ \ \\\ \ AAAACTGAAAAGTTGACTGAAGCCCAAAAAGCTACGATAAATGAGTGCGCAAATTCTATG 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGACTTTTCAACTGACTTCGGGTTTTTCGATGCTATTTACTCACGCGTTTAAGATAC / / / / / / /// / / | | | | | Eco57MI ||Hin6I | Hin4II* | | | | | Eco57I |MstI* TspEI | | | | CviJI |GlaI ApoI | | | | AluI HhaI | | | SetI | | MwoI | CviJI Hpy166II HindII K T E K L T E A Q K A T I N E C A N S M K L K S * L K P K K L R * M S A Q I L W N * K V D * S P K S Y D K * V R K F Y G ----:----|----:----|----:----|----:----|----:----|----:----| F V S F N V S A W F A V I F S H A F E I F F Q F T S Q L G F L * S L H T R L N * F S F L Q S F G L F S R Y I L A C I R H Hin4II* Hpy188I | Hpy188I |TfiI | | SfaNI Eco57I |HinfI | | | SetI Eco57MI TspDTI ||BseRI \ \ \ \ \ \ \\\ GCATCTGAAGGTTTGCGTGTCTTTGGATTTGCTAAACTAACTTTGTCTGATTCATCAACT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CGTAGACTTCCAAACGCACAGAAACCTAAACGATTTGATTGAAACAGACTAAGTAGTTGA / / / / / // / | SetI SfaNI Eco57MI TspDTI || HinfI Hpy188I Eco57I || TfiI |BseRI Hpy188I A S E G L R V F G F A K L T L S D S S T H L K V C V S L D L L N * L C L I H Q L I * R F A C L W I C * T N F V * F I N S ----:----|----:----|----:----|----:----|----:----|----:----| A D S P K R T K P N A L S V K D S E D V P M Q L N A H R Q I Q * V L K T Q N M L C R F T Q T D K S K S F * S Q R I * * S SetI BbvII* BsrI MnlI | MboII MseI SetI |MseI \ \ \ \ \ \\ CCTCTAACCGAAGACCTAATCAAAGATTTAACCTTTACTGGTTTAATCGGTATGAATGAC 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGATTGGCTTCTGGATTAGTTTCTAAATTGGAAATGACCAAATTAGCCATACTTACTG / / / / / / | SetI BbvII* MseI BsrI MseI MnlI MboII SetI P L T E D L I K D L T F T G L I G M N D L * P K T * S K I * P L L V * S V * M T S N R R P N Q R F N L Y W F N R Y E * P ----:----|----:----|----:----|----:----|----:----|----:----| G R V S S R I L S K V K V P K I P I F S E E L R L G L * L N L R * Q N L R Y S H R * G F V * D F I * G K S T * D T H I V AclI MaeII | MseI | SetI | TaiI | | ApoI | | TspEI | | | PsrI | | | |TaqII BccI TspDTI | | | || TaqI TspEI SetI PsrI \ \ \ \ \\ \ \ \ \ CCACCAAGACCGAACGTTAAATTTGCCATCGAACAATTACTACAAGGTGGTGTCCATATT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGGTTCTGGCTTGCAATTTAAACGGTAGCTTGTTAATGATGTTCCACCACAGGTATAA / / / // // / / / / / TspDTI | | || |TspEI | | TspEI SetI PsrI | | || |ApoI | BccI | | || TaqII TaqI | | |MseI | | PsrI | MaeII | AclI TaiI SetI P P R P N V K F A I E Q L L Q G G V H I H Q D R T L N L P S N N Y Y K V V S I L T K T E R * I C H R T I T T R W C P Y Y ----:----|----:----|----:----|----:----|----:----|----:----| G G L G F T L N A M S C N S C P P T W I G V L V S R * I Q W R V I V V L H H G Y W W S R V N F K G D F L * * L T T D M N MboI BclI | DpnI | |BstKTI | || BseMII | || |BspCNI | || || BsrI | || || TspRI | || || |TfiI | || || |HinfI | || || || DdeI | || || || |Hpy188I Hpy166II | || || || || HphI | BsrDI | || || || || | AciI | | CviRI* TspEI \ \\ \\ \\ \\ \ \ \ \ \ \ ATTATGATCACTGGTGATTCTGAGAATACCGCAGTAAACATTGCAAAACAAATTGGTATT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TAATACTAGTGACCACTAAGACTCTTATGGCGTCATTTGTAACGTTTTGTTTAACCATAA // // / // // / / / / / || || BsrI || |HphI AciI | CviRI* | BsrI || |BspCNI || DdeI Hpy166II TspEI || BseMII |Hpy188I BsrDI || BclI HinfI || MboI TfiI |DpnI BstKTI TspRI I M I T G D S E N T A V N I A K Q I G I L * S L V I L R I P Q * T L Q N K L V F Y D H W * F * E Y R S K H C K T N W Y S ----:----|----:----|----:----|----:----|----:----|----:----| I I I V P S E S F V A T F M A F C I P I * * S * Q H N Q S Y R L L C Q L V F Q Y N H D S T I R L I G C Y V N C F L N T N BsrI | BinI* | | MboI | | | DpnI | | | |TspGWI | | | |BstKTI BetI* | | | || HindIII |HpaII | | | || | AluI || Hin4I Hpy188I | | | || | CviJI || Hin4I | MboI | | | || | | SetI || | TspEI HphI | BclI \ \ \ \\ \ \ \ \\ \ \ \ \ \ CCAGTTATTGATCCAAAGCTTTCCGTTTTATCCGGTGATAAATTAGATGAAATGTCAGAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCAATAACTAGGTTTCGAAAGGCAAAATAGGCCACTATTTAATCTACTTTACAGTCTA / // / / / / / // // / / | || | | | HindIII | |BetI* |HphI | TspDTI | || | | CviJI | HpaII TspEI Hpy188I | || | | AluI Hin4I | || | SetI Hin4I | || MboI | |DpnI | BstKTI | TspGWI BinI* P V I D P K L S V L S G D K L D E M S D Q L L I Q S F P F Y P V I N * M K C Q M S Y * S K A F R F I R * * I R * N V R * ----:----|----:----|----:----|----:----|----:----|----:----| G T I S G F S E T K D P S L N S S I D S E L * Q D L A K R K I R H Y I L H F T L W N N I W L K G N * G T I F * I F H * I DpnI TspDTI |BstKTI || CfrI || |Hin4I || |Hin4I MaeII || ||BalI | MseI || ||CviJI | SetI BsiI* || ||HaeIII | TaiI | BseMII DdeI || |||BsrI TaqI | | SspI | |BspCNI Bpu10I \\ \\\\ \ \ \ \ \ \\ \ GATCAACTGGCCAATGTCATCGACCACGTTAATATTTTTGCTCGTGCTACGCCTGAGCAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGTTGACCGGTTACAGTAGCTGGTGCAATTATAAAAACGAGCACGATGCGGACTCGTA // / // / / / / / / // / / || | || CfrI | | | | SspI || BsiI* Bpu10I || | |HaeIII | | | MseI |BspCNI DdeI || | |CviJI | | MaeII BseMII || | |BalI | TaiI || | BsrI | SetI || Hin4I TaqI || Hin4I || BclI || MboI |DpnI BstKTI D Q L A N V I D H V N I F A R A T P E H I N W P M S S T T L I F L L V L R L S I S T G Q C H R P R * Y F C S C Y A * A * ----:----|----:----|----:----|----:----|----:----|----:----| S * S A L T M S W T L I K A R A V G S C H D V P W H * R G R * Y K Q E H * A Q A I L Q G I D D V V N I N K S T S R R L M BccI CviRI* |BsrDI | MseI || BsrI MseI | |MnlI HphI || |BcgI \ \ \\ \ \\ \\ AAGTTAAACATTGTTCGTGCATTAAGAAAGAGGGGTGATGTGGTAGCAATGACTGGTGAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAATTTGTAACAAGCACGTAATTCTTTCTCCCCACTACACCATCGTTACTGACCACTA / / / / / / / // MseI | | MseI HphI | | |BcgI | MnlI | | BsrI CviRI* | BccI BsrDI K L N I V R A L R K R G D V V A M T G D S * T L F V H * E R G V M W * Q * L V M V K H C S C I K K E G * C G S N D W * W ----:----|----:----|----:----|----:----|----:----|----:----| L N F M T R A N L F L P S T T A I V P S Y T L C Q E H M L F S P H H P L L S Q H L * V N N T C * S L P T I H Y C H S T I MseI |HpaI |HindII |Hpy166II || Hpy99I BcgI BaeI ||HphI | HgaI |Hpy188I | TspEI \\\ \ \ \\ \ \ GGTGTTAACGACGCTCCTGCGTTGAAACTTTCAGATATTGGTGTTTCTATGGGTAGAATT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAATTGCTGCGAGGACGCAACTTTGAAAGTCTATAACCACAAAGATACCCATCTTAA /// / / / / / ||Hpy99I HgaI | Hpy188I BaeI TspEI |MseI BcgI Hpy166II HindII HphI HpaI G V N D A P A L K L S D I G V S M G R I V L T T L L R * N F Q I L V F L W V E L C * R R S C V E T F R Y W C F Y G * N W ----:----|----:----|----:----|----:----|----:----|----:----| P T L S A G A N F S E S I P T E I P L I H H * R R E Q T S V K L Y Q H K * P Y F T N V V S R R Q F K * I N T N R H T S N MwoI | CviJI | | DdeI | | | BaeI | | | |TsoI | | | |Hpy188I | | | || MnlI | | | || | Eco57I | | | || | Eco57MI TatI | | | || | |MseI |Csp6I Csp6I | | | || | |BspCNI ||RsaI |RsaI CviJI | | | || | ||BseMII ||ScaI \\ \ \ \ \ \\ \ \\\ \\\ GGTACAGATGTAGCCAAAGAAGCCTCAGATATGGTCTTAACTGATGATGACTTCAGTACT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| CCATGTCTACATCGGTTTCTTCGGAGTCTATACCAGAATTGACTACTACTGAAGTCATGA // / / // /// / /// / /// |Csp6I | MwoI || ||DdeI | ||| MseI ||TatI RsaI CviJI || || | ||BseMII |Csp6I || || | |BspCNI ScaI || || | Eco57MI RsaI || || | Eco57I || || MnlI || |Hpy188I || TsoI |CviJI BaeI G T D V A K E A S D M V L T D D D F S T V Q M * P K K P Q I W S * L M M T S V L Y R C S Q R S L R Y G L N * * * L Q Y Y ----:----|----:----|----:----|----:----|----:----|----:----| P V S T A L S A E S I T K V S S S K L V Q Y L H L W L L R L Y P R L Q H H S * Y T C I Y G F F G * I H D * S I I V E T S Hpy188I Ksp632I* MboII |ApoI MseI |MnlI | SetI MseI SspI |TspEI Hpy178III* \ \\ \ \ \ \ \\ \ ATTTTAACTGCCATTGAAGAGGGTAAAGGTATCTTTAATAATATTCAGAATTTCCTGACT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TAAAATTGACGGTAACTTCTCCCATTTCCATAGAAATTATTATAAGTCTTAAAGGACTGA / / / // / / / / / MseI | Ksp632I* |MboII MseI | | | Hpy178III* MnlI SetI | | TspEI | | ApoI | Hpy188I SspI I L T A I E E G K G I F N N I Q N F L T F * L P L K R V K V S L I I F R I S * L F N C H * R G * R Y L * * Y S E F P D F ----:----|----:----|----:----|----:----|----:----|----:----| I K V A M S S P L P I K L L I * F K R V * K L Q W Q L P Y L Y R * Y Y E S N G S N * S G N F L T F T D K I I N L I E Q S AciI BisI MseI MfeI AccI |BlsI |PmeI TspEI |Hpy166II ||TauI CviRI* SfeI* |AhaIII* \ \\ \\\ \ \ \\ TTTCAATTGTCTACTTCTGTTGCCGCACTATCATTAGTTGCACTATCTACAGCGTTTAAA 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGTTAACAGATGAAGACAACGGCGTGATAGTAATCAACGTGATAGATGTCGCAAATTT / // //// / / // | |AccI |||AciI CviRI* SfeI* |MseI | Hpy166II ||BisI AhaIII* TspEI |BlsI PmeI MfeI TauI F Q L S T S V A A L S L V A L S T A F K F N C L L L L P H Y H * L H Y L Q R L N S I V Y F C C R T I I S C T I Y S V * T ----:----|----:----|----:----|----:----|----:----|----:----| K * N D V E T A A S D N T A S D V A N L K E I T * K Q Q R V I M L Q V I * L T * K L Q R S R N G C * * * N C * R C R K F AsuI* CviRI* |BmgT120I | ApoI SspI ||CviJI | TspEI | BccI ||BseGI TspRI | BsrDI | MseI ||HaeIII \ \ \ \ \ \\\ CTACCCAATCCACTGAACGCAATGCAAATTCTTTGGATAAATATTTTAATGGATGGGCCA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| GATGGGTTAGGTGACTTGCGTTACGTTTAAGAAACCTATTTATAAAATTACCTACCCGGT / / / / // / // TspRI | TspEI SspI |MseI | |AsuI* | ApoI BccI | BmgT120I CviRI* | HaeIII BsrDI | CviJI BseGI L P N P L N A M Q I L W I N I L M D G P Y P I H * T Q C K F F G * I F * W M G H T Q S T E R N A N S L D K Y F N G W A T ----:----|----:----|----:----|----:----|----:----|----:----| S G L G S F A I C I R Q I F I K I S P G V V W D V S R L A F E K S L Y K L P H A * G I W Q V C H L N K P Y I N * H I P W NlaIV | SetI | | MboI | | BclI | | | DpnI | | | |FatI | | | |BspHI AluI | | | |BstKTI FokI | | | ||CviAII TspDTI CviJI DdeI | | | ||Hpy178III* | SetI | SetI SauI* SetI | | | ||| NlaIII | | TspDTI \ \ \ \ \ \ \ \\\ \ \ \ \ CCAGCTCAATCCTTAGGTGTGGAACCTGTTGATCATGAAGTTATGAAAAAACCTCCAAGA 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCGAGTTAGGAATCCACACCTTGGACAACTAGTACTTCAATACTTTTTTGGAGGTTCT / / / // / //// // / / / | | FokI |SauI* NlaIV |||| |BspHI | SetI TspDTI | CviJI |DdeI SetI |||| |FatI TspDTI | AluI SetI |||| Hpy178III* SetI |||| CviAII |||BclI |||MboI ||NlaIII |DpnI BstKTI P A Q S L G V E P V D H E V M K K P P R Q L N P * V W N L L I M K L * K N L Q E S S I L R C G T C * S * S Y E K T S K K ----:----|----:----|----:----|----:----|----:----|----:----| G A * D K P T S G T S * S T I F F G G L V L E I R L H P V Q Q D H L * S F V E L W S L G * T H F R N I M F N H F F R W S AclI MaeII | SetI | TaiI | |Hpy166II | || TspDTI | || | AciI | || | SecI* | || | DsaI* | || | | AciI | || | | FnuDII* | || | | NspBII* MnlI | || | | |BisI |MaeII | || | | |SacII || Csp6I | || | | ||BlsI || |RsaI FatI | || | | |||TauI || |SetI ApoI |CviAII | || | | |||CviJI || |TaiI TspEI || NlaIII | || | | |||HaeIII \\ \\ \ \\ \ \ \\ \ \ \\\\ AAACGTACCGATAAAATTTTGACCCATGATGTAATGAAACGTTTACTAACCACCGCGGCC 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGCATGGCTATTTTAAAACTGGGTACTACATTACTTTGCAAATGATTGGTGGCGCCGG // /// / / // / / / / ///// || ||Csp6I TspEI | |FatI | | | TspDTI ||||HaeIII || |RsaI ApoI | CviAII | | Hpy166II ||||CviJI || MaeII NlaIII | MaeII |||DsaI* |TaiI | AclI |||SecI* |SetI TaiI |||BisI MnlI SetI |||AciI ||BlsI |NspBII* |FnuDII* |AciI |TauI SacII K R T D K I L T H D V M K R L L T T A A N V P I K F * P M M * * N V Y * P P R P T Y R * N F D P * C N E T F T N H R G L ----:----|----:----|----:----|----:----|----:----|----:----| F R V S L I K V W S T I F R K S V V A A F V Y R Y F K S G H H L S V N V L W R P F T G I F N Q G M I Y H F T * * G G R G Tsp4CI* | Hpy166II CfrI | | BslFI | BccI | | | MseI | CviJI MaeIII TsoI | | | |BccI | HaeIII |MboII \ \ \ \ \\ \ \ \\ TGTATCATCGTTGGGACAGTTTACATTTTTGTTAAAGAGATGGCCGAAGATGGTAAAGTA 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| ACATAGTAGCAACCCTGTCAAATGTAAAAACAATTTCTCTACCGGCTTCTACCATTTCAT / / / / / /// / TsoI | Hpy166II | MseI ||CfrI MboII Tsp4CI* | BccI |BccI BslFI HaeIII CviJI C I I V G T V Y I F V K E M A E D G K V V S S L G Q F T F L L K R W P K M V K * Y H R W D S L H F C * R D G R R W * S N ----:----|----:----|----:----|----:----|----:----|----:----| Q I M T P V T * M K T L S I A S S P L T R Y * R Q S L K C K Q * L S P R L H Y L T D D N P C N V N K N F L H G F I T F Y MaeI MseI \ \ ACTGCTAGAGATACTACTATGACATTTACTTGTTTTGTTTTTTTTGATATGTTTAATGCT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| TGACGATCTCTATGATGATACTGTAAATGAACAAAACAAAAAAAACTATACAAATTACGA / / / | MaeI MseI MaeIII T A R D T T M T F T C F V F F D M F N A L L E I L L * H L L V L F F L I C L M L C * R Y Y Y D I Y L F C F F * Y V * C F ----:----|----:----|----:----|----:----|----:----|----:----| V A L S V V I V N V Q K T K K S I N L A L Q * L Y * * S M * K N Q K K Q Y T * H S S S I S S H C K S T K N K K I H K I S CviJI HaeIII | SfeI* CviJI | Cac8I | FalI | | CviRI* | FalI | | | PstI | | Hpy178III* | | | | FalI TaqI | | | MmeI | | | | FalI MboII AsuII | | | |BceAI \ \ \ \ \ \ \ \ \ \ \\ TTGGCCTGCAGACATAACACAAAGTCAATCTTCGAAATCGGCTTTTTCACGAACAAAATG 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGGACGTCTGTATTGTGTTTCAGTTAGAAGCTTTAGCCGAAAAAGTGCTTGTTTTAC / / / / / / // / / / | | | SfeI* MboII AsuII |CviJI | MmeI BceAI | | CviRI* TaqI FalI Hpy178III* | | FalI FalI | | FalI | Cac8I | PstI HaeIII CviJI L A C R H N T K S I F E I G F F T N K M W P A D I T Q S Q S S K S A F S R T K C G L Q T * H K V N L R N R L F H E Q N V ----:----|----:----|----:----|----:----|----:----|----:----| K A Q L C L V F D I K S I P K K V F L I K P R C V Y C L T L R R F R S K * S C F Q G A S M V C L * D E F D A K E R V F H Hin6I Tsp4CI* |GlaI | BsmAI SetI ||HhaI \ \ \ \\\ TTCAACTACGCCGTTGGACTGTCTCTGTTAGGTCAAATGTGCGCTATATATATACCATTT 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTGATGCGGCAACCTGACAGAGACAATCCAGTTTACACGCGATATATATATGGTAAA / // /// Tsp4CI* |BsmAI ||Hin6I SetI |GlaI HhaI F N Y A V G L S L L G Q M C A I Y I P F S T T P L D C L C * V K C A L Y I Y H F Q L R R W T V S V R S N V R Y I Y T I F ----:----|----:----|----:----|----:----|----:----|----:----| N L * A T P S D R N P * I H A I Y I G N T * S R R Q V T E T L D F T R * I Y V M E V V G N S Q R Q * T L H A S Y I Y W K BseMII |BspCNI || MseI || |AhaIII* || || DdeI Hpy188I \\ \\ \ \ TTCCAAAGTATCTTTAAAACTGAGAAACTTGGTATCTCTGATATACTATTGTTATTGCTC 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGTTTCATAGAAATTTTGACTCTTTGAACCATAGAGACTATATGATAACAATAACGAG // // / / || |MseI DdeI Hpy188I || AhaIII* |BspCNI BseMII F Q S I F K T E K L G I S D I L L L L L S K V S L K L R N L V S L I Y Y C Y C S P K Y L * N * E T W Y L * Y T I V I A H ----:----|----:----|----:----|----:----|----:----|----:----| K W L I K L V S F S P I E S I S N N N S K G F Y R * F Q S V Q Y R Q Y V I T I A E L T D K F S L F K T D R I Y * Q * Q E TspEI | EcoP15I | | TspEI | | | MnlI | | | TspDTI TspDTI | | | | Hpy166II \ \ \ \ \ \ ATCAGCAGTAGCGTTTTCATCGTTGATGAATTGAGAAAATTGTGGACGAGGAAAAAGAAT 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTCGTCATCGCAAAAGTAGCAACTACTTAACTCTTTTAACACCTGCTCCTTTTTCTTA / / / /// / TspDTI | | ||| Hpy166II | | ||TspEI | | |MnlI | | TspDTI | EcoP15I TspEI I S S S V F I V D E L R K L W T R K K N S A V A F S S L M N * E N C G R G K R M Q Q * R F H R * * I E K I V D E E K E * ----:----|----:----|----:----|----:----|----:----|----:----| M L L L T K M T S S N L F N H V L F F F * * C Y R K * R Q H I S F I T S S S F S D A T A N E D N I F Q S F Q P R P F L I HinfI | BbvII* | | MaeII | | MboII | | |TspDTI | | || SetI MlyI | | || TaiI PleI | | || MboII Hin4I \ \ \ \\ \ \ GAAGAAGACTCAACGTATTTCTCAAATGTTTGA 2830 2840 2850 ----:----|----:----|----:----|--- CTTCTTCTGAGTTGCATAAAGAGTTTACAAACT // / / / / |PleI | | BbvII* Hin4I MlyI | | MboII | | MaeII | TspDTI | MboII | TaiI | SetI HinfI E E D S T Y F S N V * K K T Q R I S Q M F X R R L N V F L K C L X ----:----|----:----|----:----|--- S S S E V Y K E F T Q H L L S L T N R L H K F F V * R I E * I N S # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 7 BspACI,SsiI AclI 3 Psp1406I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AluI 8 AluBI ApaLI 1 Alw44I,VneI ApoI 9 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BaeI 2 BalI 3 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 6 BpiI,BpuAI,BstV2I,BbsI BccI 7 Bce83I* 2 BpuEI BceAI 2 BcgI 1 BciVI 1 BfuI BclI 3 FbaI,Ksp22I BetI* 2 BsaWI BglII 2 BinI* 4 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmgT120I 3 Bpu10I 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 6 BseRI 1 BseSI 1 BaeGI,BstSLI BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 6 BspHI 1 CciI,PagI,RcaI BsrDI 4 BseMI,Bse3DI BsrI 10 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstEII 2 BstPI,Eco91I,EcoO65I,PspEI BstKTI 12 BstXI 1 BtsI 1 Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 4 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 12 CviQI,RsaNI CspCI 1 CviAII 6 CviJI 27 CviKI-1 CviRI* 9 HpyCH4V DdeI 8 BstDEI,HpyF3I DpnI 12 MalI DraII 1 EcoO109I DsaI* 2 BtgI,BstDSI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 5 AcuI Eco57MI 5 EcoP15I 3 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I FalI 6 FatI 6 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 2 HaeIII 10 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 7 Hin4II* 5 HpyAV Hin6I 2 HinP1I,HspAI HindII 5 HincII HindIII 1 HinfI 10 HpaI 2 KspAI HpaII 2 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 15 Hpy8I Hpy178III* 13 Hpy188III Hpy188I 14 Hpy99I 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 8 HpyCH4IV MaeIII 11 MboI 12 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 12 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 3 MunI MlyI 5 SchI MmeI 2 MnlI 13 MseI 24 Tru1I,Tru9I MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 3 HpyF10VI,BstMWI NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI PleI 5 PpsI PmeI 1 MssI PsrI 1 PstI 1 PvuI 1 MvrI,Ple19I,BpvUI RsaI 12 AfaI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII SalI 1 SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScaI 2 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 36 SfaNI 4 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 2 SmoI SspI 4 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 8 TaqI 11 TaqII 2 TatI 5 TauI 2 TfiI 5 PfeI TseI 1 ApeKI TsoI 4 Tsp45I 6 NmuCI Tsp4CI* 11 HpyCH4III,TaaI,Bst4CI TspDTI 17 TspEI 25 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 8 TscAI TstI 2 VspI 1 PshBI,AseI XbaI 2 XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AflIII AjuI AlfI AloI AlwNI ApaI AscI Asp718I AvaI AvaII AvrII BarI BbvCI BdaI BfiI BglI BmeT110I BmtI BplI BsaAI BsaBI BsaXI BsePI BseYI BsgI BsmI Bsp120I BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstZ17I BtgZI BtrI CauII* Cfr9I DinI DraIII DrdI EciI Ecl136II Eco47III EcoICRI EcoNI EgeI EheI Esp3I EspI* FseI FspAI GsaI GsuI HaeII HgiJII* KasI KpnI MauBI MluI MroNI MslI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI OliI PacI PasI PflMI PfoI PmaCI PpiI PpuMI PshAI PsiI PspOMI PspXI PvuII RsrII SacI SanDI SapI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI Tth111I XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769