Restriction Map of RPS2/YGL123W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RPS2/YGL123W on chromosome VII from coordinates 277617 to 278381.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.31238

BceAI Hpy178III* |CfrI | MwoI || CviJI | | AluI || HaeIII | | CviJI BceAI || | MnlI CviJI | | | SetI MnlI | SetI || | MaeIII HaeIII \ \ \ \ \ \ \ \\ \ \ \ ATGTCTGCTCCAGAAGCTCAACAACAAAAGAGAGGTGGTTTCGGTGGCCGTAACAGAGGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGACGAGGTCTTCGAGTTGTTGTTTTCTCTCCACCAAAGCCACCGGCATTGTCTCCG / / / / / / / //// / / | | | CviJI MnlI | BceAI |||CfrI | HaeIII | | | AluI SetI ||MnlI | CviJI | | SetI |HaeIII MaeIII | Hpy178III* |CviJI MwoI BceAI M S A P E A Q Q Q K R G G F G G R N R G C L L Q K L N N K R E V V S V A V T E A V C S R S S T T K E R W F R W P * Q R P ----:----|----:----|----:----|----:----|----:----|----:----| X D A G S A * C C F L P P K P P R L L P X T Q E L L E V V F S L H N R H G Y C L H R S W F S L L L L S T T E T A T V S A MboII | BseGI | |NlaIV | || BsrI AsuI* | || |Eco57I AvaII | || |Eco57MI Ksp632I* |BmgT120I TspRI | || ||MaeIII |MnlI || MboII | BccI | || ||| FokI \\ \\ \ \ \ \ \\ \\\ \ CGTCCAAACAGAAGAGGACCAAGAAACACTGAAGAAAAGGGATGGGTTCCAGTTACCAAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GCAGGTTTGTCTTCTCCTGGTTCTTTGTGACTTCTTTTCCCTACCCAAGGTCAATGGTTT / / // / / / / / // // | Ksp632I* || | TspRI BccI | | |Eco57MI |FokI MnlI || MboII | | |Eco57I MaeIII |AvaII | | NlaIV |AsuI* | | BsrI BmgT120I | BseGI MboII R P N R R G P R N T E E K G W V P V T K V Q T E E D Q E T L K K R D G F Q L P N S K Q K R T K K H * R K G M G S S Y Q T ----:----|----:----|----:----|----:----|----:----|----:----| R G F L L P G L F V S S F P H T G T V L G D L C F L V L F C Q L F P I P E L * W T W V S S S W S V S F F L S P N W N G F MboII | CviRI* | | MwoI MaeI SetI CviJI MboII | | BstAPI \ \ \ \ \ \ \ CTAGGTAGATTAGTCAAGGCTGGTAAGATTACCACCATTGAAGAAATCTTCTTGCACTCT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GATCCATCTAATCAGTTCCGACCATTCTAATGGTGGTAACTTCTTTAGAAGAACGTGAGA // / / / / / |MaeI CviJI MboII | | BstAPI SetI | | MwoI | CviRI* MboII L G R L V K A G K I T T I E E I F L H S * V D * S R L V R L P P L K K S S C T L R * I S Q G W * D Y H H * R N L L A L F ----:----|----:----|----:----|----:----|----:----|----:----| S P L N T L A P L I V V M S S I K K C E V L Y I L * P Q Y S * W W Q L F R R A S * T S * D L S T L N G G N F F D E Q V R BssKI EcoRII | ScrFI Tth111I | BseBI | FatI ApoI | | SetI | BspHI TspEI | | MwoI | |CviAII BsrI EcoRI | | | CviRI* | |Hpy178III* \ \ \ \ \ \ \ \\ TTGCCAGTCAAGGAATTCCAAATCATTGACACTTTGTTGCCAGGTTTGCAAGACGAAGTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AACGGTCAGTTCCTTAAGGTTTAGTAACTGTGAAACAACGGTCCAAACGTTCTGCTTCAG / / // / / / / BsrI EcoRI || | CviRI* | NlaIII TspEI || EcoRII Tth111I ApoI || BssKI |BseBI |ScrFI |MwoI SetI L P V K E F Q I I D T L L P G L Q D E V C Q S R N S K S L T L C C Q V C K T K S A S Q G I P N H * H F V A R F A R R S H ----:----|----:----|----:----|----:----|----:----|----:----| K G T L S N W I M S V K N G P K C S S T K A L * P I G F * Q C K T A L N A L R L Q W D L F E L D N V S Q Q W T Q L V F D CviJI CviJI |BsrI Cfr10I NlaIII || TspDTI |HpaII MseI CviJI \ \\ \ \\ \ \ ATGAACATCAAGCCAGTTCAAAAGCAAACCAGAGCCGGTCAAAGAACCAGATTTAAGGCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTGTAGTTCGGTCAAGTTTTCGTTTGGTCTCGGCCAGTTTCTTGGTCTAAATTCCGA // // / / // / / |BspHI || TspDTI | |Cfr10I | CviJI |FatI |CviJI | HpaII MseI | BsrI CviJI Hpy178III* CviAII M N I K P V Q K Q T R A G Q R T R F K A * T S S Q F K S K P E P V K E P D L R L E H Q A S S K A N Q S R S K N Q I * G C ----:----|----:----|----:----|----:----|----:----|----:----| M F M L G T * F C V L A P * L V L N L A * S C * A L E F A F W L R D F F W I * P H V D L W N L L L G S G T L S G S K L S HphI MaeIII MlyI Tsp45I PleI Tsp4CI* Hpy178III* | MaeIII | MaeII | AciI | Tsp45I | | SetI | | StyI | | HinfI | | TaiI | | SecI* \ \ \ \ \ \ \ \ \ GTTGTCGTTGTTGGTGACTCTAACGGTCACGTTGGTTTGGGTATCAAGACCGCCAAGGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CAACAGCAACAACCACTGAGATTGCCAGTGCAACCAAACCCATAGTTCTGGCGGTTCCTT // // / / // / / / |PleI || | | |MaeII | AciI SecI* MlyI || | | Tsp45I | StyI || | | MaeIII Hpy178III* || | TaiI || | SetI || Tsp4CI* || HphI |HinfI Tsp45I MaeIII V V V V G D S N G H V G L G I K T A K E L S L L V T L T V T L V W V S R P P R K C R C W * L * R S R W F G Y Q D R Q G S ----:----|----:----|----:----|----:----|----:----|----:----| T T T T P S E L P * T P K P I L V A L S Q Q R Q Q H S * R D R Q N P Y * S R W P N D N N T V R V T V N T Q T D L G G L F MwoI Hpy188I | AluI Ksp632I* HgiCI* | BccI |MnlI |Hin4I | CviJI || BaeI ||NlaIV | | SetI TspGWI Hin4I || |Hpy188I \\\ \ \ \ \ \ \\ \\ GTTGCTGGTGCCATCAGAGCTGGTATCATTATTGCCAAGTTGTCCGTTATCCCAATCAGA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGACCACGGTAGTCTCGACCATAGTAATAACGGTTCAACAGGCAATAGGGTTAGTCT / / / / / / // / / / / / Hin4I | | | | | |BccI | Hin4I | | Ksp632I* | | | | | CviJI TspGWI | | Hpy188I | | | | | AluI | MnlI | | | | SetI BaeI | | | Hpy188I | | MwoI | HgiCI* NlaIV V A G A I R A G I I I A K L S V I P I R L L V P S E L V S L L P S C P L S Q S E C W C H Q S W Y H Y C Q V V R Y P N Q K ----:----|----:----|----:----|----:----|----:----|----:----| T A P A M L A P I M I A L N D T I G I L L Q Q H W * L Q Y * * Q W T T R * G L * N S T G D S S T D N N G L Q G N D W D S MboII | BsrI | Acc65I | HgiCI* | |Csp6I | ||RsaI PsrI | ||NlaIV CfrI | CspCI | ||| KpnI HindII | BalI | | BsrI MaeIII | ||| |BfiI Hpy166II | CviJI | | TspRI | SetI | ||| || CspCI | BaeI | HaeIII | | TspGWI \ \ \ \\\ \\ \ \ \ \ \ \ \ \ AGAGGTTACTGGGGTACCAACTTGGGTCAACCACATTCTTTGGCCACCAAGACCACTGGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCCAATGACCCCATGGTTGAACCCAGTTGGTGTAAGAAACCGGTGGTTCTGGTGACCA / /// / //// / / / // / / / SetI ||| | |||CspCI | Hpy166II | |PsrI | | TspGWI ||| | ||HgiCI* | HindII | CfrI | | BsrI ||| | ||Acc65I BaeI HaeIII | CspCI ||| | ||BfiI CviJI TspRI ||| | |Csp6I BalI ||| | NlaIV ||| | RsaI ||| KpnI ||BsrI |MboII MaeIII R G Y W G T N L G Q P H S L A T K T T G E V T G V P T W V N H I L W P P R P L V R L L G Y Q L G S T T F F G H Q D H W * ----:----|----:----|----:----|----:----|----:----|----:----| L P * Q P V L K P * G C E K A V L V V P F L N S P Y W S P D V V N K P W W S W Q S T V P T G V Q T L W M R Q G G L G S T NlaIV | MaeIII | Tsp45I | | Tsp4CI* | | | BinI* | | | TspRI | | | | PsrI | | | | | MboI | | | | | | DpnI | | | | | | |BstKTI | | | | | | ||BseYI BarI | | | | | | ||| MnlI | SetI | | | | | | ||| GsaI | | GsuI | | | | | | ||| CviJI | | Eco57MI Hpy99I \ \ \ \ \ \ \\\ \ \ \ \ \ AAGTGTGGTTCCGTCACTGTTAGATTGATCCCAGCCCCAAGAGGTTCTGGTATCGTCGCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTCACACCAAGGCAGTGACAATCTAACTAGGGTCGGGGTTCTCCAAGACCATAGCAGCGA / / // / // / // / / / / | | || | || | || | | Eco57MI Hpy99I | | || | || | || | | GsuI | | || | || | || | SetI | | || | || | || BarI | | || | || | |BseYI | | || | || | |CviJI | | || | || | MnlI | | || | || MboI | | || | || GsaI | | || | |DpnI | | || | BstKTI | | || BinI* | | |PsrI | | Tsp4CI* | | Tsp45I | | MaeIII | TspRI NlaIV K C G S V T V R L I P A P R G S G I V A S V V P S L L D * S Q P Q E V L V S S L V W F R H C * I D P S P K R F W Y R R F ----:----|----:----|----:----|----:----|----:----|----:----| L H P E T V T L N I G A G L P E P I T A Y T H N R * Q * I S G L G L L N Q Y R R L T T G D S N S Q D W G W S T R T D D S MwoI | AluI | CviJI | PvuII CviRI* AccI | NspBII* |MfeI |Hpy166II | | SetI BarI |TspEI CviJI || MboII \ \ \ \ \\ \ \\ \ TCTCCAGCTGTCAAAAAGTTGTTGCAATTGGCTGGTGTTGAAGATGTCTACACCCAATCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGGTCGACAGTTTTTCAACAACGTTAACCGACCACAACTTCTACAGATGTGGGTTAGA / / / / / / / // / | | | BarI | | CviJI || MboII | | NspBII* | TspEI |AccI | | PvuII | MfeI Hpy166II | | CviJI CviRI* | | AluI | SetI MwoI S P A V K K L L Q L A G V E D V Y T Q S L Q L S K S C C N W L V L K M S T P N L S S C Q K V V A I G W C * R C L H P I * ----:----|----:----|----:----|----:----|----:----|----:----| E G A T L F N N C N A P T S S T * V W D K E L Q * F T T A I P Q H Q L H R C G I R W S D F L Q Q L Q S T N F I D V G L R TseI Tsp4CI* BbvI CviJI | TaqII | Hin4II* |BisI | | MaeI | | SetI ||BlsI MwoI MaeIII \ \ \ \ \ \ \\\ \ \ AACGGTAAGACTAGAACTTTGGAAAACACCTTGAAGGCTGCTTTCGTTGCTATTGGTAAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCCATTCTGATCTTGAAACCTTTTGTGGAACTTCCGACGAAAGCAACGATAACCATTG / / / /// //// / / | TaqII MaeI ||BbvI |||| MwoI MaeIII Tsp4CI* |SetI |||TseI Hin4II* ||BisI |BlsI CviJI N G K T R T L E N T L K A A F V A I G N T V R L E L W K T P * R L L S L L L V T R * D * N F G K H L E G C F R C Y W * H ----:----|----:----|----:----|----:----|----:----|----:----| L P L V L V K S F V K F A A K T A I P L * R Y S * F K P F C R S P Q K R Q * Q Y V T L S S S Q F V G Q L S S E N S N T V Tsp4CI* BstXI | MlyI | AsuI* | PleI | |BmgT120I | | Hpy178III* | ||CviJI BsaXI | | | HinfI | ||HaeIII BsrDI BsrI Hin4I \ \ \ \ \ \\\ \ \ \ ACATACGGTTTCTTGACTCCAAACTTGTGGGCCGAACAACCATTGCCAGTTTCTCCATTG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TGTATGCCAAAGAACTGAGGTTTGAACACCCGGCTTGTTGGTAACGGTCAAAGAGGTAAC / // / / / // / / / / | || | | BstXI |AsuI* BsrDI | | BsaXI | || | HinfI BmgT120I | Hin4I | || Hpy178III* HaeIII BsrI | |PleI CviJI | MlyI Tsp4CI* T Y G F L T P N L W A E Q P L P V S P L H T V S * L Q T C G P N N H C Q F L H W I R F L D S K L V G R T T I A S F S I G ----:----|----:----|----:----|----:----|----:----|----:----| V Y P K K V G F K H A S C G N G T E G N C M R N R S E L S T P R V V M A L K E M C V T E Q S W V Q P G F L W Q W N R W Q Hpy188I | HindIII | | AluI | | CviJI | | | SetI | | | |BsaXI | | | || Hin4I XmnI | | | || | Ksp632I* |TfiI | | | || | |TspDTI |HinfI \ \ \ \\ \ \\ \\ GACATCTACTCCGATGAAGCTTCTGCTCAAAAGAAGAGATTCTAA 730 740 750 760 ----:----|----:----|----:----|----:----|----: CTGTAGATGAGGCTACTTCGAAGACGAGTTTTCTTCTCTAAGATT / / / / / / / / | | | | | | | HinfI | | | | | | | TfiI | | | | | | XmnI | | | | | Ksp632I* | | | | TspDTI | | | HindIII | | Hin4I | | BsaXI | | CviJI | | AluI | SetI Hpy188I D I Y S D E A S A Q K K R F * T S T P M K L L L K R R D S X H L L R * S F C S K E E I L X ----:----|----:----|----:----|----:----|----: S M * E S S A E A * F F L N * P C R S R H L K Q E F S S I R V D V G I F S R S L L L S E L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 1 BspACI,SsiI AluI 4 AluBI ApoI 1 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BccI 2 BceAI 2 BfiI 1 BmrI,BmuI BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 2 BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseYI 1 BspHI 1 CciI,PagI,RcaI BsrDI 1 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstAPI 1 BstKTI 1 BstXI 1 Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 1 CviQI,RsaNI CspCI 1 CviAII 1 CviJI 15 CviKI-1 CviRI* 3 HpyCH4V DpnI 1 MalI Eco57I 1 AcuI Eco57MI 2 EcoRI 1 EcoRII 1 AjnI,Psp6I,PspGI FatI 1 FokI 1 GsaI 1 GsuI 1 BpmI HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgiCI* 2 BanI,BshNI,BspT107I,AccB1I Hin4I 2 Hin4II* 1 HpyAV HindII 1 HincII HindIII 1 HinfI 3 HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 3 Hpy99I 1 KpnI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 7 MboI 1 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 6 MfeI 1 MunI MlyI 2 SchI MnlI 5 MseI 1 Tru1I,Tru9I MwoI 6 HpyF10VI,BstMWI NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PleI 2 PpsI PsrI 1 PvuII 1 RsaI 1 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 1 BseDI,BssECI,BsaJI SetI 11 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqII 1 TfiI 1 PfeI TseI 1 ApeKI Tsp45I 3 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 2 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 3 TscAI Tth111I 1 PflFI,PsyI,AspI XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvrII BamHI BbvCI BbvII* Bce83I* BcgI BciVI BclI BdaI BetI* BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BseMII BsePI BseRI BseSI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstEII BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr9I ClaI DdeI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GlaI HaeII HgaI HgiAI* HgiJII* HhaI Hin6I HinP1I HpaI HspAI KasI MauBI McrI* MluI MmeI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfaNI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqI TatI TauI TsoI TspMI TstI VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769