Restriction Map of SUT1/YGL162W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SUT1/YGL162W on chromosome VII from coordinates 198138 to 199037.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.24162

MboI | DpnI | CspCI | |TaqI | |ClaI | |BstKTI | ||MboI | ||| DpnI | ||| |PvuI | ||| |McrI* MwoI Hpy166II Tsp4CI* | ||| |BstKTI |AciI \ \ \ \\\ \\ \\ ATGTCCACAAGCATTACAGTAAGAAATAGAGATCGATCGCTACCACCGCTATTGCTCCCC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGGTGTTCGTAATGTCATTCTTTATCTCTAGCTAGCGATGGTGGCGATAACGAGGGG / / /// /// / / / Hpy166II Tsp4CI* ||| ||| | MwoI AciI ||| ||| MboI ||| ||DpnI ||| |BstKTI ||| |McrI* ||| |ClaI ||| |TaqI ||| |PvuI ||| MboI ||DpnI |BstKTI CspCI M S T S I T V R N R D R S L P P L L L P C P Q A L Q * E I E I D R Y H R Y C S P V H K H Y S K K * R S I A T T A I A P Q ----:----|----:----|----:----|----:----|----:----|----:----| X D V L M V T L F L S R D S G G S N S G X T W L C * L L F Y L D I A V V A I A G H G C A N C Y S I S I S R * W R * Q E G HgiCI* | NlaIV | | BceAI | | | HphI BinI* | | | PflMI TaqII CspCI MaeI | | | BsiYI* | MboI \ \ \ \ \ \ \ \ AATGTTTCCCTGCTAGAAAAAGATATACGGCGTAAAGGCACCCAAAATGTGGGCATCACC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAAAGGGACGATCTTTTTCTATATGCCGCATTTCCGTGGGTTTTACACCCGTAGTGG / / / / / / / / CspCI MaeI | | | HphI | BinI* | | BsiYI* TaqII | | BceAI | | PflMI | HgiCI* NlaIV N V S L L E K D I R R K G T Q N V G I T M F P C * K K I Y G V K A P K M W A S P C F P A R K R Y T A * R H P K C G H H R ----:----|----:----|----:----|----:----|----:----|----:----| L T E R S S F S I R R L P V W F T P M V W H K G A L F L Y V A Y L C G F H P C * I N G Q * F F I Y P T F A G L I H A D G SalI |TaqI AluI DpnI |AccI CviJI SfaNI ||HindII AciI |MnlI |BstKTI ||Hpy166II | Cac8I |EcoP15I ||Hpy178III* ||| MnlI FauI | | CviJI Hpy188I ||SetI \\\ \\\ \ \ \ \ \ \ \\\ GATCCAGAACTCTTGTCGACCACTTGGACGAGGAAGCGGGCTTTTCCGACTGACGAGCTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGGTCTTGAGAACAGCTGGTGAACCTGCTCCTTCGCCCGAAAAGGCTGACTGCTCGAA // / / /// / / / / / / / / || | Hpy178III* ||| MnlI FauI | CviJI Hpy188I | | EcoP15I || | SfaNI ||SalI Cac8I | CviJI || MboI |AccI AciI | AluI |DpnI |TaqI | MnlI BstKTI Hpy166II SetI HindII D P E L L S T T W T R K R A F P T D E L I Q N S C R P L G R G S G L F R L T S F S R T L V D H L D E E A G F S D * R A F ----:----|----:----|----:----|----:----|----:----|----:----| S G S S K D V V Q V L F R A K G V S S S R D L V R T S W K S S S A P K E S Q R A I W F E Q R G S P R P L P S K R S V L K CviJI | Cac8I | | TseI | | |BisI | | ||BlsI | | ||| AciI | | ||| BisI | | ||| |BlsI | | ||| ||TauI Hin6I CviJI BbvI | | ||| ||NspBII* |GlaI | MmeI | MseI | | ||| ||| Tsp4CI* ||HhaI \ \ \ \ \ \ \\\ \\\ \ \\\ TTAGGAGGCTATAAGAGATTAAAGCCTGCTGCCGCTGACAGTAATGAGTGCGCTATTGGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AATCCTCCGATATTCTCTAATTTCGGACGACGGCGACTGTCATTACTCACGCGATAACCA / / / / / ////// / /// CviJI | | | | |||||| Tsp4CI* ||Hin6I MmeI | | | | |||||NspBII* |GlaI | | | | |||||AciI HhaI | | | | ||||BisI | | | | |||BlsI | | | | ||TseI | | | | ||TauI | | | | |BisI | | | | BlsI | | | Cac8I | | CviJI | MseI BbvI L G G Y K R L K P A A A D S N E C A I G * E A I R D * S L L P L T V M S A L L V R R L * E I K A C C R * Q * * V R Y W Y ----:----|----:----|----:----|----:----|----:----|----:----| K P P * L L N F G A A A S L L S H A I P K L L S Y S I L A Q Q R Q C Y H T R * Q * S A I L S * L R S G S V T I L A S N T SecI* DsaI* | MaeIII | Tsp45I | Tsp4CI* | | AcyI | | | AciI | | | BisI | | | |BlsI | | | ||TauI | | | |||AciI | | | |||BisI | | | ||||BlsI | | | |||||TauI | | | |||||HgaI | | | |||||HphI | | | |||||| MwoI TspEI \ \ \ \\\\\\ \ \ ATTGCCACGGTGACGCCGCCGCCAACGCTCCCCGTAAGTGCGATTGTTCCCCCTCCACAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAACGGTGCCACTGCGGCGGCGGTTGCGAGGGGCATTCACGCTAACAAGGGGGAGGTGTT // //////// / || |||||||MwoI HgaI || |||||||AciI || ||||||HphI || ||||||BisI || |||||BlsI || ||||AciI || ||||TauI || |||BisI || ||BlsI || |AcyI || |TauI || Tsp45I || MaeIII |DsaI* |SecI* Tsp4CI* I A T V T P P P T L P V S A I V P P P Q L P R * R R R Q R S P * V R L F P L H K C H G D A A A N A P R K C D C S P S T K ----:----|----:----|----:----|----:----|----:----|----:----| I A V T V G G G V S G T L A I T G G G C Y Q W P S A A A L A G R L H S Q E G E V N G R H R R R W R E G Y T R N N G R W L FatI BseGI NcoI | MslI StyI | |FatI SecI* | ||CviAII DsaI* | ||| NlaIII |CviAII MnlI FokI | ||| | MnlI || NlaIII HgaI \ \ \ \\\ \ \ \\ \ \ AATTACACTCCACCATTGTTTGAGTATCATCCTCATGCTCTTGCTTCCATGGTCAATGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTAATGTGAGGTGGTAACAAACTCATAGTAGGAGTACGAGAACGAAGGTACCAGTTACTT / / / / // // / / // | TspEI FokI BseGI || || MnlI | |DsaI* MnlI || |FatI | |SecI* || CviAII | |StyI |NlaIII | |NcoI MslI | |FatI | CviAII NlaIII N Y T P P L F E Y H P H A L A S M V N E I T L H H C L S I I L M L L L P W S M K L H S T I V * V S S S C S C F H G Q * R ----:----|----:----|----:----|----:----|----:----|----:----| F * V G G N N S Y * G * A R A E M T L S F N C E V M T Q T D D E H E Q K W P * H I V S W W Q K L I M R M S K S G H D I F BbvII* | HgaI | MboII | |TspDTI | || FatI | || |CviAII Hin6I | || || CviRI* FnuDII* | || || NlaIII |GlaI BseRI | || || | MslI TspEI ||HhaI MwoI |TaqI \ \\ \\ \ \ \ \\\ \ \\ GACGCTAATGCGTCATGCACTCAAATGTCTATAATTTCGCGCTCAACGAGCAACTCGACA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCGATTACGCAGTACGTGAGTTTACAGATATTAAAGCGCGAGTTGCTCGTTGAGCTGT / / / /// / / /// / / / / HgaI | | ||| MslI | ||| MwoI | | SetI | | ||CviRI* | ||Hin6I | TaqI | | ||FatI | |GlaI BseRI | | |CviAII | FnuDII* | | HgaI | HhaI | NlaIII TspEI TspDTI BbvII* MboII D A N A S C T Q M S I I S R S T S N S T T L M R H A L K C L * F R A Q R A T R Q R * C V M H S N V Y N F A L N E Q L D N ----:----|----:----|----:----|----:----|----:----|----:----| S A L A D H V * I D I I E R E V L L E V L R * H T M C E F T * L K A S L S C S S V S I R * A S L H R Y N R A * R A V R C AsuI* |CviJI MnlI |HaeIII | MnlI |BmgT120I | | SpeI TspEI || MaeIII SetI | | |MaeI | BsmAI || Tsp45I \ \ \ \\ \ \ \\ \ ACCTCCTCTGCCACATCTACTAGTTCAATTTCCAAGAGACAAAGAAGTGGCCCAAGTTGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAGGAGACGGTGTAGATGATCAAGTTAAAGGTTCTCTGTTTCTTCACCGGGTTCAACA / / // / / /// | MnlI |SpeI | BsmAI ||AsuI* MnlI MaeI TspEI |BmgT120I HaeIII CviJI T S S A T S T S S I S K R Q R S G P S C P P L P H L L V Q F P R D K E V A Q V V L L C H I Y * F N F Q E T K K W P K L * ----:----|----:----|----:----|----:----|----:----|----:----| V E E A V D V L E I E L L C L L P G L Q L R R Q W M * * N L K W S V F F H G L N G G R G C R S T * N G L S L S T A W T T PshAI TspEI Hpy178III* \ \ \ GACAAATGTCGTTTGAAAAAAATAAAATGTAATGCGAAAATTGAGATTTTGCTTCAAGAC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTTACAGCAAACTTTTTTTATTTTACATTACGCTTTTAACTCTAAAACGAAGTTCTG / / / / | PshAI TspEI Hpy178III* Tsp45I MaeIII D K C R L K K I K C N A K I E I L L Q D T N V V * K K * N V M R K L R F C F K T Q M S F E K N K M * C E N * D F A S R R ----:----|----:----|----:----|----:----|----:----|----:----| S L H R K F F I F H L A F I S I K S * S H C I D N S F F L I Y H S F Q S K A E L V F T T Q F F Y F T I R F N L N Q K L V AciI | Csp6I | |RsaI | ||MaeII | |||MlyI | |||PleI | |||| SetI MboI | |||| TaiI | DpnI | |||| |Hpy178III* | |BstKTI | |||| || HinfI | ||Hpy178III* | |||| || |BcgI BcgI | |||TaqI | |||| || || Hpy178III* \ \ \\\\ \ \\\\ \\ \\ \ GATACTATAATGCCAATGATCTCGAACAAGTTGCGGTACGTCTTGACTCCTGACGATATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGATATTACGGTTACTAGAGCTTGTTCAACGCCATGCAGAACTGAGGACTGCTATAA / // / // / //// / / / BcgI || | |TaqI | |||| | | Hpy178III* || | Hpy178III* | |||| | HinfI || MboI | |||| Hpy178III* |DpnI | |||| BcgI BstKTI | |||MaeII | |||PleI | ||MlyI | |Csp6I | RsaI | TaiI | SetI AciI D T I M P M I S N K L R Y V L T P D D I I L * C Q * S R T S C G T S * L L T I F Y Y N A N D L E Q V A V R L D S * R Y S ----:----|----:----|----:----|----:----|----:----|----:----| S V I I G I I E F L N R Y T K V G S S I R Y * L A L S R S C T A T R R S E Q R Y I S Y H W H D R V L Q P V D Q S R V I N AlfI AlfI AlfI AlfI FokI CviJI | BetI* MnlI | Csp6I |MnlI TaqI Cac8I AciI SspI | |HpaII BseGI | |RsaI \\ \ \ \ \ \ \\ \ \ \\ CGGCTATATCGAGGCACGCTGTTGCGGAATATTGCCATACCGGATGATGTCATTGAGGGT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GCCGATATAGCTCCGTGCGACAACGCCTTATAACGGTATGGCCTACTACAGTAACTCCCA / / / / / / / // // // | CviJI TaqI Cac8I | SspI AlfI || |MnlI |RsaI | MnlI AciI AlfI || BseGI FokI AlfI |BetI* AlfI HpaII R L Y R G T L L R N I A I P D D V I E G G Y I E A R C C G I L P Y R M M S L R V A I S R H A V A E Y C H T G * C H * G Y ----:----|----:----|----:----|----:----|----:----|----:----| R S Y R P V S N R F I A M G S S T M S P E A I D L C A T A S Y Q W V P H H * Q P P * I S A R Q Q P I N G Y R I I D N L T SetI CviJI MseI | Hpy166II \ \ \ \ ACAGGCTCACGCAAGTTGATTAAGCATATTGATAAGTTGGTTTTGCTCACACCTTGTTTA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCCGAGTGCGTTCAACTAATTCGTATAACTATTCAACCAAAACGAGTGTGGAACAAAT / / / / / | CviJI MseI SetI Hpy166II Csp6I T G S R K L I K H I D K L V L L T P C L Q A H A S * L S I L I S W F C S H L V Y R L T Q V D * A Y * * V G F A H T L F T ----:----|----:----|----:----|----:----|----:----|----:----| V P E R L N I L C I S L N T K S V G Q K Y L S V C T S * A Y Q Y T P K A * V K N C A * A L Q N L M N I L Q N Q E C R T * FatI |CviAII || CviRI* || NlaIII || | EcoT22I || | | MboII || | | | MboII TatI || | | | |BsmI |Csp6I || | |MseI | || MboII TspEI ||RsaI \\ \ \\ \ \\ \ \ \\\ CCATGCATTAAGAAAAAGCATTCTTCTTCTTCCACTAATTTCCCAAAAAATGATAAATGT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GGTACGTAATTCTTTTTCGTAAGAAGAAGAAGGTGATTAAAGGGTTTTTTACTATTTACA / /// / / / / / / | ||| | | | MboII TspEI RsaI | ||| | | MboII | ||| | | BsmI | ||| | MboII | ||| MseI | ||CviRI* | ||FatI | |CviAII | EcoT22I NlaIII P C I K K K H S S S S T N F P K N D K C H A L R K S I L L L P L I S Q K M I N V M H * E K A F F F F H * F P K K * * M Y ----:----|----:----|----:----|----:----|----:----|----:----| G H M L F F C E E E E V L K G F F S L H V M C * S F A N K K K W * N G L F H Y I W A N L F L M R R R G S I E W F I I F T AluI CviJI | FokI MseI | SetI | ApoI CviJI | | TspDTI BseGI | TspEI \ \ \ \ \ \ \ ACTTTTTCAAAAGGCTTTACCAGAGCTGACATAAACATTTCATCCAAAATCTCCTTAAAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAAAAGTTTTCCGAAATGGTCTCGACTGTATTTGTAAAGTAGGTTTTAGAGGAATTTT // / / / / / / / |TatI CviJI | | | FokI BseGI MseI Csp6I | | TspDTI | CviJI | AluI SetI T F S K G F T R A D I N I S S K I S L K L F Q K A L P E L T * T F H P K S P * N F F K R L Y Q S * H K H F I Q N L L K I ----:----|----:----|----:----|----:----|----:----|----:----| V K E F P K V L A S M F M E D L I E K F Y K K L L S * W L Q C L C K M W F R R L S K * F A K G S S V Y V N * G F D G * F MseI SetI \ \ TTTAAGGATAAAACCATTTACGACATAACCTATGATGACTATAAAAGCATTGATTTTTAG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTCCTATTTTGGTAAATGCTGTATTGGATACTACTGATATTTTCGTAACTAAAAATC / / / | MseI SetI TspEI ApoI F K D K T I Y D I T Y D D Y K S I D F * L R I K P F T T * P M M T I K A L I F X * G * N H L R H N L * * L * K H * F L X ----:----|----:----|----:----|----:----|----:----|----:----| N L S L V M * S M V * S S * L L M S K * I * P Y F W K R C L R H H S Y F C Q N K K L I F G N V V Y G I I V I F A N I K L # Enzymes that cut Frequency Isoschizomers AccI 1 FblI,XmiI AciI 7 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AlfI 2 AluI 2 AluBI ApoI 1 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BceAI 1 BcgI 1 BetI* 1 BsaWI BinI* 1 AlwI,BspPI,AclWI BisI 4 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 4 BmgT120I 1 BseGI 3 BstF5I,BtsCI BseRI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BstKTI 4 Cac8I 3 BstC8I ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 3 CviQI,RsaNI CspCI 1 CviAII 4 CviJI 9 CviKI-1 CviRI* 2 HpyCH4V DpnI 4 MalI DsaI* 2 BtgI,BstDSI EcoP15I 1 EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 4 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 2 HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 3 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin6I 2 HinP1I,HspAI HindII 1 HincII HinfI 1 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 1 MaeI 2 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 2 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 McrI* 1 BsiEI,BstMCI,Bsh1285I MlyI 1 SchI MmeI 1 MnlI 8 MseI 5 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NcoI 1 Bsp19I NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PflMI 1 BasI,AccB7I,Van91I PleI 1 PpsI PshAI 1 BstPAI,BoxI PvuI 1 MvrI,Ple19I,BpvUI RsaI 3 AfaI SalI 1 SecI* 2 BseDI,BssECI,BsaJI SetI 6 SfaNI 1 LweI SpeI 1 BcuI,AhlI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 5 TaqII 1 TatI 1 TauI 3 TseI 1 ApeKI Tsp45I 2 NmuCI Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 6 TasI,Tsp509I,Sse9I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AflII AflIII AgeI AhaIII* AjuI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BccI Bce83I* BciVI BclI BdaI BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseSI BseYI BsgI BsiI* BslFI BsmFI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI DdeI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoRII EcoRV EgeI EheI Esp3I EspI* FalI FaqI FseI FspAI GsaI GsuI HaeII HgiAI* HgiJII* Hin4I Hin4II* HindIII HpaI Hpy99I KasI KpnI Ksp632I* MauBI MfeI MluI MroNI MstI* MvaI NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI NspI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PsiI PspOMI PspXI PsrI PstI PvuII RsrII SacI SacII SanDI SapI SauI* ScaI ScrFI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TfiI TsoI TspGWI TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769