Restriction Map of ALG2/YGL065C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ALG2/YGL065C on chromosome VII from coordinates 381271 to 379760.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.24765

EMBOSS_001 BseGI | Hpy178III* | | StyI | | AvrII | | SecI* | | |MaeI | | |BsiYI* FokI | | ||SetI Hin6I | TspDTI | | ||| SetI |GlaI \ \ \ \ \\\ \ \\ ATGATTGAAAAGGATAAAAGAACGATTGCTTTTATTCATCCAGACCTAGGTATTGGGGGC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTAACTTTTCCTATTTTCTTGCTAACGAAAATAAGTAGGTCTGGATCCATAACCCCCG / / / // /// /// | FokI BseGI || ||SecI* ||GlaI TspDTI || ||AvrII |HhaI || ||StyI HaeII || |MaeI || SetI |BsiYI* |SetI Hpy178III* M I E K D K R T I A F I H P D L G I G G * L K R I K E R L L L F I Q T * V L G A D * K G * K N D C F Y S S R P R Y W G R ----:----|----:----|----:----|----:----|----:----|----:----| X I S F S L L V I A K I * G S R P I P P X S Q F P Y F F S Q K * E D L G L Y Q P H N F L I F S R N S K N M W V * T N P A TaqI | Hpy99I AccI | | TseI SetI | | CviRI* |BbvI HhaI SfaNI | | |BisI |SfeI* |HaeII |SetI | | ||BlsI |Hpy166II \\ \\ \ \ \\\ \\ GCTGAAAGGTTAGTCGTCGATGCAGCATTAGGTCTACAGCAACAAGGACATAGTGTAATC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTTTCCAATCAGCAGCTACGTCGTAATCCAGATGTCGTTGTTCCTGTATCACATTAG / / // / //// / // / | SetI || | |||| SetI || SfeI* Hin6I || | |||TseI || BbvI || | ||BisI |AccI || | |BlsI Hpy166II || | CviRI* || TaqI |Hpy99I SfaNI A E R L V V D A A L G L Q Q Q G H S V I L K G * S S M Q H * V Y S N K D I V * S * K V S R R C S I R S T A T R T * C N H ----:----|----:----|----:----|----:----|----:----|----:----| A S L N T T S A A N P R C C C P C L T I R Q F T L R R H L M L D V A V L V Y H L S F P * D D I C C * T * L L L S M T Y D SpeI MboII |MaeI | CfrI || MaeIII | | CviJI || Tsp45I | | HaeIII || | Tsp4CI* TaqI | | | TspEI || | | TspRI AsuII MseI | | | | MseI \\ \ \ \ \ \ \ \ \ \ \ ATCTATACTAGTCACTGTGATAAATCACATTGTTTCGAAGAAGTTAAAAACGGCCAATTA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TAGATATGATCAGTGACACTATTTAGTGTAACAAAGCTTCTTCAATTTTTGCCGGTTAAT // / / / / / / // || Tsp4CI* AsuII | | | | |MseI || Tsp45I TaqI | | | | TspEI || MaeIII | | | CfrI |SpeI | | HaeIII TspRI | | CviJI MaeI | MboII MseI I Y T S H C D K S H C F E E V K N G Q L S I L V T V I N H I V S K K L K T A N * L Y * S L * * I T L F R R S * K R P I K ----:----|----:----|----:----|----:----|----:----|----:----| M * V L * Q S L D C Q K S S T L F P W N * R Y * D S H Y I V N N R L L * F R G I D I S T V T I F * M T E F F N F V A L * TaqI |BceAI HphI \\ \ AAAGTCGAAGTTTATGGTGATTTTTTACCGACAAACTTTTTGGGTCGTTTTTTTATTGTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCAGCTTCAAATACCACTAAAAAATGGCTGTTTGAAAAACCCAGCAAAAAAATAACAA // / |BceAI HphI TaqI K V E V Y G D F L P T N F L G R F F I V K S K F M V I F Y R Q T F W V V F L L F S R S L W * F F T D K L F G S F F Y C F ----:----|----:----|----:----|----:----|----:----|----:----| F T S T * P S K K G V F K K P R K K I T L L R L K H H N K V S L S K P D N K * Q F D F N I T I K * R C V K Q T T K K N N BinI* |MfeI |TspEI || MboI AluI || | DpnI CviJI || | |BstKTI TspEI | SetI || | || SfeI* \ \ \ \\ \ \\ \ TTCGCAACAATTAGACAGCTTTATTTAGTTATTCAATTGATCCTACAGAAAAAAGTGAAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCGTTGTTAATCTGTCGAAATAAATCAATAAGTTAACTAGGATGTCTTTTTTCACTTA / / / / /// / / | | CviJI | ||| MboI SfeI* | | AluI | ||DpnI | SetI | |BstKTI TspEI | TspEI | MfeI BinI* F A T I R Q L Y L V I Q L I L Q K K V N S Q Q L D S F I * L F N * S Y R K K * M R N N * T A L F S Y S I D P T E K S E C ----:----|----:----|----:----|----:----|----:----|----:----| K A V I L C S * K T I * N I R C F F T F K R L L * V A K N L * E I S G V S F L S E C C N S L K I * N N L Q D * L F F H I MboI BclI | DpnI | |BstKTI | || Tsp4CI* | || | AccI | || | |Hpy166II BsmI | || | || FatI Csp6I | || | || AflIII |RsaI | || | || BspLU11I* || TspEI | || | || |CviAII || | MseI | || | || || NspI || | VspI | || | || || NlaIII || | |TspEI | || | || || | AciI || | || Hin4I | || | || || | | Hin4I || | || Hin4I | || | || || | | Hin4I CviRI* \\ \ \\ \ \ \\ \ \\ \\ \ \ \ \ GCGTACCAATTAATTATCATTGATCAACTGTCTACATGTATTCCGCTTCTGCATATCTTT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGCATGGTTAATTAATAGTAACTAGTTGACAGATGTACATAAGGCGAAGACGTATAGAAA / // / // / // / / /// // / / / | || | || TspEI || | | ||| || | AciI CviRI* | || | |VspI || | | ||| || Hin4I | || | |MseI || | | ||| || Hin4I | || | TspEI || | | ||| |BspLU11I* | || Hin4I || | | ||| |AflIII | || Hin4I || | | ||| |FatI | |Csp6I || | | ||| CviAII | RsaI || | | ||NlaIII BsmI || | | ||NspI || | | |AccI || | | Hpy166II || | Tsp4CI* || BclI || MboI |DpnI BstKTI A Y Q L I I I D Q L S T C I P L L H I F R T N * L S L I N C L H V F R F C I S L V P I N Y H * S T V Y M Y S A S A Y L * ----:----|----:----|----:----|----:----|----:----|----:----| A Y W N I I M S * S D V H I G S R C I K H T G I L * * Q D V T * M Y E A E A Y R R V L * N D N I L Q R C T N R K Q M D K MwoI TspEI | AluI | PflMI | BseYI | BsiYI* | CviJI MslI | | CviJI | | SetI \ \ \ \ \ \ \ AGTTCTGCCACTTTGATGTTTTATTGTCATTTCCCCGACCAATTATTGGCTCAAAGAGCT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TCAAGACGGTGAAACTACAAAATAACAGTAAAGGGGCTGGTTAATAACCGAGTTTCTCGA / / / / / / / MslI | | | | | CviJI | | | | | AluI | | | | | GsaI | | | | SetI | | | | BarI | | | MwoI | | CviJI | TspEI BsiYI* PflMI S S A T L M F Y C H F P D Q L L A Q R A V L P L * C F I V I S P T N Y W L K E L F C H F D V L L S F P R P I I G S K S W ----:----|----:----|----:----|----:----|----:----|----:----| L E A V K I N * Q * K G S W N N A * L A * N Q W K S T K N D N G R G I I P E F L T R G S Q H K I T M E G V L * Q S L S S BarI TspGWI |GsaI BarI | Tsp4CI* ||CviJI MboII | MseI | |BbvI BaeI \\\ \ \ \ \ \\ \ GGGCTATTGAAGAAAATATACAGACTACCATTTGACTTAATAGAACAGTTTTCCGTGAGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CCCGATAACTTCTTTTATATGTCTGATGGTAAACTGAATTATCTTGTCAAAAGGCACTCA // / / // / / / |CviJI MboII BarI || | | BaeI BseYI || | BbvI || Tsp4CI* |TspGWI MseI G L L K K I Y R L P F D L I E Q F S V S G Y * R K Y T D Y H L T * * N S F P * V A I E E N I Q T T I * L N R T V F R E C ----:----|----:----|----:----|----:----|----:----|----:----| P S N F F I Y L S G N S K I S C N E T L Q A I S S F I C V V M Q S L L V T K R S P * Q L F Y V S * W K V * Y F L K G H T ApoI XmnI AclI TseI TspEI MaeII MaeII |BisI ApoI | BaeI | SetI | SetI ||BlsI Tsp4CI* TspEI | | DdeI | TaiI | TaiI \\\ \ \ \ \ \ \ \ \ \ GCTGCCGATACTGTTGTGGTAAATTCAAATTTCACTAAGAATACGTTCCACCAAACGTTC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGACGGCTATGACAACACCATTTAAGTTTAAAGTGATTCTTATGCAAGGTGGTTTGCAAG /// / / / / / // / / / ||TseI Tsp4CI* | | TspEI | || MaeII | MaeII |BisI | | ApoI | |XmnI | AclI BlsI | BaeI | TaiI TaiI TspEI | SetI SetI ApoI DdeI A A D T V V V N S N F T K N T F H Q T F L P I L L W * I Q I S L R I R S T K R S C R Y C C G K F K F H * E Y V P P N V Q ----:----|----:----|----:----|----:----|----:----|----:----| A A S V T T T F E F K V L F V N W W V N H Q R Y Q Q P L N L N * * S Y T G G F T S G I S N H Y I * I E S L I R E V L R E BinI* | MboI | | DpnI | | |BstKTI | | ||Hpy178III* | | ||| AcyI | | ||| MaeII | | ||| |ZraI | | ||| || SetI FatI | | ||| || TaiI |CviAII TaqI | | ||| || AatII || NlaIII | TspEI \ \ \\\ \\ \ \\ \ \ \ AAGTATTTATCCAATGATCCAGACGTCATTTATCCATGCGTGGATTTATCAACAATCGAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTCATAAATAGGTTACTAGGTCTGCAGTAAATAGGTACGCACCTAAATAGTTGTTAGCTT / // / // // / // / | || | || |MaeII | |FatI TaqI | || | || |AcyI | CviAII | || | || ZraI NlaIII | || | |AatII | || | |TaiI | || | |SetI | || | Hpy178III* | || MboI | |DpnI | BstKTI BinI* K Y L S N D P D V I Y P C V D L S T I E S I Y P M I Q T S F I H A W I Y Q Q S K V F I Q * S R R H L S M R G F I N N R N ----:----|----:----|----:----|----:----|----:----|----:----| L Y K D L S G S T M * G H T S K D V I S * T N I W H D L R * K D M R P N I L L R L I * G I I W V D N I W A H I * * C D F MboII Tsp4CI* | ApoI | Hin4II* | TspEI | |MseI | | XmnI | |TspRI \ \ \ \ \\ ATTGAAGATATTGACAAGAAATTTTTCAAAACAGTGTTTAACGAAGGCGATAGATTTTAC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTTCTATAACTGTTCTTTAAAAAGTTTTGTCACAAATTGCTTCCGCTATCTAAAATG / / // / / / / / TspEI MboII |TspEI | | | MseI SetI |ApoI | | Hin4II* XmnI | Tsp4CI* TspRI I E D I D K K F F K T V F N E G D R F Y L K I L T R N F S K Q C L T K A I D F T * R Y * Q E I F Q N S V * R R R * I L P ----:----|----:----|----:----|----:----|----:----|----:----| I S S I S L F N K L V T N L S P S L N * F Q L Y Q C S I K * F L T * R L R Y I K N F I N V L F K E F C H K V F A I S K V BseGI |Hin6I ||GlaI |||HhaI |||| Cac8I DdeI |||| | FokI MwoI |SetI TsoI |||| | CviJI | CviJI \\ \ \\\\ \ \ \ \ CTAAGTATAAATCGTTTTGAGAAAAAAAAGGATGTTGCGCTGGCTATAAAGGCTTTTGCG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GATTCATATTTAGCAAAACTCTTTTTTTTCCTACAACGCGACCGATATTTCCGAAAACGC / / / /// / / // / DdeI TsoI | ||| | | |FokI CviJI | ||| | | MwoI | ||| | CviJI | ||| Cac8I | ||Hin6I | |GlaI | HhaI BseGI L S I N R F E K K K D V A L A I K A F A * V * I V L R K K R M L R W L * R L L R K Y K S F * E K K G C C A G Y K G F C V ----:----|----:----|----:----|----:----|----:----|----:----| R L I F R K S F F F S T A S A I F A K A G L Y L D N Q S F F P H Q A P * L P K Q * T Y I T K L F F L I N R Q S Y L S K R AclI MaeII Eco57I Hpy188I Eco57MI | MboI | MseI | | DpnI | SetI AciI | | |BstKTI MboII | TaiI TsoI | BcgI MnlI \ \ \\ \ \ \ \ \ \ \ TTATCTGAAGATCAAATCAATGACAACGTTAAGTTAGTTATTTGCGGTGGTTATGACGAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGACTTCTAGTTTAGTTACTGTTGCAATTCAATCAATAAACGCCACCAATACTGCTC / // / / // / / / / / / | || MboI MboII || | MseI TsoI | AciI MnlI | |DpnI || MaeII BcgI | BstKTI || AclI Hpy188I |TaiI |SetI Eco57MI Eco57I L S E D Q I N D N V K L V I C G G Y D E Y L K I K S M T T L S * L F A V V M T R I * R S N Q * Q R * V S Y L R W L * R E ----:----|----:----|----:----|----:----|----:----|----:----| N D S S * I L S L T L N T I Q P P * S S T I Q L D F * H C R * T L * K R H N H R * R F I L D I V V N L * N N A T T I V L SfeI* TatI | Tsp4CI* BcgI | | AlwNI |Csp6I | | | CfrI |Hin4II* | | | BsmAI ||RsaI | | | | CviJI CviRI* ||ScaI | | | | HaeIII TspEI \ \\\ \ \ \ \ \ \ AGGGTTGCAGAAAATGTGGAGTACTTGAAGGAACTACAGTCTCTGGCCGATGAATACGAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCAACGTCTTTTACACCTCATGAACTTCCTTGATGTCAGAGACCGGCTACTTATGCTT / / / /// /// / / CviRI* | | ||TatI ||AlwNI | BsmAI | | |Csp6I |SfeI* | CfrI | | ScaI Tsp4CI* HaeIII | | RsaI CviJI | Hin4II* BcgI R V A E N V E Y L K E L Q S L A D E Y E G L Q K M W S T * R N Y S L W P M N T N G C R K C G V L E G T T V S G R * I R I ----:----|----:----|----:----|----:----|----:----|----:----| L T A S F T S Y K F S S C D R A S S Y S S P Q L F H P T S S P V V T E P R H I R P N C F I H L V Q L F * L R Q G I F V F Hin6I |GlaI |Hin4I |Hin4I ||HhaI ||FnuDII* ||| BsmAI ||| Esp3I ||| Hpy188I TspDTI HgaI ||| | HinfI PleI \ \ \\\ \ \ \ TTATCCCATACAACCATATACTACCAAGAAATAAAGCGCGTCTCCGATTTAGAGTCATTC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AATAGGGTATGTTGGTATATGATGGTTCTTTATTTCGCGCAGAGGCTAAATCTCAGTAAG // / /// / / / |TspDTI | ||| | Esp3I HinfI TspEI | ||| | BsmAI | ||| Hpy188I | ||FnuDII* | ||Hin6I | |GlaI | HhaI Hin4I Hin4I HgaI L S H T T I Y Y Q E I K R V S D L E S F Y P I Q P Y T T K K * S A S P I * S H S I P Y N H I L P R N K A R L R F R V I Q ----:----|----:----|----:----|----:----|----:----|----:----| N D W V V M Y * W S I F R T E S K S D N I I G Y L W I S G L F L A R R R N L T M * G M C G Y V V L F Y L A D G I * L * E Hin4I MseI Hpy188I MlyI Hin4I TspEI |TspDTI | TspEI \ \ \ \\ \ \ AAAACCAATAATAGTAAAATTATATTTTTAACTTCCATTTCATCATCTCTGAAAGAATTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGGTTATTATCATTTTAATATAAAAATTGAAGGTAAAGTAGTAGAGACTTTCTTAAT / / / / / / / | Hin4I TspEI | MseI Hpy188I TspEI | Hin4I TspDTI PleI MlyI K T N N S K I I F L T S I S S S L K E L K P I I V K L Y F * L P F H H L * K N Y N Q * * * N Y I F N F H F I I S E R I T ----:----|----:----|----:----|----:----|----:----|----:----| L V L L L L I I N K V E M E D D R F S N * F W Y Y Y F * I K L K W K M M E S L I F G I I T F N Y K * S G N * * R Q F F * AccI |BssNAI SduI TaqI |Hpy166II NdeI HgiAI* \ \\ \ \ CTGCTCGAAAGAACCGAAATGTTATTGTATACACCAGCATATGAGCACTTTGGTATTGTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GACGAGCTTTCTTGGCTTTACAATAACATATGTGGTCGTATACTCGTGAAACCATAACAA / // / / TaqI |AccI | HgiAI* Hpy166II | SduI BssNAI NdeI L L E R T E M L L Y T P A Y E H F G I V C S K E P K C Y C I H Q H M S T L V L F A R K N R N V I V Y T S I * A L W Y C S ----:----|----:----|----:----|----:----|----:----|----:----| S S S L V S I N N Y V G A Y S C K P I T V A R F F R F T I T Y V L M H A S Q Y Q Q E F S G F H * Q I C W C I L V K T N N SetI AsuI* | CviJI AvaII CviJI | |TspDTI DraII |FatI | || TatI PpuMI ||CviAII | || |Csp6I |BmgT120I ||| NlaIII | || ||RsaI Hpy166II ||SetI ||| |TspEI | || ||| MaeI |MnlI |||BsmAI \\\ \\ \ \\ \\\ \ \\ \\\\ CCTTTAGAAGCCATGAAATTAGGTAAGCCTGTACTAGCAGTAAACAATGGAGGTCCTTTG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAATCTTCGGTACTTTAATCCATTCGGACATGATCGTCATTTGTTACCTCCAGGAAAC // // / // /// / / / // / || |FatI TspEI || ||| MaeI | | || BsmAI || | SetI || ||TatI | | |PpuMI || CviAII || |Csp6I | | |DraII |NlaIII || RsaI | | |AvaII CviJI |CviJI | | |AsuI* TspDTI | | BmgT120I | SetI Hpy166II MnlI P L E A M K L G K P V L A V N N G G P L L * K P * N * V S L Y * Q * T M E V L W F R S H E I R * A C T S S K Q W R S F G ----:----|----:----|----:----|----:----|----:----|----:----| G K S A M F N P L G T S A T F L P P G K E K L L W S I L Y A Q V L L L C H L D K R * F G H F * T L R Y * C Y V I S T R Q TspDTI | BceAI | |PflMI | |DraIII | |BsiYI* | ||BsrI | ||TspRI MaeII HphI | |||BslFI | SetI |TaqII | |||| CviJI | TaiI || TsoI | |||| | BfiI \ \ \\ \ \ \\\\ \ \ GAGACTATCAAATCTTACGTTGCTGGTGAAAATGAAAGTTCTGCCACTGGGTGGCTAAAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTGATAGTTTAGAATGCAACGACCACTTTTACTTTCAAGACGGTGACCCACCGATTTT / / / / / / / / / /// / | MaeII | | | | | | | ||| SetI TaiI | | | | | | | ||BslFI SetI | | | | | | | |BfiI | | | | | | | CviJI | | | | | | BceAI | | | | | BsrI | | | | BsiYI* | | | | DraIII | | | | PflMI | | | TspDTI | | TspRI | TsoI TaqII HphI E T I K S Y V A G E N E S S A T G W L K R L S N L T L L V K M K V L P L G G * N D Y Q I L R C W * K * K F C H W V A K T ----:----|----:----|----:----|----:----|----:----|----:----| S V I L D * T A P S F S L E A V P H S F P S * * I K R Q Q H F H F N Q W Q T A L L S D F R V N S T F I F T R G S P P * F MboI BglII XhoII | DpnI CviRI* | |BstKTI |MfeI | |TspDTI SetI BspMI CviJI |TspEI | || CviRI* \ \ \ \\ \ \\ \ CCTGCCGTCCCTATTCAATGGGCTACTGCAATTGATGAAAGCAGAAAGATCTTGCAGAAC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GGACGGCAGGGATAAGTTACCCGATGACGTTAACTACTTTCGTCTTTCTAGAACGTCTTG / / / / // / / / BspMI CviJI | TspEI || | | Tsp4CI* | MfeI || | CviRI* CviRI* || XhoII || BglII || MboI |DpnI TspDTI BstKTI P A V P I Q W A T A I D E S R K I L Q N L P S L F N G L L Q L M K A E R S C R T C R P Y S M G Y C N * * K Q K D L A E R ----:----|----:----|----:----|----:----|----:----|----:----| G A T G I * H A V A I S S L L F I K C F V Q R G * E I P * Q L Q H F C F S R A S R G D R N L P S S C N I F A S L D Q L V AsuI* |CviJI |HaeIII |BmgT120I || AciI || Cac8I || | FalI || | FalI || | DdeI || | | FauI || | | HinfI || | | | Hpy178III* Hpy166II || | | | | PleI MlyI Tsp4CI* | MnlI || | | | | |MlyI MaeI PleI \ \ \ \\ \ \ \ \ \\ \ \ GGTTCTGTGAACTTTGAGAGGAATGGCCCGCTAAGAGTCAAGAAATACTTTTCTAGGGAA 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAGACACTTGAAACTCTCCTTACCGGGCGATTCTCAGTTCTTTATGAAAAGATCCCTT // /// / / // / / / / / |MnlI ||| | | || | PleI | | MlyI Hpy166II ||| | | || | MlyI | FalI ||| | | || Hpy178III* | FalI ||| | | |HinfI MaeI ||| | | FauI ||| | DdeI ||| AciI ||AsuI* ||Cac8I |BmgT120I HaeIII CviJI FalI FalI G S V N F E R N G P L R V K K Y F S R E V L * T L R G M A R * E S R N T F L G K F C E L * E E W P A K S Q E I L F * G S ----:----|----:----|----:----|----:----|----:----|----:----| P E T F K S L F P G S L T L F Y K E L S R N Q S S Q S S H G A L L * S I S K * P T R H V K L P I A R * S D L F V K R P F BspCNI |BseMII || MaeII FalI || | TaqI FalI || | SetI | HinfI || | TaiI | | DdeI || | |Hpy178III* | | BsrDI || | ||MboII | | |Tth111I || | ||Hpy99I NdeI \ \ \\ \\ \ \\\ \ GCAATGACTCAGTCATTTGAAGAAAACGTCGAGAAAGTCATATGGAAAGAAAAAAAGTAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTACTGAGTCAGTAAACTTCTTTTGCAGCTCTTTCAGTATACCTTTCTTTTTTTCATA / / /// // // / /// / PleI | ||DdeI || || | ||| NdeI | |Tth111I || || | ||Hpy178III* | HinfI || || | |TaqI BsrDI || || | MboII || || MaeII || |Hpy99I || TaiI || SetI |BseMII BspCNI A M T Q S F E E N V E K V I W K E K K Y Q * L S H L K K T S R K S Y G K K K S I N D S V I * R K R R E S H M E R K K V L ----:----|----:----|----:----|----:----|----:----|----:----| A I V * D N S S F T S F T M H F S F F Y L L S E T M Q L F R R S L * I S L F F T C H S L * K F F V D L F D Y P F F F L I StyI SspI CviRI* SecI* TspDTI TspEI | NdeI PsiI \ \ \ \ \ \ TATCCTTGGGAAATATTCGGTATTTCATTCTCTAATTTTATTTTGCATATGGCATTTATA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ATAGGAACCCTTTATAAGCCATAAAGTAAGAGATTAAAATAAAACGTATACCGTAAATAT / / / / / / / | | SspI TspEI | NdeI PsiI | TspDTI CviRI* SecI* StyI Y P W E I F G I S F S N F I L H M A F I I L G K Y S V F H S L I L F C I W H L * S L G N I R Y F I L * F Y F A Y G I Y K ----:----|----:----|----:----|----:----|----:----|----:----| * G Q S I N P I E N E L K I K C I A N I N D K P F I R Y K M R * N * K A Y P M * I R P F Y E T N * E R I K N Q M H C K Y FatI NcoI StyI SecI* BsiYI* DsaI* Hin4II* |CviAII | CfrI || AsuI* | | BalI || NlaIII | | CviJI || |CviJI | | HaeIII ApoI || |HaeIII | | | MslI FalI TspEI || |BmgT120I | | | | BstXI FalI \ \\ \\ \ \ \ \ \ \ AAAATTCTACCCAATAATCCATGGCCCTTCCTATTTATGGCCACTTTTATGGTATTATAT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAAGATGGGTTATTAGGTACCGGGAAGGATAAATACCGGTGAAAATACCATAATATA / / ///// / / / / / / / TspEI | ||||AsuI* | | | | | | FalI ApoI | |||| | | | | | | FalI | |||| | | | | | MslI | |||| | | | | BstXI | |||| | | | CfrI | |||| | | HaeIII | |||| | | CviJI | |||| | | BalI | |||| | Hin4II* | |||| BsiYI* | |||BmgT120I | ||HaeIII | ||CviJI | |DsaI* | |SecI* | |StyI | |NcoI | |FatI | CviAII NlaIII K I L P N N P W P F L F M A T F M V L Y K F Y P I I H G P S Y L W P L L W Y Y I N S T Q * S M A L P I Y G H F Y G I I F ----:----|----:----|----:----|----:----|----:----|----:----| F I R G L L G H G K R N I A V K I T N Y L F E V W Y D M A R G I * P W K * P I I F N * G I I W P G E * K H G S K H Y * I FalI ApoI FalI MseI TspEI | BsrI BfiI \ \ \ \ \ TTTAAGAACTACTTATGGGGAATTTACTGGGCATTTGTATTCGCTCTCTCCTACCCTTAT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AAATTCTTGATGAATACCCCTTAAATGACCCGTAAACATAAGCGAGAGAGGATGGGAATA / / / / / MseI | | BsrI BfiI | TspEI | ApoI FalI FalI F K N Y L W G I Y W A F V F A L S Y P Y L R T T Y G E F T G H L Y S L S P T L M * E L L M G N L L G I C I R S L L P L * ----:----|----:----|----:----|----:----|----:----|----:----| K L F * K H P I * Q A N T N A R E * G * N * S S S I P F K S P M Q I R E R R G K K L V V * P S N V P C K Y E S E G V R I GAAGAAATATAA 1510 ----:----|-- CTTCTTTATATT E E I * K K Y X R N I X ----:----|-- S S I Y H L F I F F Y L # Enzymes that cut Frequency Isoschizomers AatII 1 AccI 3 FblI,XmiI AciI 3 BspACI,SsiI AclI 2 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AluI 2 AluBI AlwNI 1 CaiI ApoI 5 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BceAI 2 BcgI 1 BclI 1 FbaI,Ksp22I BfiI 2 BmrI,BmuI BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 3 BseGI 2 BstF5I,BtsCI BseMII 1 BseYI 1 BsiYI* 4 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 3 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssNAI 1 Bst1107I,BstZ17I BstKTI 5 BstXI 1 Cac8I 2 BstC8I CfrI 3 AcoI,EaeI Csp6I 3 CviQI,RsaNI CviAII 4 CviJI 15 CviKI-1 CviRI* 6 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 5 MalI DraII 1 EcoO109I DraIII 1 AdeI DsaI* 1 BtgI,BstDSI Eco57I 1 AcuI Eco57MI 1 Esp3I 1 BsmBI FalI 4 FatI 4 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 3 GsaI 1 HaeII 1 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 3 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 3 HpyAV Hin6I 3 HinP1I,HspAI HinfI 3 HphI 2 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 3 Hpy99I 2 MaeI 4 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 1 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MfeI 2 MunI MlyI 3 SchI MnlI 3 MseI 8 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 2 HpyF10VI,BstMWI NcoI 1 Bsp19I NdeI 3 FauNDI NlaIII 4 Hin1II,Hsp92II,FaeI NspI 1 BstNSI,XceI PflMI 2 BasI,AccB7I,Van91I PleI 3 PpsI PpuMI 1 Psp5II,PspPPI PsiI 1 AanI RsaI 3 AfaI ScaI 1 BmcAI,AssI,ZrmI SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 16 SfaNI 1 LweI SfeI* 3 BstSFI,SfcI,BfmI SpeI 1 BcuI,AhlI SspI 1 StyI 3 Eco130I,EcoT14I,ErhI,BssT1I TaiI 6 TaqI 6 TaqII 1 TatI 2 TseI 2 ApeKI TsoI 3 Tsp45I 1 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 18 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 3 TscAI Tth111I 1 PflFI,PsyI,AspI VspI 1 PshBI,AseI XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I ZraI 1 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AflII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AvaI BamHI BbvCI BbvII* BccI Bce83I* BciVI BdaI BetI* BglI BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BsePI BseRI BseSI BsgI BsiI* Bsp120I Bsp1407I BspHI BspMII* BspOI BsrBI BssKI Bst2UI BstAPI BstEII BstNI BstOI BstSCI BtgZI BtrI BtsI CauII* Cfr10I Cfr9I ClaI CspCI DinI DrdI Eam1105I EciI Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI EspI* FseI FspAI GsuI HgiCI* HgiJII* HindII HindIII HpaI HpaII KasI KpnI Ksp632I* MauBI McrI* MluI MmeI Mph1103I MroNI MstI* MvaI NaeI NarI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PfoI PmaCI PmeI PpiI PshAI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScrFI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TauI TfiI TspMI TstI XbaI XcmI XhoI XmaCI XmaI XmaIII* Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769