Restriction Map of SLD3/YGL113W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

SLD3/YGL113W on chromosome VII from coordinates 295932 to 297938.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2868

StuI CviJI HaeIII FatI |Hin4I AluI |CviAII || FokI CviJI || NlaIII SfaNI || |SmlI |DdeI \\ \ \ \\ \\ \\ ATGGAAACATGGGAAGTCATAGCATCGGTAAAAGAAGCAACAAAAGGCCTTGACTTGAGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTTGTACCCTTCAGTATCGTAGCCATTTTCTTCGTTGTTTTCCGGAACTGAACTCG / // / / / /// | |FatI SfaNI | HaeIII ||CviJI | CviAII | CviJI ||AluI NlaIII | StuI |SmlI Hin4I SetI FokI M E T W E V I A S V K E A T K G L D L S W K H G K S * H R * K K Q Q K A L T * A G N M G S H S I G K R S N K R P * L E L ----:----|----:----|----:----|----:----|----:----|----:----| X S V H S T M A D T F S A V F P R S K L X P F M P L * L M P L L L L L L G Q S S H F C P F D Y C R Y F F C C F A K V Q A SecI* |Hpy188I || BfiI || MaeII || |BtrI || || SetI SetI || || TaiI | MboI Bce83I* || || | BsrI | | DpnI | MseI || || | SduI | | |BseGI | Hin4I || || | BseSI | | |BstKTI | |MnlI || || | | MaeIII TspEI CviRI* \ \ \\ \ \\ \\ \\ \ \ \ \ \ TTAGATCATCCACTTATTATTAAATCCGAGGACGTGCCCAGTAACATTCTCCAATTACTG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AATCTAGTAGGTGAATAATAATTTAGGCTCCTGCACGGGTCATTGTAAGAGGTTAATGAC /// / / / / / / // // / / / / ||| MboI | | | | | || || BsrI MaeIII | CviRI* ||DpnI | | | | | || |MaeII TspEI |BstKTI | | | | | || |BseSI |BseGI | | | | | || |SduI DdeI | | | | | || BtrI | | | | | |TaiI | | | | | |SetI | | | | | |BfiI | | | | | SecI* | | | | Hpy188I | | | MseI | | MnlI | Hin4I Bce83I* L D H P L I I K S E D V P S N I L Q L L * I I H L L L N P R T C P V T F S N Y C R S S T Y Y * I R G R A Q * H S P I T A ----:----|----:----|----:----|----:----|----:----|----:----| K S * G S I I L D S S T G L L M R W N S S L D D V * * * I R P R A W Y C E G I V * I M W K N N F G L V H G T V N E L * Q TfiI HinfI | TaqI | | AcyI | | MaeII | | |ZraI | | ||Hpy99I MslI | | |||SetI |FatI | | |||TaiI |CviRI* | | |||AatII ||CviAII | | |||MboII ||| NlaIII | | ||||MfeI ||| | Hpy178III* | | ||||TspEI ||| | | TspDTI MnlI \ \ \\\\\ \\\ \ \ \ \ CAACAGAAGAATCGACGTCAATTGAAACACATCTGCATGAAATCAAGAAAAGAGTATTTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGTCTTCTTAGCTGCAGTTAACTTTGTGTAGACGTACTTTAGTTCTTTTCTCATAAAA / / // / // // / / / | | |MboII TspEI || |FatI | TspDTI MnlI | | |MaeII MfeI || CviAII Hpy178III* | | |AcyI |CviRI* | | ZraI |NlaIII | AatII MslI | TaqI | TaiI | SetI Hpy99I HinfI TfiI Q Q K N R R Q L K H I C M K S R K E Y F N R R I D V N * N T S A * N Q E K S I F T E E S T S I E T H L H E I K K R V F S ----:----|----:----|----:----|----:----|----:----|----:----| C C F F R R * N F C M Q M F D L F S Y K A V S S D V D I S V C R C S I L F L T N L L L I S T L Q F V D A H F * S F L I K AsuI* |BmgT120I ||BssKI ||CviJI CfrI ||EcoRII | CviJI ||HaeIII | HaeIII ||| ScrFI | | Csp6I ||| BseBI | | |RsaI ||| | BceAI | | || TspEI MaeI ||| | | BstXI MseI | | || | TsoI MaeIII \ \\\ \ \ \ \ \ \ \\ \ \ \ CTACTAGAGGAATATGGGCCAGGATTTTGGGTTAAGTGGCCGTACAATTATTTCAATGGT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GATGATCTCCTTATACCCGGTCCTAAAACCCAATTCACCGGCATGTTAATAAAGTTACCA / // /// / / / / /// / MaeI || ||| BceAI MseI | | ||| TspEI || ||EcoRII | | ||TsoI || ||BssKI | | |Csp6I || |BstXI | | RsaI || BseBI | CfrI || ScrFI HaeIII |AsuI* CviJI BmgT120I HaeIII CviJI L L E E Y G P G F W V K W P Y N Y F N G Y * R N M G Q D F G L S G R T I I S M V T R G I W A R I L G * V A V Q L F Q W L ----:----|----:----|----:----|----:----|----:----|----:----| R S S S Y P G P N Q T L H G Y L * K L P E V L P I H A L I K P * T A T C N N * H * * L F I P W S K P N L P R V I I E I T AluI CviJI AluI SplI* |DdeI CviJI |Csp6I TspGWI |EspI* | SetI ||RsaI MaeIII | Tsp4CI* ||SetI \ \ \\\ \ \ \ \\\ TACAGCTTACCAGAAAGGCGTACGGAAGTTGTAACGACAGTTGAAAGAGAAAGAGCTAAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTCGAATGGTCTTTCCGCATGCCTTCAACATTGCTGTCAACTTTCTCTTTCTCGATTC / / /// / / / / / | CviJI ||SplI* | Tsp4CI* | | EspI* | AluI |Csp6I TspGWI | | DdeI MaeIII RsaI MaeIII | CviJI SetI | AluI SetI Y S L P E R R T E V V T T V E R E R A K T A Y Q K G V R K L * R Q L K E K E L S Q L T R K A Y G S C N D S * K R K S * A ----:----|----:----|----:----|----:----|----:----|----:----| * L K G S L R V S T T V V T S L S L A L N C S V L F A Y P L Q L S L Q F L F L * V A * W F P T R F N Y R C N F S F S S L FatI |CviAII || NlaIII || | TspEI || | | FalI || | | FalI || | | | ApoI || | | | TspEI || | | | | BslFI || | | | | |MseI || | | | | ||AhaIII* AclI || | | | | |||MboII MaeII || | | | | |||TspDTI | MseI || | | | | |||| AluI | SetI || | | | | |||| CviJI | TaiI || | | | | |||| | SetI Hpy188I \ \ \\ \ \ \ \ \\\\ \ \ \ CGTGAAACGTTAAAAACATGGGACGAATTGAAATTTAAAGAGCTTCTTCATTTATGGTCA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GCACTTTGCAATTTTTGTACCCTGCTTAACTTTAAATTTCTCGAAGAAGTAAATACCAGT / / / / // / / //// / / / / | | | | || FalI TspEI |||| | CviJI | Hpy188I | | | | || FalI |||| | AluI FalI | | | | |FatI |||| SetI FalI | | | | CviAII |||BslFI | | | NlaIII ||MseI | | MseI |AhaIII* | MaeII |MboII | AclI TspDTI TaiI TspEI SetI ApoI R E T L K T W D E L K F K E L L H L W S V K R * K H G T N * N L K S F F I Y G Q * N V K N M G R I E I * R A S S F M V R ----:----|----:----|----:----|----:----|----:----|----:----| R S V N F V H S S N F N L S S R * K H D A H F T L F M P R I S I * L A E E N I T T F R * F C P V F Q F K F L K K M * P * StyI SecI* | MboII | |CviJI | ||BsiI* | |||SduI MseI | |||HgiJII* SetI | |||| HindIII | Bce83I* | |||| | AluI | | BsiYI* | |||| | CviJI | | | BsrI | |||| | Hin4II* | | | | BsaBI FalI | |||| | |SmlI | | | | |TfiI FalI | |||| | ||SetI | | | | |HinfI \ \ \\\\ \ \\\ \ \ \ \ \\ GAAGAACCCAAGGGCTCGTGTAAGCTTGAGAAGGACAAAGACCTTAAACTGGATATGAAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTGGGTTCCCGAGCACATTCGAACTCTTCCTGTTTCTGGAATTTGACCTATACTTA / / / /// / / / /// / / / | | | ||| | SmlI | ||MseI BsrI | HinfI | | | ||| HindIII | |BsiYI* | TfiI | | | ||CviJI | Bce83I* BsaBI | | | ||AluI SetI | | | |Hin4II* | | | SetI | | BsiI* | CviJI HgiJII* MboII SecI* StyI SduI E E P K G S C K L E K D K D L K L D M N K N P R A R V S L R R T K T L N W I * I R T Q G L V * A * E G Q R P * T G Y E S ----:----|----:----|----:----|----:----|----:----|----:----| S S G L P E H L S S F S L S R L S S I F L L V W P S T Y A Q S P C L G * V P Y S F F G L A R T L K L L V F V K F Q I H I TspDTI |TspEI TatI TfiI || MseI |Csp6I TspDTI HinfI || VspI Hpy188I ||RsaI \ \ \\ \ \ \\\ CCCCCAGATATGAAAGGCGAATCAAAAATTAATGACTACTATTCAGACCCTAAAGAGTAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GGGGGTCTATACTTTCCGCTTAGTTTTTAATTACTGATGATAAGTCTGGGATTTCTCATG / // // / /// TspDTI |TspDTI |VspI Hpy188I ||TatI HinfI |MseI |Csp6I TfiI TspEI RsaI P P D M K G E S K I N D Y Y S D P K E Y P Q I * K A N Q K L M T T I Q T L K S T P R Y E R R I K N * * L L F R P * R V H ----:----|----:----|----:----|----:----|----:----|----:----| G G S I F P S D F I L S * * E S G L S Y D G L Y S L R I L F * H S S N L G * L T G W I H F A F * F N I V V I * V R F L V SfaNI MnlI \ \ ATAGAAAGTAAGTATTATGATGCTCTTTTTTCCATACATACGCCTCTCGCATATTTCGTC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TATCTTTCATTCATAATACTACGAGAAAAAAGGTATGTATGCGGAGAGCGTATAAAGCAG / / SfaNI MnlI I E S K Y Y D A L F S I H T P L A Y F V * K V S I M M L F F P Y I R L S H I S S R K * V L * C S F F H T Y A S R I F R Q ----:----|----:----|----:----|----:----|----:----|----:----| M S L L Y * S A R K E M C V G R A Y K T C L F Y T N H H E K K W V Y A E R M N R Y F T L I I I S K K G Y M R R E C I E D MaeIII Tsp45I BspMI | MaeIII ApoI | Csp6I | Tsp4CI* TspEI CviJI SetI | |RsaI | | TspGWI \ \ \ \ \\ \ \ \ AAGTCAAATTTAGTAAGGCTCAAAAATACCTGCCGAACCAAGTACGGAAGTGACAGTTAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTCAGTTTAAATCATTCCGAGTTTTTATGGACGGCTTGGTTCATGCCTTCACTGTCAATG / / / / // / / / TspEI CviJI SetI | |Csp6I | | MaeIII ApoI | RsaI | TspGWI BspMI Tsp4CI* Tsp45I MaeIII K S N L V R L K N T C R T K Y G S D S Y S Q I * * G S K I P A E P S T E V T V T V K F S K A Q K Y L P N Q V R K * Q L Q ----:----|----:----|----:----|----:----|----:----|----:----| L D F K T L S L F V Q R V L Y P L S L * * T L N L L A * F Y R G F W T R F H C N L * I * Y P E F I G A S G L V S T V T V MwoI | CviJI | |FatI | ||CviAII | ||| TseI | ||| NlaIII MfeI | ||| |BisI TspEI | ||| ||BlsI | TatI | ||| |||CviRI* | Bsp1407I | ||| ||||MboII | |Csp6I CviJI | ||| ||||| ApoI | ||RsaI |BbvI | ||| ||||| TspEI | ||| TspEI \\ \ \\\ \\\\\ \ \ \\\ \ AAAATAGCCTATCAAGCCATGCTGCAAAAATTTCTTCTCTCAATTGTACAATTCAAAGAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTATCGGATAGTTCGGTACGACGTTTTTAAAGAAGAGAGTTAACATGTTAAGTTTCTA / / / // ///// / / /// / | | | || ||||CviRI* TspEI | ||| TspEI | | | || ||||MboII ApoI | ||Bsp1407I | | | || ||||TseI | ||TatI | | | || |||BisI | |Csp6I | | | || ||BlsI | RsaI | | | || |FatI TspEI | | | || CviAII MfeI | | | |NlaIII | | | CviJI | | BbvI | MwoI CviJI K I A Y Q A M L Q K F L L S I V Q F K D K * P I K P C C K N F F S Q L Y N S K I N S L S S H A A K I S S L N C T I Q R * ----:----|----:----|----:----|----:----|----:----|----:----| L I A * * A M S C F N R R E I T C N L S C F L R D L W A A F I E E R L Q V I * L F Y G I L G H Q L F K K E * N Y L E F I BslFI | CviJI FatI | | SduI |CviAII | | HgiJII* || NlaIII CviJI | | | MaeI \\ \ \ \ \ \ \ AGACATGATAACAGGCTTTTATTAGAGCCCTTTTCTAGTCCCATAGCAGATGAAAAAAGG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTACTATTGTCCGAAAATAATCTCGGGAAAAGATCAGGGTATCGTCTACTTTTTTCC / // / / / / | |FatI CviJI | CviJI MaeI | CviAII | BslFI NlaIII HgiJII* SduI R H D N R L L L E P F S S P I A D E K R D M I T G F Y * S P F L V P * Q M K K G T * * Q A F I R A L F * S H S R * K K E ----:----|----:----|----:----|----:----|----:----|----:----| L C S L L S K N S G K E L G M A S S F L Y V H Y C A K I L A R K * D W L L H F F S M I V P K * * L G K R T G Y C I F F P TspDTI | Tsp4CI* AluI | | MboII CviJI | | |BsmAI TspDTI | | || ApoI | SetI | | || TspEI | | BsrDI \ \ \\ \ \ \ \ AAGAACTGTCTCACAAAATTTGTTATCCAAGATGAAAACAAAAACAGCTCAACCATTGCT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTGACAGAGTGTTTTAAACAATAGGTTCTACTTTTGTTTTTGTCGAGTTGGTAACGA / / / / / / / / | | MboII | TspEI | | BsrDI | Tsp4CI* | ApoI | CviJI TspDTI BsmAI | AluI TspDTI SetI K N C L T K F V I Q D E N K N S S T I A R T V S Q N L L S K M K T K T A Q P L L E L S H K I C Y P R * K Q K Q L N H C * ----:----|----:----|----:----|----:----|----:----|----:----| F F Q R V F N T I W S S F L F L E V M A S S S D * L I Q * G L H F C F C S L W Q L V T E C F K N D L I F V F V A * G N S AciI AluI | FnuDII* CviJI MseI | | FauI | SetI SspI \ \ \ \ \ \ \ GATTTATGTGTTGTATTAAAATCCCGCGAAATAAAGCTACAAATATTATTGCTATTAGAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAATACACAACATAATTTTAGGGCGCTTTATTTCGATGTTTATAATAACGATAATCTC / / // / / MseI | || CviJI SspI | || AluI | |SetI | FauI FnuDII* AciI D L C V V L K S R E I K L Q I L L L L E I Y V L Y * N P A K * S Y K Y Y C Y * R F M C C I K I P R N K A T N I I A I R D ----:----|----:----|----:----|----:----|----:----|----:----| S K H T T N F D R S I F S C I N N S N S Q N I H Q I L I G R F L A V F I I A I L I * T N Y * F G A F Y L * L Y * Q * * L ApoI TspEI TspEI | MseI \ \ \ ATAATAGGATTGAACGATTTAGATTGGAATTTTAGAGATTTTGAGAAAAAGTATAAATTA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TATTATCCTAACTTGCTAAATCTAACCTTAAAATCTCTAAAACTCTTTTTCATATTTAAT / // TspEI |MseI ApoI TspEI I I G L N D L D W N F R D F E K K Y K L * * D * T I * I G I L E I L R K S I N * N R I E R F R L E F * R F * E K V * I K ----:----|----:----|----:----|----:----|----:----|----:----| I I P N F S K S Q F K L S K S F F Y L N S L L I S R N L N S N * L N Q S F T Y I Y Y S Q V I * I P I K S I K L F L I F * MboI TaqI | DpnI | Hpy99I | |BstKTI | | MboI | || MboII | | | DpnI | || | MseI | | | |TaqI TspEI | || | |TspEI | | | |BstKTI \ \ \\ \ \\ \ \ \ \\ AAATTGAAGAAAAGATCACTTAATTTGACAAAAAAGGGATTAGTTCGTCGAAGATCGAAG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAACTTCTTTTCTAGTGAATTAAACTGTTTTTTCCCTAATCAAGCAGCTTCTAGCTTC / // / / / / / // // TspEI || | | TspEI | | || |TaqI || | MseI | | || MboI || MboII | | |DpnI || MboI | | BstKTI |DpnI | TaqI BstKTI Hpy99I K L K K R S L N L T K K G L V R R R S K N * R K D H L I * Q K R D * F V E D R R I E E K I T * F D K K G I S S S K I E E ----:----|----:----|----:----|----:----|----:----|----:----| F N F F L D S L K V F F P N T R R L D F L I S S F I V * N S L F P I L E D F I S F Q L F S * K I Q C F L S * N T S S R L TfiI HinfI | TaqI MboII MboII | |Hpy178III* \ \ \ \\ AAAAAAACCAGCGAAAAAGACAAAGGAATCGAGAGAATAACAACATCTTTGGATTATTGT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTTTGGTCGCTTTTTCTGTTTCCTTAGCTCTCTTATTGTTGTAGAAACCTAATAACA / / / // MboII MboII | |Hpy178III* | TaqI HinfI TfiI K K T S E K D K G I E R I T T S L D Y C K K P A K K T K E S R E * Q H L W I I V K N Q R K R Q R N R E N N N I F G L L * ----:----|----:----|----:----|----:----|----:----|----:----| F F V L S F S L P I S L I V V D K S * Q S F F W R F L C L F R S F L L M K P N N F F G A F F V F S D L S Y C C R Q I I T FatI |CviAII ||Cac8I ||| SphI TatI ||| NspI |Csp6I ||| CviRI* ||RsaI ||| NlaIII Hpy166II |||Hin4I ||| | EcoT22I | Tsp4CI* ||||DdeI ||| | | SfaNI Hin4I \ \ \\\\\ \\\ \ \ \ \ GAACAGTTAGACTTGTACTTAGATAGAGCATGCATCTTGGACATTCTACTATCAAGTGAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGTCAATCTGAACATGAATCTATCTCGTACGTAGAACCTGTAAGATGATAGTTCACTT / / / /// / / /// // | Tsp4CI* | ||| DdeI | ||CviRI* |SfaNI Hpy166II | ||TatI | ||FatI Hin4I | |Csp6I | |CviAII | RsaI | EcoT22I Hin4I | Cac8I NlaIII NspI SphI E Q L D L Y L D R A C I L D I L L S S E N S * T C T * I E H A S W T F Y Y Q V K T V R L V L R * S M H L G H S T I K * N ----:----|----:----|----:----|----:----|----:----|----:----| S C N S K Y K S L A H M K S M R S D L S H V T L S T S L Y L M C R P C E V I L H F L * V Q V * I S C A D Q V N * * * T F SfaNI MwoI SfaNI \ \ \ ACGCCCAACCCAGATGCCATAGAAGCATCAAATGGAACAATACAAGAGCATAAAAAAAAT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGCGGGTTGGGTCTACGGTATCTTCGTAGTTTACCTTGTTATGTTCTCGTATTTTTTTTA / / / SfaNI MwoI SfaNI T P N P D A I E A S N G T I Q E H K K N R P T Q M P * K H Q M E Q Y K S I K K I A Q P R C H R S I K W N N T R A * K K Y ----:----|----:----|----:----|----:----|----:----|----:----| V G L G S A M S A D F P V I C S C L F F F A W G L H W L L M L H F L V L A Y F F R G V W I G Y F C * I S C Y L L M F F I CviJI | TspDTI MaeI | | MnlI TspEI \ \ \ \ \ ATCCTAGACAAAAGCAAAGAAGCCTCATTGGTTGGGTTCATAAATTATGTTCTTATTCCA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGATCTGTTTTCGTTTCTTCGGAGTAACCAACCCAAGTATTTAATACAAGAATAAGGT / / / / / MaeI | TspDTI MnlI TspEI CviJI I L D K S K E A S L V G F I N Y V L I P S * T K A K K P H W L G S * I M F L F H P R Q K Q R S L I G W V H K L C S Y S I ----:----|----:----|----:----|----:----|----:----|----:----| I R S L L L S A E N T P N M F * T R I G Y G L C F C L L R M P Q T * L N H E * E D * V F A F F G * Q N P E Y I I N K N W BceAI | Acc65I | HgiCI* AsuI* | |Csp6I ApoI AvaII | ||RsaI TspEI AluI |NlaIV | ||SetI | Bce83I* CviJI |BmgT120I | ||NlaIV | | PsiI |SmlI || BsmAI | ||| KpnI | | |TspEI ||SetI || Eco31I \ \\\ \ \ \ \\ \\\ \\ \ TATTTCAACAAAAAGGTACCACACGCCGTTGAATTTATAATTCAAAAGCTCAAGGGACCA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAAGTTGTTTTTCCATGGTGTGCGGCAACTTAAATATTAAGTTTTCGAGTTCCCTGGT // / /// / / / / / / / /// || | ||HgiCI* | | PsiI | | | | ||AvaII || | ||Acc65I | TspEI | | | | ||AsuI* || | |Csp6I | ApoI | | | | |BmgT120I || | NlaIV Bce83I* | | | | NlaIV || | RsaI | | | SmlI || KpnI | | CviJI |SetI | | AluI BceAI | SetI TspEI Y F N K K V P H A V E F I I Q K L K G P I S T K R Y H T P L N L * F K S S R D Q F Q Q K G T T R R * I Y N S K A Q G T K ----:----|----:----|----:----|----:----|----:----|----:----| Y K L L F T G C A T S N I I * F S L P G M N * C F P V V R R Q I * L E F A * P V I E V F L Y W V G N F K Y N L L E L S W CviJI | SduI | HgiJII* FatI | | EcoNI |CviAII | | | BsiYI* || NlaIII | | | | BaeI || | BslFI | | | | SetI BdaI || | | BdaI | | | | |HindII BdaI MaeIII || | | BdaI | | | | |Hpy166II |HphI Tsp45I SetI \\ \ \ \ \ \ \ \ \\ \\ \ \ AGCATGAGACCAAAGAGAGCCCTGAAAAAGGTCAACGATAGCACAAATGTATCGTCACCT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTACTCTGGTTTCTCTCGGGACTTTTTCCAGTTGCTATCGTGTTTACATAGCAGTGGA / /// / / / / / /// / / / / / / | ||| | | | | | ||SetI Hpy166II | HphI | | BaeI | ||| | | | | | |BaeI HindII BdaI | Tsp45I | ||| | | | | | EcoNI BdaI | MaeIII | ||| | | | | BsiYI* SetI | ||| | | | CviJI | ||| | | HgiJII* | ||| | | SduI | ||| | BslFI | ||| BdaI | ||| BdaI | ||FatI | |CviAII | Eco31I | BsmAI NlaIII S M R P K R A L K K V N D S T N V S S P A * D Q R E P * K R S T I A Q M Y R H L H E T K E S P E K G Q R * H K C I V T * ----:----|----:----|----:----|----:----|----:----|----:----| L M L G F L A R F F T L S L V F T D D G L C S V L S L G S F P * R Y C L H I T V A H S W L S G Q F L D V I A C I Y R * R BsiI* | HinfI | | HindII | | Hpy166II BaeI | | | MaeII SfeI* | | | | PleI MnlI |Tsp4CI* | | | | |SetI |BslFI || MaeII | | | | |TaiI || SapI || | SetI | | | | |MlyI || TspGWI || | TaiI SetI | | | | || MboII || Ksp632I* \\ \ \ \ \ \ \ \ \\ \ \\ \ AATACTGTAGAAACGTATAACAGGTTATCCACGAGTCAACGTGCCTCTCGCTCTTCAATC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGACATCTTTGCATATTGTCCAATAGGTGCTCAGTTGCACGGAGAGCGAGAAGTTAG / / / / / / /// /// / / // | | | MaeII SetI | ||| ||MboII | | |Ksp632I* | | TaiI | ||| |PleI | | |SapI | | SetI | ||| |MlyI | | BslFI | SfeI* | ||| MaeII | TspGWI Tsp4CI* | ||TaiI MnlI | ||SetI | |Hpy166II | |HindII | HinfI BsiI* N T V E T Y N R L S T S Q R A S R S S I I L * K R I T G Y P R V N V P L A L Q S Y C R N V * Q V I H E S T C L S L F N H ----:----|----:----|----:----|----:----|----:----|----:----| L V T S V Y L L N D V L * R A E R E E I * Y Q L F T Y C T I W S D V H R E S K L I S Y F R I V P * G R T L T G R A R * D MseI VspI BccI |TspEI | AciI Hpy166II || MboII | | Hin4II* | TspEI || | HphI | | | FauI | | HgaI \\ \ \ \ \ \ \ \ \ \ ATTAATTCCGTCCCATCTTCACCCGCATTGAGAAGGGTGGACGCTAATTTGTTCAGCAGA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TAATTAAGGCAGGGTAGAAGTGGGCGTAACTCTTCCCACCTGCGATTAAACAAGTCGTCT / / / / / / / / / | | HphI | | FauI Hpy166II | HgaI | TspEI | Hin4II* TspEI | MboII | AciI VspI BccI MseI I N S V P S S P A L R R V D A N L F S R L I P S H L H P H * E G W T L I C S A E * F R P I F T R I E K G G R * F V Q Q K ----:----|----:----|----:----|----:----|----:----|----:----| M L E T G D E G A N L L T S A L K N L L * * N R G M K V R M S F P P R * N T * C N I G D W R * G C Q S P H V S I Q E A S ApoI TspEI SfeI* EcoRI | AluI | XbaI | CviJI | |MaeI | | SetI EcoP15I | |Hpy178III* \ \ \ \ \ \\ AAATCTATAGCTTCGCCCACCCCTGAACTTTTGAATTCTAGAACGAACTCTAACTTGAAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGATATCGAAGCGGGTGGGGACTTGAAAACTTAAGATCTTGCTTGAGATTGAACTTA /// / / // ||CviJI EcoP15I | |XbaI ||AluI | Hpy178III* |SfeI* | MaeI SetI EcoRI TspEI ApoI K S I A S P T P E L L N S R T N S N L N N L * L R P P L N F * I L E R T L T * M I Y S F A H P * T F E F * N E L * L E * ----:----|----:----|----:----|----:----|----:----|----:----| F D I A E G V G S S K F E L V F E L K F F I * L K A W G Q V K S N * F S S * S S F R Y S R G G R F K Q I R S R V R V Q I Hpy178III* | TspDTI | | MaeI | | | HindIII | | | | AluI | | | | CviJI | | | | | MseI | | | | | SetI | | | | | | MwoI | | | | | | |Hin6I MfeI | | | | | | ||GlaI TspEI ApoI | | | | | | |||HhaI |Hin4II* TspEI |TaqI | | | | | ||||HaeII || Hin4II* Tth111I \ \\ \ \ \ \ \ \\\\\ \\ \ \ GAATTTCTCGAAAGTGAAACTAGAAGCTTAAAGCGCCCTTCACAATTGGGAAGGACGAAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAAAGAGCTTTCACTTTGATCTTCGAATTTCGCGGGAAGTGTTAACCCTTCCTGCTTC / // / / / / /// //// / // / | || TspDTI | | | ||| |||Hin6I | |TspEI Tth111I | |TaqI | | | ||| ||GlaI | |MfeI | Hpy178III* | | | ||| |HhaI | Hin4II* TspEI | | | ||| HaeII Hin4II* ApoI | | | ||MseI | | | |MwoI | | | HindIII | | CviJI | | AluI | SetI MaeI E F L E S E T R S L K R P S Q L G R T K N F S K V K L E A * S A L H N W E G R S I S R K * N * K L K A P F T I G K D E V ----:----|----:----|----:----|----:----|----:----|----:----| S N R S L S V L L K F R G E C N P L V F H I E R F H F * F S L A G K V I P F S S F K E F T F S S A * L A R * L Q S P R L BceAI | BsmAI | Hpy188I MboI | | BaeI Hpy188I | | |SmlI | DpnI TfiI | | |AflII | |BstKTI HinfI TspDTI | | ||MseI \ \\ \ \ \ \ \\\ TCTGATCTAACGATGAATCATTTACAAAAACGGCAGTTTTCTGTCTCTGACTTAAGCACA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| AGACTAGATTGCTACTTAGTAAATGTTTTTGCCGTCAAAAGACAGAGACTGAATTCGTGT / // / / / / // / // | || MboI HinfI TspDTI | || | |AflII | |DpnI TfiI | || | |SmlI | BstKTI | || | MseI Hpy188I | || BsmAI | |BceAI | Hpy188I BaeI S D L T M N H L Q K R Q F S V S D L S T L I * R * I I Y K N G S F L S L T * A Q * S N D E S F T K T A V F C L * L K H N ----:----|----:----|----:----|----:----|----:----|----:----| D S R V I F * K C F R C N E T E S K L V T Q D L S S D N V F V A T K Q R Q S L C R I * R H I M * L F P L K R D R V * A C TspDTI | Csp6I | |RsaI | || ApoI | || TspEI MseI | || EcoRI BaeI MwoI VspI \ \\ \ \ \ \ ACAAGAGTACCGAATTCATCAACTATCACACTCAAAACGCCTTTCTCGCACTCAACTATT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCTCATGGCTTAAGTAGTTGATAGTGTGAGTTTTGCGGAAAGAGCGTGAGTTGATAA / // / / / | |Csp6I | BaeI MwoI | RsaI EcoRI TspDTI TspEI ApoI T R V P N S S T I T L K T P F S H S T I Q E Y R I H Q L S H S K R L S R T Q L L K S T E F I N Y H T Q N A F L A L N Y * ----:----|----:----|----:----|----:----|----:----|----:----| V L T G F E D V I V S L V G K E C E V I L L L V S N M L * * V * F A K R A S L * C S Y R I * * S D C E F R R E R V * S N MaeII CviRI* | SetI | EcoT22I TspDTI | TaiI EcoRV \ \ \ \ \ \ AATGCATACAAAACTATGAATAACTCTTTTCGCAGAGTTGGGAAACGTAAAGATATCAAT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGTATGTTTTGATACTTATTGAGAAAAGCGTCTCAACCCTTTGCATTTCTATAGTTA // / / / / / || CviRI* TspDTI | MaeII EcoRV |EcoT22I TaiI VspI SetI MseI N A Y K T M N N S F R R V G K R K D I N M H T K L * I T L F A E L G N V K I S M C I Q N Y E * L F S Q S W E T * R Y Q * ----:----|----:----|----:----|----:----|----:----|----:----| L A Y L V I F L E K R L T P F R L S I L * H M C F * S Y S K E C L Q S V Y L Y * I C V F S H I V R K A S N P F T F I D I TspDTI |FatI ||CviAII ||| NlaIII ||| |MslI ||| ||MaeII ||| ||AflIII ||| |||MlyI ||| |||PleI ||| ||||BseMII ||| |||||SetI ||| |||||TaiI ||| |||||BspCNI ||| |||||| AccI ||| |||||| |MnlI ||| |||||| |Hpy166II ||| |||||| ||HinfI ||| |||||| ||| DdeI ||| |||||| ||| TspDTI ||| |||||| ||| |Hpy188I ||| |||||| ||| ||EcoP15I ||| |||||| ||| ||| MaeII ||| |||||| ||| ||| | Csp6I ||| |||||| ||| ||| | |RsaI ||| |||||| ||| ||| | |SetI ||| |||||| ||| ||| | |TaiI CviJI \\\ \\\\\\ \\\ \\\ \ \\ \ GAAACGATACGCCTACATGAACGTGTAGACTCTGAGGAAAACGTACAAGTTCAAGCCACT 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGCTATGCGGATGTACTTGCACATCTGAGACTCCTTTTGCATGTTCAAGTTCGGTGA / / ////// //// /// // / /// / / | | |||||| |||| ||| || | ||Csp6I | MwoI | | |||||| |||| ||| || | |RsaI CviJI | | |||||| |||| ||| || | MaeII | | |||||| |||| ||| || TaiI | | |||||| |||| ||| || SetI | | |||||| |||| ||| |EcoP15I | | |||||| |||| ||| DdeI | | |||||| |||| ||Hpy188I | | |||||| |||| |HinfI | | |||||| |||| TspDTI | | |||||| |||AccI | | |||||| ||Hpy166II | | |||||| |MnlI | | |||||| AflIII | | |||||MaeII | | |||||PleI | | ||||BspCNI | | ||||MlyI | | |||BseMII | | ||MslI | | ||TaiI | | ||SetI | | |FatI | | CviAII | NlaIII TspDTI E T I R L H E R V D S E E N V Q V Q A T K R Y A Y M N V * T L R K T Y K F K P L N D T P T * T C R L * G K R T S S S H S ----:----|----:----|----:----|----:----|----:----|----:----| S V I R R C S R T S E S S F T C T * A V H F S V G V H V H L S Q P F R V L E L W F R Y A * M F T Y V R L F V Y L N L G S MaeIII Hin6I Tsp45I |GlaI MwoI Tsp4CI* SetI ||HhaI \ \ \ \\\ CCTGCTGTGAAAAAAAGAACTGTGACACCTAATAAAAAGGCGCAACTTCAAAGCATCATT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| GGACGACACTTTTTTTCTTGACACTGTGGATTATTTTTCCGCGTTGAAGTTTCGTAGTAA / / /// | Tsp45I ||Hin6I | MaeIII |GlaI | SetI HhaI Tsp4CI* P A V K K R T V T P N K K A Q L Q S I I L L * K K E L * H L I K R R N F K A S L C C E K K N C D T * * K G A T S K H H * ----:----|----:----|----:----|----:----|----:----|----:----| G A T F F L V T V G L L F A C S * L M M E Q Q S F F F Q S V * Y F P A V E F C * R S H F F S S H C R I F L R L K L A D N TfiI HinfI |SfaNI || AciI BseGI || BisI | Hin4II* || |BlsI | | FatI || ||TauI | | |FokI TspDTI || ||| ApoI | | |CviAII | BsaXI || ||| TspEI | | || NlaIII | |SetI SspI \\ \\\ \ \ \ \\ \ \ \\ \ GAATCGCCGCTAAATTTCAAGGATGATGATACGCATGAAGGCAGAAAAAATACCTCCAAT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CTTAGCGGCGATTTAAAGTTCCTACTACTATGCGTACTTCCGTCTTTTTTATGGAGGTTA / //// / / / / /// / / / | |||AciI TspEI | | | ||FokI | BsaXI SspI | ||BisI ApoI | | | |FatI | SetI | |BlsI | | | CviAII TspDTI | SfaNI | | NlaIII | TauI | Hin4II* HinfI BseGI TfiI E S P L N F K D D D T H E G R K N T S N N R R * I S R M M I R M K A E K I P P I I A A K F Q G * * Y A * R Q K K Y L Q Y ----:----|----:----|----:----|----:----|----:----|----:----| S D G S F K L S S S V C S P L F F V E L Q I A A L N * P H H Y A H L C F F Y R W F R R * I E L I I I R M F A S F I G G I CviJI BsaXI | BssKI | SecI* | | HpaII AluI GsuI MnlI | | ScrFI CviJI Eco57MI | SetI MnlI | | CauII* | SetI | MaeII \ \ \ \ \ \ \ \ \ \ ATTACCTCTACTCCCACTAATAAGCCCCCGGAAAATAGCTCAAAAAGGAGAGTAAGAAGA 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TAATGGAGATGAGGGTGATTATTCGGGGGCCTTTTATCGAGTTTTTCCTCTCATTCTTCT // / / / /// / / / / |SetI MnlI | | ||| | CviJI | TaiI MnlI | | ||| | AluI | SetI | | ||| SetI Eco57MI | | ||BssKI GsuI | | |SecI* | | |HpaII | | CauII* | | ScrFI | CviJI BsaXI I T S T P T N K P P E N S S K R R V R R L P L L P L I S P R K I A Q K G E * E D Y L Y S H * * A P G K * L K K E S K K T ----:----|----:----|----:----|----:----|----:----|----:----| I V E V G V L L G G S F L E F L L T L L Y * R * E W * Y A G P F Y S L F S L L F N G R S G S I L G R F I A * F P S Y S S SetI TaiI BbvII* | MboII | | Hpy178III* | | | TfiI | | | HinfI \ \ \ \ CGTTTATTTGCTCCAGAATCCACATAG 1990 2000 ----:----|----:----|----:-- GCAAATAAACGAGGTCTTAGGTGTATC / / / / | BbvII* | HinfI | MboII | TfiI MaeII Hpy178III* R L F A P E S T * V Y L L Q N P H X F I C S R I H I X ----:----|----:----|----:-- R K N A G S D V Y V N I Q E L I W M T * K S W F G C L # Enzymes that cut Frequency Isoschizomers AatII 1 Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 3 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 1 AhaIII* 1 DraI AluI 11 AluBI ApoI 10 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 2 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 1 Bce83I* 3 BpuEI BceAI 3 BdaI 2 BfiI 1 BmrI,BmuI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 2 BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 1 BseSI 1 BaeGI,BstSLI BsiI* 2 BssSI,Bst2BI,BauI BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 4 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 4 BstXI 1 BtrI 1 BmgBI,AjiI Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI Csp6I 9 CviQI,RsaNI CviAII 9 CviJI 24 CviKI-1 CviRI* 5 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 4 MalI Eco31I 1 Bso31I,BspTNI,BsaI Eco57MI 1 EcoNI 1 BstENI,XagI EcoP15I 2 EcoRI 2 EcoRII 1 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 2 Mph1103I,NsiI,Zsp2I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 2 FatI 9 FauI 2 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 2 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 3 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 3 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 5 HpyAV Hin6I 2 HinP1I,HspAI HindII 2 HincII HindIII 2 HinfI 9 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 6 Hpy99I 2 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 9 HpyCH4IV MaeIII 7 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 11 MfeI 3 MunI MlyI 2 SchI MnlI 8 MseI 13 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NlaIII 9 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI PleI 2 PpsI PsiI 1 AanI RsaI 9 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 4 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 29 SfaNI 6 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 4 SmoI SphI 1 PaeI,BbuI SplI* 1 Pfl23II,PspLI,BsiWI SspI 2 StuI 1 Eco147I,PceI,SseBI,AatI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 9 TaqI 5 TatI 3 TauI 1 TfiI 7 PfeI TseI 1 ApeKI TsoI 1 Tsp45I 3 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 14 TspEI 25 TasI,Tsp509I,Sse9I TspGWI 3 Tth111I 1 PflFI,PsyI,AspI VspI 3 PshBI,AseI XbaI 1 ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI AgeI AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuII AvaI AvrII BalI BamHI BarI BbvCI BcgI BciVI BclI BetI* BglI BglII BinI* BmeT110I BmtI BplI Bpu10I BsaAI BsePI BseRI BseYI BsgI BsmI Bsp120I BspHI BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstZ17I BtgZI BtsI Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco47III Eco57I EcoICRI EgeI EheI Esp3I FseI FspAI GsaI HgiAI* HpaI KasI MauBI McrI* MluI MmeI MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SrfI Sse232I* Sse8387I SwaI TaqII TspMI TspRI TstI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769