Restriction Map of RAD6/YGL058W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RAD6/YGL058W on chromosome VII from coordinates 393986 to 394504.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.4935

MseI Hpy166II |AhaIII* | AluI || MaeII | CviJI || Hin4II* | |MaeI || | SetI | |Hin4II* SetI || | TaiI | ||SetI | MboII || | SfaNI \ \\\ \ \ \\ \ \ ATGTCCACACCAGCTAGAAGAAGGTTGATGAGAGATTTTAAACGTATGAAGGAAGATGCC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGGTGTGGTCGATCTTCTTCCAACTACTCTCTAAAATTTGCATACTTCCTTCTACGG / / / / / / /// / / / | | | MaeI SetI MboII ||| | SfaNI TspDTI | | Hin4II* ||| MaeII | | CviJI ||Hin4II* | | AluI ||TaiI | SetI ||SetI Hpy166II |MseI AhaIII* M S T P A R R R L M R D F K R M K E D A C P H Q L E E G * * E I L N V * R K M P V H T S * K K V D E R F * T Y E G R C P ----:----|----:----|----:----|----:----|----:----|----:----| X D V G A L L L N I L S K L R I F S S A X T W V L * F F T S S L N * V Y S P L H H G C W S S S P Q H S I K F T H L F I G TspDTI | BssKI | |HpaII MaeII | |MboII | FatI | ||ScrFI | SetI | ||CauII* | TaiI FatI | ||| DraIII | |CviAII |CviAII | ||| | HphI SetI | || NlaIII || NlaIII \ \\\ \ \ \ \ \\ \ \\ \ CCACCGGGTGTATCTGCTTCACCATTACCTGATAACGTCATGGTATGGAACGCCATGATT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGGCCCACATAGACGAAGTGGTAATGGACTATTGCAGTACCATACCTTGCGGTACTAA // / / / / / // // / // || | | HphI SetI | || |FatI | |FatI || | BssKI | || CviAII | CviAII || CauII* | |NlaIII NlaIII || HpaII | MaeII || ScrFI TaiI |DraIII SetI MboII P P G V S A S P L P D N V M V W N A M I H R V Y L L H H Y L I T S W Y G T P * L T G C I C F T I T * * R H G M E R H D Y ----:----|----:----|----:----|----:----|----:----|----:----| G G P T D A E G N G S L T M T H F A M I G V P H I Q K V M V Q Y R * P I S R W S W R T Y R S * W * R I V D H Y P V G H N AsuI* MmeI |BmgT120I | BbvII* ||CviJI | | MboII ||HaeIII | | |TspDTI ||| Cac8I | | || SetI ||| | CviJI NdeI | | || |TspGWI \\\ \ \ \ \ \ \\ \\ ATCGGGCCAGCCGATACTCCATATGAAGACGGAACTTTTAGGTTATTGTTGGAGTTTGAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCCCGGTCGGCTATGAGGTATACTTCTGCCTTGAAAATCCAATAACAACCTCAAACTA /// / / / / / / ||| CviJI | MmeI | | TspGWI ||Cac8I NdeI | SetI |AsuI* TspDTI BmgT120I BbvII* HaeIII MboII CviJI I G P A D T P Y E D G T F R L L L E F D S G Q P I L H M K T E L L G Y C W S L M R A S R Y S I * R R N F * V I V G V * * ----:----|----:----|----:----|----:----|----:----|----:----| I P G A S V G Y S S P V K L N N N S N S * R A L R Y E M H L R F K * T I T P T Q D P W G I S W I F V S S K P * Q Q L K I MboII |TspDTI || CviJI || | AciI || | | FatI || | | |CviAII || | | || NspI || | | || NlaIII || | | || | BdaI || | | || | BdaI XmnI || | | || | ApoI FokI | BseGI || | | || | TspEI | TspDTI | | MslI \\ \ \ \\ \ \ \ \ \ \ \ GAAGAATATCCCAATAAGCCACCGCATGTCAAATTTTTGAGTGAAATGTTTCATCCCAAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTATAGGGTTATTCGGTGGCGTACAGTTTAAAAACTCACTTTACAAAGTAGGGTTA / / / /// / / / / / / | CviJI | ||BdaI | | FokI | BseGI MslI TspDTI | ||BdaI | TspDTI XmnI MboII | |FatI TspEI | CviAII ApoI NlaIII AciI NspI E E Y P N K P P H V K F L S E M F H P N K N I P I S H R M S N F * V K C F I P M R I S Q * A T A C Q I F E * N V S S Q C ----:----|----:----|----:----|----:----|----:----|----:----| S S Y G L L G G C T L N K L S I N * G L H L I D W Y A V A H * I K S H F T E D W F F I G I L W R M D F K Q T F H K M G I HinfI CviRI* | Hin4I BdaI | BccI | Hin4I BdaI ApoI | | MlyI | | FokI | CviRI* TspEI HphI | | PleI | | | NdeI \ \ \ \ \ \ \ \ \ \ \ GTCTATGCAAATGGTGAAATTTGTTTGGATATTTTGCAGAACAGATGGACTCCAACATAT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CAGATACGTTTACCACTTTAAACAAACCTATAAAACGTCTTGTCTACCTGAGGTTGTATA / / / / / / // / / // | CviRI* | HphI | | || | HinfI |NdeI BdaI TspEI | | || Hin4I FokI BdaI ApoI | | || Hin4I | | |PleI | | MlyI | BccI CviRI* V Y A N G E I C L D I L Q N R W T P T Y S M Q M V K F V W I F C R T D G L Q H M L C K W * N L F G Y F A E Q M D S N I * ----:----|----:----|----:----|----:----|----:----|----:----| T * A F P S I Q K S I K C F L H V G V Y H R H L H H F K N P Y K A S C I S E L M D I C I T F N T Q I N Q L V S P S W C I BinI* MmeI | AjuI SfaNI | | MboI | BseGI | | | DpnI AluI FokI | | Hin4I | | | |BstKTI CviJI |BseGI | | Hin4I | | | || BsaBI | SetI \\ \ \ \ \ \ \ \\ \ \ \ GATGTCGCATCCATATTGACATCCATTCAAAGTTTATTCAACGATCCAAATCCAGCTTCG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTACAGCGTAGGTATAACTGTAGGTAAGTTTCAAATAAGTTGCTAGGTTTAGGTCGAAGC / / / / // / / // // / / / | | | | |SfaNI | | || |BsaBI | | MwoI | | | | Hin4I | | || MboI | CviJI | | | | Hin4I | | |DpnI | AluI | | | BseGI | | BstKTI SetI | | MmeI | BinI* | FokI AjuI BseGI D V A S I L T S I Q S L F N D P N P A S M S H P Y * H P F K V Y S T I Q I Q L R C R I H I D I H S K F I Q R S K S S F A ----:----|----:----|----:----|----:----|----:----|----:----| S T A D M N V D M * L K N L S G F G A E H H R M W I S M W E F N I * R D L D L K I D C G Y Q C G N L T * E V I W I W S R TseI AluI Tsp4CI* CviJI |Csp6I |BisI ||RsaI AclI ||BlsI |||MaeII MaeII ||SetI |||| SetI MwoI | SetI |||CviRI* MboI |||| TaiI |Cac8I | TaiI |||| Hin4I | DpnI |||| | Hin4I ||BbvI | AjuI |||| Hin4I | |BstKTI |||| | Hin4I \\\ \ \ \\\\ \ \ \\ \\\\ \ \ CCAGCAAACGTTGAAGCTGCAACATTATTCAAAGATCATAAATCACAGTACGTCAAAAGA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCGTTTGCAACTTCGACGTTGTAATAAGTTTCTAGTATTTAGTGTCATGCAGTTTTCT / // / / ///// // / / // / | || | | ||||Hin4I || MboI | || Hin4I | || | | ||||Hin4I |DpnI | || Hin4I | || | | |||CviRI* BstKTI | || MaeII | || | | |||TseI | |Csp6I | || | | ||BisI | RsaI | || | | |BlsI | TaiI | || | | CviJI | SetI | || | | AluI Tsp4CI* | || | SetI | || MaeII | || AclI | |TaiI | |SetI | |BbvI | AjuI Cac8I P A N V E A A T L F K D H K S Q Y V K R Q Q T L K L Q H Y S K I I N H S T S K E S K R * S C N I I Q R S * I T V R Q K S ----:----|----:----|----:----|----:----|----:----|----:----| G A F T S A A V N N L S * L D C Y T L L A L L R Q L Q L M I * L D Y I V T R * F W C V N F S C C * E F I M F * L V D F S Esp3I BsmAI |MseI Tsp4CI* MnlI BseGI FokI \\ \ \ \ \ GTTAAGGAGACGGTAGAGAAATCTTGGGAGGATGATATGGACGATATGGACGATGATGAT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTCCTCTGCCATCTCTTTAGAACCCTCCTACTATACCTGCTATACCTGCTACTACTA // / / / / |BsmAI Tsp4CI* MnlI BseGI FokI |Esp3I MseI V K E T V E K S W E D D M D D M D D D D L R R R * R N L G R M I W T I W T M M M * G D G R E I L G G * Y G R Y G R * * * ----:----|----:----|----:----|----:----|----:----|----:----| T L S V T S F D Q S S S I S S I S S S S L * P S P L S I K P P H Y P R Y P R H H N L L R Y L F R P L I I H V I H V I I I Hpy99I | Hpy99I | | Hpy99I | | | Hpy99I | | | | Hpy99I \ \ \ \ \ GATGATGATGACGACGACGACGACGACGAAGCAGACTGA 490 500 510 ----:----|----:----|----:----|----:---- CTACTACTACTGCTGCTGCTGCTGCTGCTTCGTCTGACT / / / / / | | | | Hpy99I | | | Hpy99I | | Hpy99I | Hpy99I Hpy99I D D D D D D D D D E A D * M M M T T T T T T K Q T X * * * R R R R R R S R L X ----:----|----:----|----:----|----:---- S S S S S S S S S S A S Q H H H H R R R R R R L L S I I I V V V V V V F C V S # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AclI 1 Psp1406I AhaIII* 1 DraI AjuI 1 AluI 3 AluBI ApoI 2 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 1 BdaI 2 BinI* 1 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmgT120I 1 BsaBI 1 Bse8I,BseJI BseGI 4 BstF5I,BtsCI BsmAI 1 Alw26I,BstMAI BssKI 1 BstSCI,StyD4I BstKTI 2 Cac8I 2 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Csp6I 1 CviQI,RsaNI CviAII 3 CviJI 6 CviKI-1 CviRI* 3 HpyCH4V DpnI 2 MalI DraIII 1 AdeI Esp3I 1 BsmBI FatI 3 FokI 4 HaeIII 1 BsnI,BsuRI,BshFI,PhoI Hin4I 4 Hin4II* 2 HpyAV HinfI 1 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 1 Hpy8I Hpy99I 5 MaeI 1 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 MlyI 1 SchI MmeI 2 MnlI 1 MseI 2 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 3 Hin1II,Hsp92II,FaeI NspI 1 BstNSI,XceI PleI 1 PpsI RsaI 1 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SetI 10 SfaNI 2 LweI TaiI 4 TseI 1 ApeKI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 2 TasI,Tsp509I,Sse9I TspGWI 1 XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AflIII AgeI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BceAI BcgI BciVI BclI BetI* BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BsrI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstXI BstZ17I BtgZI BtrI BtsI Cfr10I Cfr9I CfrI ClaI CspCI DdeI DinI DraII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI EspI* FalI FaqI FauI FnuDII* FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* HhaI Hin6I HindII HindIII HinP1I HpaI Hpy178III*Hpy188I HspAI KasI KpnI Ksp632I* MaeIII MauBI McrI* MfeI MluI Mph1103I MroNI MstI* MvaI NaeI NarI NcoI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SecI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI StyI SwaI TaqI TaqII TatI TauI TfiI TsoI Tsp45I TspMI TspRI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769