Restriction Map of SEH1/YGL100W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SEH1/YGL100W on chromosome VII from coordinates 313234 to 314283.


FatI FatI BspHI |CviAII |CviAII BdaI BdaI || TspDTI |Hpy178III* BdaI CviRI* BdaI || NlaIII || NlaIII | TstI \ \ \\ \ \\ \ \ \ ATGCAACCATTTGATAGTGGGCATGATGATTTAGTTCATGATGTCGTTTATGACTTTTAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTGGTAAACTATCACCCGTACTACTAAATCAAGTACTACAGCAAATACTGAAAATG / / / /// / // / CviRI* BdaI | ||FatI | |BspHI BdaI BdaI | |CviAII | |FatI BdaI | TspDTI | | TstI NlaIII | Hpy178III* | CviAII NlaIII M Q P F D S G H D D L V H D V V Y D F Y C N H L I V G M M I * F M M S F M T F T A T I * * W A * * F S S * C R L * L L R ----:----|----:----|----:----|----:----|----:----|----:----| X C G N S L P C S S K T * S T T * S K * X A V M Q Y H A H H N L E H H R K H S K H L W K I T P M I I * N M I D N I V K V FatI AflIII BspLU11I* |CviAII || BbvII* || |NspI || |NlaIII || || MboII || || TspGWI || || | FatI || || | |CviAII || || | || NspI || || | || NlaIII || || | || | TstI || || | || | | MboI || || | || | | BclI || || | || | | SapI || || | || | | Hpy188I || || | || | | Ksp632I* MseI || || | || | | | DpnI |AhaIII* || || | || | | | |BstKTI MseI ||TspEI \\ \\ \ \\ \ \ \ \\ \ \\\ GGAAGACATGTGGCAACATGCTCTTCTGATCAACATATTAAAGTTTTTAAATTAGACAAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCTTCTGTACACCGTTGTACGAGAAGACTAGTTGTATAATTTCAAAAATTTAATCTGTTC / // // / // / //// / // / | || || | |TstI | |||BclI MseI || TspEI | || || | |FatI | |||MboI |MseI | || || | CviAII | ||Ksp632I* AhaIII* | || || NlaIII | ||SapI | || || NspI | |DpnI | || |BbvII* | BstKTI | || |MboII Hpy188I | || TspGWI | |BspLU11I* | |AflIII | |FatI | CviAII NlaIII NspI G R H V A T C S S D Q H I K V F K L D K E D M W Q H A L L I N I L K F L N * T R K T C G N M L F * S T Y * S F * I R Q G ----:----|----:----|----:----|----:----|----:----|----:----| P L C T A V H E E S * C I L T K L N S L R F V H P L M S K Q D V Y * L K * I L C S S M H C C A R R I L M N F N K F * V L MlyI PleI DdeI | MaeIII | Tsp45I | | HinfI | | | TspRI | | | |FatI | | | ||CviAII | | | ||| NlaIII | | | ||| BspCNI | | | ||| |BaeI | | | ||| |BseMII | | | ||| || AluI | | | ||| || CviJI | | | ||| || Ecl136II | | | ||| || | SetI | | | ||| || | SduI | | | ||| || | SacI | | | ||| || | HgiAI* CfrI | | | ||| || | HgiJII* | BalI | | | ||| || | |Hpy178III* | CviJI BsiI* TspEI | | | ||| || | || Tsp4CI* | HaeIII \ \ \ \ \ \\\ \\ \ \\ \ \ \ GACACGAGTAATTGGGAACTCAGTGACTCATGGAGAGCTCACGACAGTAGTATCGTGGCC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTGCTCATTAACCCTTGAGTCACTGAGTACCTCTCGAGTGCTGTCATCATAGCACCGG / / /// / // /// / / / / / / BsiI* | ||| DdeI || ||| | | | Tsp4CI* | CfrI | ||PleI || ||| | | Hpy178III* HaeIII | |MlyI || ||| | Ecl136II CviJI | TspRI || ||| | CviJI BalI TspEI || ||| | AluI || ||| HgiJII* || ||| HgiAI* || ||| SacI || ||| SduI || ||| SetI || ||FatI || |BseMII || |CviAII || BspCNI |NlaIII |HinfI |BaeI Tsp45I MaeIII D T S N W E L S D S W R A H D S S I V A T R V I G N S V T H G E L T T V V S W P H E * L G T Q * L M E S S R Q * Y R G H ----:----|----:----|----:----|----:----|----:----|----:----| S V L L Q S S L S E H L A * S L L I T A P C S Y N P V * H S M S L E R C Y Y R P V R T I P F E T V * P S S V V T T D H G PflMI BsiYI* |BaeI || AsuI* || |BmgT120I || ||CviJI || ||HaeIII || ||| Hpy178III* || ||| | PflMI || ||| | BsiYI* || ||| | |Eco57I || ||| | |Eco57MI || ||| | || Hin6I || ||| | || |GlaI || ||| | || ||HhaI SfaNI || |||BsrI | || ||| BsrDI | CviJI MnlI Tsp4CI* \\ \\\\ \ \\ \\\ \ \ \ \ \ ATTGATTGGGCCAGTCCAGAATATGGGCGCATCATTGCTTCAGCCTCTTACGATAAGACG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTAACCCGGTCAGGTCTTATACCCGCGTAGTAACGAAGTCGGAGAATGCTATTCTGC // /// // / //// // / / |BsiYI* ||AsuI* || | |||BsrDI |CviJI MnlI Tsp4CI* |PflMI || || | ||Hin6I SfaNI BaeI || || | |GlaI || || | HhaI || || Eco57MI || || Eco57I || |BsiYI* || |PflMI || Hpy178III* |BmgT120I |HaeIII |CviJI BsrI I D W A S P E Y G R I I A S A S Y D K T L I G P V Q N M G A S L L Q P L T I R R * L G Q S R I W A H H C F S L L R * D G ----:----|----:----|----:----|----:----|----:----|----:----| M S Q A L G S Y P R M M A E A E * S L V W Q N P W D L I H A C * Q K L R K R Y S N I P G T W F I P A D N S * G R V I L R BinI* | MboI | XhoII | | DpnI | | |BstKTI BsmI | | ||Hpy178III* | CfrI | | ||| MboII | |MboII | | ||| | MboII | ||CviJI | | ||| | |BceAI | ||HaeIII AluI TspEI | | ||| | || MmeI | ||| Hpy99I CviJI \ \ \ \\\ \ \\ \ \ \\\ \ \ GTAAAATTATGGGAAGAAGATCCCGACCAAGAAGAATGCTCTGGCCGTCGTTGGAACAAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CATTTTAATACCCTTCTTCTAGGGCTGGTTCTTCTTACGAGACCGGCAGCAACCTTGTTC / / // / / / / / / / /// / / TspEI | || | | | | BceAI | | ||CfrI | CviJI | || | | | MmeI | | |Hpy99I | AluI | || | | MboII | | HaeIII SetI | || | Hpy178III* | | CviJI | || | MboII | MboII | || XhoII BsmI | || MboI | |DpnI | BstKTI BinI* V K L W E E D P D Q E E C S G R R W N K * N Y G K K I P T K K N A L A V V G T S K I M G R R S R P R R M L W P S L E Q A ----:----|----:----|----:----|----:----|----:----|----:----| T F N H S S S G S W S S H E P R R Q F L P L I I P L L D R G L L I S Q G D N S C Y F * P F F I G V L F F A R A T T P V L ApoI TspEI | FalI | FalI | | Hin6I | | |GlaI | | ||HhaI SetI FalI MboI | | ||| Cac8I | Csp6I FalI | DpnI | | ||| | Hin6I | Hpy166II | TfiI | |BstKTI | | ||| | |GlaI | |RsaI | HinfI | || BinI* | | ||| | ||HhaI \ \\ \ \ \ \\ \ \ \ \\\ \ \\\ CTGTGTACCCTGAATGATTCCAAAGGATCACTTTATAGTGTAAAATTTGCGCCAGCGCAT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GACACATGGGACTTACTAAGGTTTCCTAGTGAAATATCACATTTTAAACGCGGTCGCGTA /// / / // / / / / /// / /// ||| FalI HinfI || MboI BinI* FalI | ||| | ||Hin6I ||| FalI TfiI |DpnI FalI | ||| | |GlaI ||Csp6I BstKTI | ||| | HhaI |RsaI | ||| Cac8I Hpy166II | ||Hin6I | |GlaI | HhaI TspEI ApoI L C T L N D S K G S L Y S V K F A P A H C V P * M I P K D H F I V * N L R Q R I V Y P E * F Q R I T L * C K I C A S A F ----:----|----:----|----:----|----:----|----:----|----:----| S H V R F S E L P D S * L T F N A G A C A T Y G S H N W L I V K Y H L I Q A L A Q T G Q I I G F S * K I T Y F K R W R M TfiI HinfI | DdeI | | SfaNI | | |Hpy188I | | || MnlI CviJI AluI | | || | BspCNI | MseI CviJI BccI | | || | |BseMII | | TspEI | SetI MaeIII | | || | || DdeI \ \ \ \ \ \ \ \ \\ \ \\ \ TTGGGCTTAAAATTAGCTTGTTTGGGTAACGATGGAATCCTCAGACTTTATGATGCCTTA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AACCCGAATTTTAATCGAACAAACCCATTGCTACCTTAGGAGTCTGAAATACTACGGAAT / / / / / / / // / / // / / | MseI | CviJI | MaeIII | || | | || | DdeI CviJI | AluI BccI | || | | || Hin4I TspEI | || | | || Hin4I SetI | || | | |BseMII | || | | BspCNI | || | MnlI | || SfaNI | |DdeI | Hpy188I HinfI TfiI L G L K L A C L G N D G I L R L Y D A L W A * N * L V W V T M E S S D F M M P * G L K I S L F G * R W N P Q T L * C L R ----:----|----:----|----:----|----:----|----:----|----:----| K P K F N A Q K P L S P I R L S * S A K N P S L I L K N P Y R H F G * V K H H R Q A * F * S T Q T V I S D E S K I I G * Hin4I Hin4I | SetI | | Hpy188I | | | DdeI | | | SauI* | | | |SetI | | | |Hin4II* | | | ||Eam1105I | | | ||| FatI | | | ||| SetI | | | ||| |CviAII | | | ||| || NlaIII | | | ||| || | BseMII | | | ||| || | |BspCNI | | | ||| || | || TspRI | | | ||| || | || |Hin4I | | | ||| || | || |Hin4I | | | ||| || | || || DdeI | | | ||| || | || || |Hpy188I TspDTI \ \ \ \\\ \\ \ \\ \\ \\ \ GAACCTTCTGACCTAAGGTCATGGACACTGACTTCTGAGATGAAAGTGCTATCTATACCA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTTGGAAGACTGGATTCCAGTACCTGTGACTGAAGACTCTACTTTCACGATAGATATGGT / / / //// / //// / / / / SetI | | |||| | |||| Hin4I | DdeI TspDTI | | |||| | |||| Hin4I Hpy188I | | |||| | |||BspCNI | | |||| | ||BseMII | | |||| | |TspRI | | |||| | |FatI | | |||| | CviAII | | |||| NlaIII | | |||SauI* | | |||DdeI | | ||SetI | | |Eam1105I | | Hin4II* | SetI Hpy188I E P S D L R S W T L T S E M K V L S I P N L L T * G H G H * L L R * K C Y L Y H T F * P K V M D T D F * D E S A I Y T T ----:----|----:----|----:----|----:----|----:----|----:----| S G E S R L D H V S V E S I F T S D I G L V K Q G L T M S V S K Q S S L A I * V F R R V * P * P C Q S R L H F H * R Y W TaqI BsmAI |Hpy178III* Tsp4CI* | BplI || Hin4II* | Hpy188I | BplI || | Hpy178III* \ \ \ \ \\ \ \ CCAGCAAATCATTTACAGTCTGATTTTTGTCTCTCTTGGTGTCCTTCGAGATTTTCTCCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCGTTTAGTAAATGTCAGACTAAAAACAGAGAGAACCACAGGAAGCTCTAAAAGAGGA / / / / // / / | Hpy188I | BsmAI || Hin4II* Hpy178III* Tsp4CI* BplI |Hpy178III* BplI TaqI P A N H L Q S D F C L S W C P S R F S P Q Q I I Y S L I F V S L G V L R D F L L S K S F T V * F L S L L V S F E I F S * ----:----|----:----|----:----|----:----|----:----|----:----| G A F * K C D S K Q R E Q H G E L N E G V L L D N V T Q N K D R K T D K S I K E W C I M * L R I K T E R P T R R S K R R AluI CviJI MwoI | SetI AlwNI | Cac8I BstAPI | | BplI | BsmAI | | BplI | |CviRI* Tsp4CI* \ \ \ \ \\ \ GAAAAGCTCGCAGTCTCTGCATTGGAACAAGCGATTATATACCAAAGGGGTAAAGACGGT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCGAGCGTCAGAGACGTAACCTTGTTCGCTAATATATGGTTTCCCCATTTCTGCCA / / / / / / / | | | | | BsmAI Tsp4CI* | | | | CviRI* | | | BstAPI | | | AlwNI | | | MwoI | | Cac8I | CviJI | BplI | BplI | AluI SetI E K L A V S A L E Q A I I Y Q R G K D G K S S Q S L H W N K R L Y T K G V K T V K A R S L C I G T S D Y I P K G * R R * ----:----|----:----|----:----|----:----|----:----|----:----| S F S A T E A N S C A I I Y W L P L S P Q F A R L R Q M P V L S * I G F P Y L R F L E C D R C Q F L R N Y V L P T F V T Hpy166II | MaeII AluI | | SetI BseYI | | TaiI BssKI CviJI | | | TseI |BbvI PvuII | | | CviRI* ||HpaII NspBII* | | | |BisI ||ScrFI | SetI | | | ||BlsI ||CauII* MseI | | GsaI \ \ \ \\\ \\\ \ \ \ \ AAACTTCACGTTGCAGCAAAACTTCCCGGTCATAAAAGTTTAATAAGAAGTATCAGCTGG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGAAGTGCAACGTCGTTTTGAAGGGCCAGTATTTTCAAATTATTCTTCATAGTCGACC / / / //// /// / / / // | | | |||TseI ||BssKI MseI | | |BseYI | | | ||BisI ||BbvI | | HgiJII* | | | |BlsI |HpaII | | SduI | | | CviRI* CauII* | NspBII* | | MaeII ScrFI | PvuII | TaiI | CviJI | SetI | AluI Hpy166II | GsaI SetI K L H V A A K L P G H K S L I R S I S W N F T L Q Q N F P V I K V * * E V S A G T S R C S K T S R S * K F N K K Y Q L G ----:----|----:----|----:----|----:----|----:----|----:----| L S * T A A F S G P * L L K I L L I L Q Y V E R Q L L V E R D Y F N L L F Y * S F K V N C C F K G T M F T * Y S T D A P CviJI |NlaIV ||SduI ||HgiJII* ||| BsiYI* SetI TspEI ||| |BccI AlfI BsrDI |BccI |AlfI ||| || Hin4II* AlfI | CviRI* ||CviRI* |AlfI \\\ \\ \ \ \ \ \\\ \\ GCTCCTTCCATTGGTAGATGGTATCAACTCATTGCAACAGGTTGCAAAGATGGTAGAATT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGGAAGGTAACCATCTACCATAGTTGAGTAACGTTGTCCAACGTTTCTACCATCTTAA // / // / / / / / / / || | |Hin4II* AlfI BsrDI | SetI CviRI* AlfI TspEI || | BccI AlfI CviRI* BccI AlfI || BsiYI* |NlaIV CviJI A P S I G R W Y Q L I A T G C K D G R I L L P L V D G I N S L Q Q V A K M V E L S F H W * M V S T H C N R L Q R W * N * ----:----|----:----|----:----|----:----|----:----|----:----| A G E M P L H Y * S M A V P Q L S P L I P E K W Q Y I T D V * Q L L N C L H Y F S R G N T S P I L E N C C T A F I T S N BssKI SecI* EcoRII | ScrFI | BseBI | | MnlI | | |CviJI | | |HaeIII | | || DdeI | | || | Hpy188I | | || | | HinfI | | || | | | MnlI | | || | | | | MseI | | || | | | | BspCNI | | || | | | | |BseMII | | || | | | | ||PleI ApoI | | || | | | | |||MlyI TspEI BslFI DdeI | | || | | | | |||| BseRI \ \ \ \ \ \\ \ \ \ \ \\\\ \ AGAATTTTCAAAATCACAGAAAAACTAAGTCCCCTGGCCTCAGAGGAGTCTTTAACTAAC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTAAAAGTTTTAGTGTCTTTTTGATTCAGGGGACCGGAGTCTCCTCAGAAATTGATTG / / / /// // / /// /// TspEI BslFI DdeI ||| |DdeI | ||| ||BseRI ApoI ||| | | ||| |PleI ||| | | ||| |MlyI ||| | | ||| MseI ||| | | ||BseMII ||| | | |BspCNI ||| | | HinfI ||| | MnlI ||| Hpy188I ||EcoRII ||HaeIII ||BssKI ||CviJI |SecI* BseBI ScrFI MnlI R I F K I T E K L S P L A S E E S L T N E F S K S Q K N * V P W P Q R S L * L T N F Q N H R K T K S P G L R G V F N * L ----:----|----:----|----:----|----:----|----:----|----:----| L I K L I V S F S L G R A E S S D K V L * F K * F * L F V L D G P R L P T K L * S N E F D C F F * T G Q G * L L R * S V SfaNI MlyI | HindII PleI | Hpy166II MboI | | FatI FokI | | |CviAII | DpnI | | || NlaIII | |BstKTI | | || | CviRI* | || Hpy188I | | || | | BseGI | || |HinfI \ \ \\ \ \ \ \ \\ \\ TCAAATATGTTTGATAATAGTGCTGATGTTGACATGGATGCACAGGGCAGATCAGACTCA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTTATACAAACTATTATCACGACTACAACTGTACCTACGTGTCCCGTCTAGTCTGAGT /// // / /// / / ||| || CviRI* ||| | HinfI ||| || BseGI ||| Hpy188I ||| |FatI ||| FokI ||| CviAII ||| MboI ||NlaIII ||DpnI |SfaNI |BstKTI Hpy166II |PleI HindII MlyI S N M F D N S A D V D M D A Q G R S D S Q I C L I I V L M L T W M H R A D Q T Q K Y V * * * C * C * H G C T G Q I R L K ----:----|----:----|----:----|----:----|----:----|----:----| E F I N S L L A S T S M S A C P L D S E S L Y T Q Y Y H Q H Q C P H V P C I L S * I H K I I T S I N V H I C L A S * V * AluI CviJI |DdeI |EspI* ||SetI Ksp632I* |||MboII | BseMII |||| AluI Cac8I | |BspCNI |||| CviJI FalI CviRI* | FatI | ||Hin4I |||| | SetI FalI | Hin4I DdeI | |CviAII \ \\\ \\\\ \ \ \ \ \ \ \ \\ AATACCGAAGAGAAAGCTGAGCTACAATCAAACTTGCAAGTTGAACTTCTAAGCGAGCAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGGCTTCTCTTTCGACTCGATGTTAGTTTGAACGTTCAACTTGAAGATTCGCTCGTA /// / / //// / // / /// / ||BspCNI | | |||| FalI |Hin4I | ||| CviAII |BseMII | | |||| FalI CviRI* | ||NlaIII Ksp632I* | | |||CviJI | |FalI Hin4I | | |||AluI | |FalI | | ||EspI* | Cac8I | | ||DdeI DdeI | | |SetI | | MboII | CviJI | AluI SetI N T E E K A E L Q S N L Q V E L L S E H I P K R K L S Y N Q T C K L N F * A S M Y R R E S * A T I K L A S * T S K R A * ----:----|----:----|----:----|----:----|----:----|----:----| F V S S F A S S C D F K C T S S R L S C L Y R L S L Q A V I L S A L Q V E L R A I G F L F S L * L * V Q L N F K * A L M AsuI* AvaII |BmgT120I || BsiYI* FalI || | ApoI SmlI FalI || | TspEI Csp6I AflII NlaIII TspGWI || | | MseI |RsaI |MseI \ \ \\ \ \ \ \\ \\ GATGACCATAATGGCGAAGTTTGGTCCGTGTCTTGGAATTTAACGGGTACAATCTTAAGC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGGTATTACCGCTTCAAACCAGGCACAGAACCTTAAATTGCCCATGTTAGAATTCG / / // / / / // // FatI TspGWI || BsiYI* | MseI |Csp6I |AflII |AvaII TspEI RsaI |SmlI |AsuI* ApoI TspRI BmgT120I MseI D D H N G E V W S V S W N L T G T I L S M T I M A K F G P C L G I * R V Q S * A * P * W R S L V R V L E F N G Y N L K Q ----:----|----:----|----:----|----:----|----:----|----:----| S S W L P S T Q D T D Q F K V P V I K L H H G Y H R L K T R T K S N L P Y L R L I V M I A F N P G H R P I * R T C D * A BseYI FokI | BtsI Csp6I | TspRI |RsaI | |BccI |SetI | ||GsaI ||MaeII ApoI | ||| Hin4II* ||| SetI TspEI | ||| | BseGI ||| TaiI CviJI | MseI \ \\\ \ \ \\\ \ \ \ \ AGTGCTGGGGATGATGGGAAGGTACGTTTATGGAAAGCCACTTATTCAAATGAATTTAAG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TCACGACCCCTACTACCCTTCCATGCAAATACCTTTCGGTGAATAAGTTTACTTAAATTC / / / / / // / / / / | | | BseGI | || MaeII CviJI | MseI | | Hin4II* | || FokI TspEI | BseYI | |Csp6I ApoI | BccI | RsaI BtsI | TaiI GsaI | SetI SetI S A G D D G K V R L W K A T Y S N E F K V L G M M G R Y V Y G K P L I Q M N L S C W G * W E G T F M E S H L F K * I * V ----:----|----:----|----:----|----:----|----:----|----:----| L A P S S P F T R K H F A V * E F S N L C H Q P H H S P V N I S L W K N L H I * T S P I I P L Y T * P F G S I * I F K L TspDTI | TspEI \ \ TGTATGTCAGTAATTACTGCCCAACAATAA 1030 1040 1050 ----:----|----:----|----:----| ACATACAGTCATTAATGACGGGTTGTTATT / / TspDTI TspEI C M S V I T A Q Q * V C Q * L L P N N X Y V S N Y C P T I X ----:----|----:----|----:----| H I D T I V A W C Y T Y T L L * Q G V I T H * Y N S G L L L # Enzymes that cut Frequency Isoschizomers AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AflIII 1 AhaIII* 1 DraI AlfI 2 AluI 7 AluBI AlwNI 1 CaiI ApoI 4 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 4 BceAI 1 BclI 1 FbaI,Ksp22I BdaI 2 BinI* 2 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 2 BplI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 5 BseRI 1 BseYI 2 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 5 BspHI 1 CciI,PagI,RcaI BspLU11I* 1 PscI,PciI BsrDI 2 BseMI,Bse3DI BsrI 1 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstAPI 1 BstKTI 4 BtsI 1 Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 2 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 8 CviJI 15 CviKI-1 CviRI* 7 HpyCH4V DdeI 9 BstDEI,HpyF3I DpnI 4 MalI Eam1105I 1 AspEI,BmeRI,DriI,AhdI Ecl136II 1 EcoICRI Eco57I 1 AcuI Eco57MI 1 EcoRII 1 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FalI 4 FatI 8 FokI 2 GlaI 3 GsaI 2 HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII HhaI 3 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 4 HpyAV Hin6I 3 HinP1I,HspAI HindII 1 HincII HinfI 5 HpaII 1 HapII,BsiSI,MspI Hpy166II 3 Hpy8I Hpy178III* 6 Hpy188III Hpy188I 7 Hpy99I 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeII 2 HpyCH4IV MaeIII 2 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MlyI 3 SchI MmeI 1 MnlI 4 MseI 8 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NlaIII 8 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 2 BstNSI,XceI PflMI 2 BasI,AccB7I,Van91I PleI 3 PpsI PvuII 1 RsaI 3 AfaI SacI 1 Psp124BI,SstI SapI 1 LguI,PciSI,BspQI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 14 SfaNI 3 LweI SmlI 1 SmoI TaiI 2 TaqI 1 TfiI 2 PfeI TseI 1 ApeKI Tsp45I 1 NmuCI Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 10 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 3 TscAI TstI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AciI AclI AcyI AgeI AjuI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BamHI BarI BbvCI Bce83I* BcgI BciVI BetI* BfiI BglI BglII BmeT110I BmtI Bpu10I BsaAI BsaBI BsaXI BsePI BseSI BsgI Bsp120I Bsp1407I BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI BtrI Cfr10I Cfr9I ClaI CspCI DinI DraII DraIII DrdI DsaI* EciI Eco31I Eco47III EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I FauI FnuDII* FseI FspAI GsuI HaeII HgaI HgiCI* HindIII HpaI HphI KasI KpnI MaeI MauBI McrI* MfeI MluI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacII SalI SanDI ScaI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqII TatI TauI TsoI TspMI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769