Restriction Map of RIM8/YGL045W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RIM8/YGL045W on chromosome VII from coordinates 414102 to 415730.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.24190

HgiCI* MaeIII | NlaIV HinfI |BsmAI TfiI | |SduI | FatI || DdeI Tsp4CI* HinfI | |BseSI BccI | |CviAII \\ \ \ \ \ \\ \ \ \\ ATGTCGTTACTGAGACTGTGGAACAAAGAATCAAGGGCACCATCAAAAATAAAGAGTCAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGCAATGACTCTGACACCTTGTTTCTTAGTTCCCGTGGTAGTTTTTATTTCTCAGTA / / / / / / / / / / | | Tsp4CI* | | | HgiCI* BccI | CviAII | DdeI | | NlaIV NlaIII MaeIII | BseSI HinfI BsmAI | SduI HinfI TfiI M S L L R L W N K E S R A P S K I K S H C R Y * D C G T K N Q G H H Q K * R V M V V T E T V E Q R I K G T I K N K E S W ----:----|----:----|----:----|----:----|----:----|----:----| X D N S L S H F L S D L A G D F I F L * X T T V S V T S C L I L P V M L F L S D H R * Q S Q P V F F * P C W * F Y L T M FatI |CviAII ||Cac8I ||| SphI ||| NspI ||| NlaIII ||| | Cac8I ||| | |AsuI* AlfI AlfI ||| | |BceAI AlfI NlaIII AlfI ||| | ||CviJI |MaeII |PleI | MaeIII ||| | ||HaeIII || SetI ||MlyI | | MwoI ||| | ||BmgT120I || TaiI TspEI \\\ \ \ \ \\\ \ \\\ \\ \ \ GGTATTGTTGGCAGTTACGGCAACAGCATGCTGGCCCATAACAACGTGAAGCAATTTCGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAACAACCGTCAATGCCGTTGTCGTACGACCGGGTATTGTTGCACTTCGTTAAAGCA / / / / / / /// / /// / / / / | | AlfI | MaeIII | ||| | ||| | | MaeII TspEI | | AlfI MwoI | ||| | ||| | TaiI | PleI | ||| | ||| | SetI | MlyI | ||| | ||| AlfI FatI | ||| | ||| AlfI | ||| | ||AsuI* | ||| | |BmgT120I | ||| | |BceAI | ||| | HaeIII | ||| | CviJI | ||| Cac8I | ||FatI | |CviAII | Cac8I NlaIII NspI SphI G I V G S Y G N S M L A H N N V K Q F R V L L A V T A T A C W P I T T * S N F V Y C W Q L R Q Q H A G P * Q R E A I S Y ----:----|----:----|----:----|----:----|----:----|----:----| P I T P L * P L L M S A W L L T F C N R H Y Q Q C N R C C C A P G Y C R S A I E T N N A T V A V A H Q G M V V H L L K T Hin4I BsaXI | BetI* | |HpaII | || TspDTI AciI | || | AciI \ \ \\ \ \ ATAGACATAGACGAACCGCATAGAGTATGGAAACCGAATGAAAGCATAACCGGAGAAGCG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TATCTGTATCTGCTTGGCGTATCTCATACCTTTGGCTTACTTTCGTATTGGCCTCTTCGC / / / /// / AciI | BsaXI ||BetI* AciI Hin4I |HpaII TspDTI I D I D E P H R V W K P N E S I T G E A * T * T N R I E Y G N R M K A * P E K R R H R R T A * S M E T E * K H N R R S G ----:----|----:----|----:----|----:----|----:----|----:----| I S M S S G C L T H F G F S L M V P S A Y L C L R V A Y L I S V S H F C L R L L Y V Y V F R M S Y P F R I F A Y G S F R MaeII | SetI | TaiI | | MboI | | | DpnI BsmAI | | | |BstKTI | BsaXI | | | || TspEI MaeI | | Hin4I | | | || | PsrI | MnlI \ \ \ \ \ \ \\ \ \ \ \ GTCATTGACATAAAGAGAGACATAACTAACGTAGCGATCAAATTATCGCTAGTATGTGAG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTAACTGTATTTCTCTCTGTATTGATTGCATCGCTAGTTTAATAGCGATCATACACTC / / / / // / / // / | BsmAI | | || MboI TspEI |MaeI SetI BsaXI | | || PsrI MnlI Hin4I | | |DpnI | | BstKTI | MaeII TaiI SetI V I D I K R D I T N V A I K L S L V C E S L T * R E T * L T * R S N Y R * Y V R H * H K E R H N * R S D Q I I A S M * G ----:----|----:----|----:----|----:----|----:----|----:----| T M S M F L S M V L T A I L N D S T H S P * Q C L S L C L * R L S * I I A L I H D N V Y L S V Y S V Y R D F * R * Y T L SetI TspEI DdeI | FnuDII* PsrI Tsp4CI* SetI MnlI | MmeI |SetI \ \ \ \ \ \ \ \ \\ GTTCGCGTGAAAACGGGGAACAGTCCAACCTCCAAGAATAAGAGAATTGAGAAAACCTTA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGCGCACTTTTGCCCCTTGTCAGGTTGGAGGTTCTTATTCTCTTAACTCTTTTGGAAT / / / / / // / / | PsrI | SetI MnlI |TspEI SetI DdeI FnuDII* Tsp4CI* MmeI V R V K T G N S P T S K N K R I E K T L F A * K R G T V Q P P R I R E L R K P * S R E N G E Q S N L Q E * E N * E N L R ----:----|----:----|----:----|----:----|----:----|----:----| T R T F V P F L G V E L F L L I S F V K P E R S F P S C D L R W S Y S F Q S F R N A H F R P V T W G G L I L S N L F G * SalI |TaqI |AccI AluI ||HindII CviJI ||Hpy166II MaeII | SetI ||| MaeII |BsaAI | | MwoI ||| | Hpy99I |SnaBI | | | CviJI ||| | |SetI || SetI | | | |DdeI ||| | |TaiI || TaiI | | | |Bpu10I \\\ \ \\ \\ \ \ \ \ \\ GAGAAGTCGACGTTTCTTTATGGACAGGACTACGTAAAGACAGCTTTTTCGGCTAAGGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTCAGCTGCAAAGAAATACCTGTCCTGATGCATTTCTGTCGAAAAAGCCGATTCCTT //// / / // / / / / / |||| MaeII | |MaeII | | MwoI | Bpu10I |||SalI | SnaBI | CviJI | DdeI ||AccI | BsaAI | AluI CviJI ||TaqI TaiI SetI ||TaiI SetI ||SetI |Hpy166II |HindII Hpy99I E K S T F L Y G Q D Y V K T A F S A K E R S R R F F M D R T T * R Q L F R L R K E V D V S L W T G L R K D S F F G * G K ----:----|----:----|----:----|----:----|----:----|----:----| S F D V N R * P C S * T F V A K E A L S L S T S T E K H V P S R L S L K K P * P L L R R K K I S L V V Y L C S K R S L F AciI | FatI | |CviAII | || NspI | || NlaIII | || | HindII | || | Hpy166II MseI \ \\ \ \ \ AAGAAACCGCATGTTGACAAAACCACCATTCTCAATGGTTTAAGCAAGGGGGAACACAGG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTGGCGTACAACTGTTTTGGTGGTAAGAGTTACCAAATTCGTTCCCCCTTGTGTCC / // / / / | || Hpy166II MseI SetI | || HindII | |FatI | CviAII NlaIII AciI NspI K K P H V D K T T I L N G L S K G E H R R N R M L T K P P F S M V * A R G N T G E T A C * Q N H H S Q W F K Q G G T Q V ----:----|----:----|----:----|----:----|----:----|----:----| F F G C T S L V V M R L P K L L P S C L F S V A H Q C F W W E * H N L C P P V C L F R M N V F G G N E I T * A L P F V P AluI CviJI Ecl136II | SetI | SduI MnlI | SacI SetI | BsiI* | HgiAI* TaqI | BciVI | | MnlI | HgiJII* AsuII \ \ \ \ \ \ \ \ TTTCCCTTTAGGATACGAATACCACGAGGCAGAGGAATGTTGAGCTCTATAAAGTTCGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGGGAAATCCTATGCTTATGGTGCTCCGTCTCCTTACAACTCGAGATATTTCAAGCTT / / / / / / / BciVI MnlI | BsiI* | Ecl136II AsuII MnlI | CviJI TaqI | AluI HgiJII* HgiAI* SacI SduI SetI F P F R I R I P R G R G M L S S I K F E F P L G Y E Y H E A E E C * A L * S S K S L * D T N T T R Q R N V E L Y K V R K ----:----|----:----|----:----|----:----|----:----|----:----| N G K L I R I G R P L P I N L E I F N S T E R * S V F V V L C L F T S S * L T R K G K P Y S Y W S A S S H Q A R Y L E F CviJI | TaqI | SduI CviRI* TfiI | HgiJII* | MnlI HinfI MnlI \ \ \ \ \ \ AGGGGCTCGATAACATACTTCCTCTCTTGCACTTTAGAATCCCTCAACAACATCAACGGA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCCGAGCTATTGTATGAAGGAGAGAACGTGAAATCTTAGGGAGTTGTTGTAGTTGCCT / / / // / / | | TaqI |MnlI HinfI MnlI | CviJI CviRI* TfiI HgiJII* SduI R G S I T Y F L S C T L E S L N N I N G G A R * H T S S L A L * N P S T T S T D G L D N I L P L L H F R I P Q Q H Q R I ----:----|----:----|----:----|----:----|----:----|----:----| L P E I V Y K R E Q V K S D R L L M L P F P S S L M S G R K C K L I G * C C * R P A R Y C V E E R A S * F G E V V D V S AciI | NspBII* | | BbvI | | | MnlI | | | AcyI | | | MaeII | | | |ZraI | | | || SetI | | | || TaiI | | | || AatII BetI* | | | || |AvaI |SfaNI MaeII | | | || |XhoI |HpaII | SetI | | | || |SmlI MseI ||TspGWI | TaiI CviRI* | | | || |Hpy178III* \ \\\ \ \ \ \ \ \ \\ \\ TTAAAAAAACCGGAAGCAAGATGCGAACGTGAGTTTGCAGTCATAGTTCCGCTGGACGTC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTTTTTGGCCTTCGTTCTACGCTTGCACTCAAACGTCAGTATCAAGGCGACCTGCAG / / /// / / / / / // MseI | ||SfaNI | MaeII CviRI* | | |MaeII | |BetI* TaiI | | |AcyI | HpaII SetI | | ZraI TspGWI | | BbvI | AatII | TaiI | SetI | MnlI NspBII* AciI L K K P E A R C E R E F A V I V P L D V * K N R K Q D A N V S L Q S * F R W T S K K T G S K M R T * V C S H S S A G R L ----:----|----:----|----:----|----:----|----:----|----:----| N F F G S A L H S R S N A T M T G S S T I L F V P L L I R V H T Q L * L E A P R * F F R F C S A F T L K C D Y N R Q V D TaqI BmeT110I | BsmAI | Esp3I | | TseI | | CviJI | | |BisI AsuI* | | ||BlsI AvaII | | ||| MwoI Tsp4CI* |SfaNI | | ||| | CviJI DdeI | TspRI |BmgT120I \ \ \\\ \ \ \ \ \ \\ TCGAGGCTGCCCAAGCCGAAAACTAAGACAGTGGTTTTACAATCAGCATCTATGGTCCAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGCTCCGACGGGTTCGGCTTTTGATTCTGTCACCAAAATGTTAGTCGTAGATACCAGGTT /// //// / / / // / ||| |||MwoI CviJI | Tsp4CI* || SfaNI ||| |||TseI TspRI |AvaII ||| ||BisI DdeI |AsuI* ||| |Esp3I BmgT120I ||| |BsmAI ||| |BlsI ||| CviJI ||SmlI ||XhoI ||AvaI |BmeT110I |TaqI Hpy178III* S R L P K P K T K T V V L Q S A S M V Q R G C P S R K L R Q W F Y N Q H L W S K E A A Q A E N * D S G F T I S I Y G P K ----:----|----:----|----:----|----:----|----:----|----:----| E L S G L G F V L V T T K C D A D I T W R S A A W A S F * S L P K V I L M * P G R P Q G L R F S L C H N * L * C R H D L AccI |BssNAI |Hpy166II ||MnlI Hin4I ||| Hin4I | MnlI ||| |TspEI | |Hin4I TfiI ||| || Hin4I | ||SfeI* HinfI ||| || |MseI \ \\\ \ \\\ \\ \\ AACAAAAAGAACAAATCTACAGAGGACGAATCCTCATCGTATACACAATTAACTCAAAAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTGTTTTTCTTGTTTAGATGTCTCCTGCTTAGGAGTAGCATATGTGTTAATTGAGTTTTC / / / / / //// // | | MnlI SfeI* HinfI |||Hin4I |MseI | Hin4I TfiI ||AccI TspEI Hin4I |Hpy166II |BssNAI |MnlI Hin4I N K K N K S T E D E S S S Y T Q L T Q K T K R T N L Q R T N P H R I H N * L K S Q K E Q I Y R G R I L I V Y T I N S K V ----:----|----:----|----:----|----:----|----:----|----:----| F L F F L D V S S S D E D Y V C N V * F F C F S C I * L P R I R M T Y V I L E F V F L V F R C L V F G * R I C L * S L L AcyI MaeII AccI |ZraI |Hpy166II || SetI || MboII BslFI || TaiI || | TspEI MaeI | Hpy166II || AatII \\ \ \ \ \ \ \\ \ TCTACTACTTCTAATTCTTCTAGCAGTTCAGTAAACTCCAAGACGTCCCCCTTACCAAAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGATGATGAAGATTAAGAAGATCGTCAAGTCATTTGAGGTTCTGCAGGGGGAATGGTTTA // / / / // / // || MboII TspEI MaeI |BslFI | |MaeII |AccI Hpy166II | |AcyI Hpy166II | ZraI AatII TaiI SetI S T T S N S S S S S V N S K T S P L P N L L L L I L L A V Q * T P R R P P Y Q I Y Y F * F F * Q F S K L Q D V P L T K * ----:----|----:----|----:----|----:----|----:----|----:----| D V V E L E E L L E T F E L V D G K G F T * * K * N K * C N L L S W S T G R V L R S S R I R R A T * Y V G L R G G * W I HphI | AccI | |Hpy166II | || AciI | || | TspDTI | || | | Cac8I | || | | | CviJI | || | | | BsiYI* | || | | | | TfiI | || | | | | HinfI | || | | | | | FatI TspGWI | || | | | | | BspHI MaeIII | || | | | | | |CviAII Tsp45I | || | | | | | |Hpy178III* Tsp4CI* | || | | | | | || NlaIII TspEI \ \ \\ \ \ \ \ \ \\ \ \ AAAACGGTGACTATATCCGTAGACATACCGCAGGCTGGATTCATGATTGGTGAAATTATC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGCCACTGATATAGGCATCTGTATGGCGTCCGACCTAAGTACTAACCACTTTAATAG // / / // / /// / / // / / || | | |AccI | ||| CviJI | |BspHI | HphI || | | | | ||Cac8I | |FatI TspEI || | | | | |BsiYI* | Hpy178III* || | | | | AciI | CviAII || | | | TspDTI NlaIII || | | Hpy166II HinfI || | HphI TfiI || Tsp45I || MaeIII |Tsp4CI* TspGWI K T V T I S V D I P Q A G F M I G E I I K R * L Y P * T Y R R L D S * L V K L S N G D Y I R R H T A G W I H D W * N Y P ----:----|----:----|----:----|----:----|----:----|----:----| L V T V I D T S M G C A P N M I P S I I Y F P S * I R L C V A P Q I * S Q H F * F R H S Y G Y V Y R L S S E H N T F N D MaeII | MseI HphI | SetI HphI BsmAI |SfeI* | TaiI CviJI FauI |AciI Eco31I \\ \ \ \ \ \\ \ CCTATAGACGTTAAGATTGACCACTATAAGCCTTTCTATGCCCCTGCGGGTCTCACCACC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGATATCTGCAATTCTAACTGGTGATATTCGGAAAGATACGGGGACGCCCAGAGTGGTGG // / / / / / / / || | MseI CviJI | | AciI Eco31I || MaeII | HphI BsmAI |TaiI FauI BstXI |SetI SfeI* P I D V K I D H Y K P F Y A P A G L T T L * T L R L T T I S L S M P L R V S P P Y R R * D * P L * A F L C P C G S H H H ----:----|----:----|----:----|----:----|----:----|----:----| G I S T L I S W * L G K * A G A P R V V G * L R * S Q G S Y A K R H G Q P D * W R Y V N L N V V I L R E I G R R T E G G CviRI* |MwoI ||Cac8I ||| BinI* ||| | MboI MnlI ||| | | DpnI |BstXI ||| | | |BstKTI ||OliI ||| | | ||BsmAI ||MslI HphI AciI ||| | | ||| BsgI \\\ \ \ \\\ \ \ \\\ \ ACTTTGGTGAGGATATGTAGGGTGGGCGGTGCAGGCAAAGATGATCCTATGGAGACTTTC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAACCACTCCTATACATCCCACCCGCCACGTCCGTTTCTACTAGGATACCTCTGAAAG / / / // / / / // / / / / | MslI HphI || | | | || | | BsmAI Hpy188I | OliI || | | | || | BsgI MnlI || | | | || MboI || | | | |DpnI || | | | BstKTI || | | BinI* || | Cac8I || CviRI* |MwoI AciI T L V R I C R V G G A G K D D P M E T F L W * G Y V G W A V Q A K M I L W R L S F G E D M * G G R C R Q R * S Y G D F Q ----:----|----:----|----:----|----:----|----:----|----:----| V K T L I H L T P P A P L S S G I S V K W K P S S I Y P P R H L C L H D * P S K S Q H P Y T P H A T C A F I I R H L S E AclI MaeII MseI | SetI BplI | BplI | TaiI Hpy188I BplI Hpy188I | BplI | | CviRI* \ \ \ \ \ \ \ \ AGAAAAGATATATGTCAGAGTATCTCTCCTATATATATTAACCCTGAAACGTTGCAGTTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTTCTATATACAGTCTCATAGAGAGGATATATATAATTGGGACTTTGCAACGTCAAA / / / / / / / BplI Hpy188I | MseI | | CviRI* BplI BplI | MaeII BplI | AclI TaiI SetI R K D I C Q S I S P I Y I N P E T L Q F E K I Y V R V S L L Y I L T L K R C S F K R Y M S E Y L S Y I Y * P * N V A V S ----:----|----:----|----:----|----:----|----:----|----:----| L F S I H * L I E G I Y I L G S V N C N * F L Y I D S Y R E * I Y * G Q F T A T S F I Y T L T D R R Y I N V R F R Q L K XbaI CviRI* |MaeI Hpy188I | EcoT22I |Hpy178III* | SfaNI | | TaqI || FalI | | SduI | | | FalI || FalI | | BseSI | | | FalI Tsp4CI* \\ \ \ \ \ \ \ \ \ \ CAATCTAGAGTTTATCTGAAAGTGCCCCTTGATGCATTTTCGACCCTTACTACTGTGGGA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAGATCTCAAATAGACTTTCACGGGGAACTACGTAAAAGCTGGGAATGATGACACCCT /// / / / / / / / / ||XbaI | | SfaNI | | | TaqI Tsp4CI* || | BseSI | | FalI || | SduI | | FalI || Hpy188I | CviRI* |Hpy178III* EcoT22I |MaeI FalI FalI Q S R V Y L K V P L D A F S T L T T V G N L E F I * K C P L M H F R P L L L W E I * S L S E S A P * C I F D P Y Y C G K ----:----|----:----|----:----|----:----|----:----|----:----| * D L T * R F T G R S A N E V R V V T P E I * L K D S L A G Q H M K S G * * Q P L R S N I Q F H G K I C K R G K S S H S MnlI MseI Hin4II* |HpaI MaeII ApoI | TsoI |HindII | SetI TspEI | |TaqI SetI |Hpy166II | TaiI \ \ \\ \ \\ \ \ AAATTTTTCTCCTTCCAATACTATATCGAGGTTATGGTTAACTTATCAAAAAAAAACGTG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAAAAGAGGAAGGTTATGATATAGCTCCAATACCAATTGAATAGTTTTTTTTTGCAC / / / / // / / TspEI | TsoI TaqI |MseI | MaeII ApoI Hin4II* SetI Hpy166II TaiI MnlI HindII SetI HpaI K F F S F Q Y Y I E V M V N L S K K N V N F S P S N T I S R L W L T Y Q K K T W I F L L P I L Y R G Y G * L I K K K R G ----:----|----:----|----:----|----:----|----:----|----:----| F N K E K W Y * I S T I T L K D F F F T F I K R R G I S Y R P * P * S I L F F R F K E G E L V I D L N H N V * * F F V H Hpy166II | TfiI | HinfI CviJI \ \ \ GTTTACACAGAATCTAATAGAATAATAGGAACTCCTATTGGAGAACAAAATGGCTTGGGC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CAAATGTGTCTTAGATTATCTTATTATCCTTGAGGATAACCTCTTGTTTTACCGAACCCG / / / Hpy166II HinfI CviJI TfiI V Y T E S N R I I G T P I G E Q N G L G F T Q N L I E * * E L L L E N K M A W A L H R I * * N N R N S Y W R T K W L G R ----:----|----:----|----:----|----:----|----:----|----:----| T * V S D L L I I P V G I P S C F P K P P K C L I * Y F L L F E * Q L V F H S P N V C F R I S Y Y S S R N S F L I A Q A MaeII |BsaAI |SnaBI ||MmeI Hpy178III* |||SetI | AclI Tsp4CI* BciVI |||TaiI | MaeII \ \ \\\\ \ \ GTAGAGAATAATATCAACCGTATCCAAAGGAAAATGCTACGTATGGTCAATCCAGAAACG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CATCTCTTATTATAGTTGGCATAGGTTTCCTTTTACGATGCATACCAGTTAGGTCTTTGC / / //// / / / Tsp4CI* BciVI |||MaeII | | MaeII ||SnaBI | | AclI ||BsaAI | TaiI |MmeI | SetI TaiI Hpy178III* SetI V E N N I N R I Q R K M L R M V N P E T * R I I S T V S K G K C Y V W S I Q K R R E * Y Q P Y P K E N A T Y G Q S R N V ----:----|----:----|----:----|----:----|----:----|----:----| T S F L I L R I W L F I S R I T L G S V R L S Y Y * G Y G F S F A V Y P * D L F Y L I I D V T D L P F H * T H D I W F R SetI TaiI | BseMII | |BspCNI | || MnlI | || |TfiI | || |HinfI TfiI | || || DdeI HinfI | || || |Hpy188I | BsrI TspDTI \ \\ \\ \\ \ \ \ TTGGAGAACGATTCTGAGGGTTATGAATCCAGTATATTTTTCAAAGATATGGTAAATGTG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AACCTCTTGCTAAGACTCCCAATACTTAGGTCATATAAAAAGTTTCTATACCATTTACAC // / // / // / || MnlI || DdeI |HinfI TspDTI |BspCNI |Hpy188I |TfiI BseMII HinfI BsrI TfiI L E N D S E G Y E S S I F F K D M V N V W R T I L R V M N P V Y F S K I W * M W G E R F * G L * I Q Y I F Q R Y G K C G ----:----|----:----|----:----|----:----|----:----|----:----| N S F S E S P * S D L I N K L S I T F T T P S R N Q P N H I W Y I K * L Y P L H Q L V I R L T I F G T Y K E F I H Y I H AluI BsmAI CviJI |BseMII ||SetI ||BspCNI ||| MnlI DdeI MaeIII BsrI Tsp4CI* BinI* \\\ \ \ \ \ \ \ GAAAAGCTAAAGAGACTGAGGAATGTAACTGGTATGTCCATAGAAACCGTCATAGGAACG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTCGATTTCTCTGACTCCTTACATTGACCATACAGGTATCTTTGGCAGTATCCTTGC /// / / / / / / / ||| BsmAI DdeI | BsrI Tsp4CI* | BinI* ||| MnlI MaeIII Hpy99I ||BspCNI ||CviJI ||AluI |BseMII SetI E K L K R L R N V T G M S I E T V I G T K S * R D * G M * L V C P * K P S * E R K A K E T E E C N W Y V H R N R H R N D ----:----|----:----|----:----|----:----|----:----|----:----| S F S F L S L F T V P I D M S V T M P V P F A L S V S S H L Q Y T W L F R * L F F L * L S Q P I Y S T H G Y F G D Y S R Hpy99I |MboI FokI |XhoII Hpy188I || DpnI | BbvI || |AlfI | |CviRI* || |AlfI | || Cac8I || |BstKTI | || | BseGI || || Hpy188I | || | | BseGI || || | TseI | || | | | AlfI || || | SfaNI | || | | | AlfI || || | |BisI | || | | | SfaNI MnlI || || | ||BlsI | || | | | | EcoP15I |CviJI || || | ||| FokI | || | | | | | BccI BseRI ||NlaIV \\ \\ \ \\\ \ \ \\ \ \ \ \ \ \ \ \\\ ACGAGATCCGAACAGCAGCAATCTGATGCAAGCATCCCATCCCAATCCTCAATCACGGCT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTCTAGGCTTGTCGTCGTTAGACTACGTTCGTAGGGTAGGGTTAGGAGTTAGTGCCGA // / //// / / // / / // / / // || Hpy188I |||| | | || | AlfI || BseRI | |NlaIV || XhoII |||| | | || | AlfI |BccI | CviJI || MboI |||| | | || BseGI EcoP15I MnlI |DpnI |||| | | |BbvI SfaNI BstKTI |||| | | Cac8I AlfI |||| | | BseGI AlfI |||| | CviRI* |||| | FokI |||| Hpy188I |||| FokI |||SfaNI ||TseI |BisI BlsI T R S E Q Q Q S D A S I P S Q S S I T A R D P N S S N L M Q A S H P N P Q S R L E I R T A A I * C K H P I P I L N H G S ----:----|----:----|----:----|----:----|----:----|----:----| V L D S C C C D S A L M G D W D E I V A S S I R V A A I Q H L C G M G I R L * P R S G F L L L R I C A D W G L G * D R S ApoI TspEI | MnlI | BceAI AsuI* | | TaqI |CviJI CviRI* | | | ApoI |HaeIII | NdeI | | | TspEI |BmgT120I | EcoT22I | | | | BccI ||NlaIV | | MaeIII | | | | |MseI ||| MseI | | Tsp45I \ \ \ \ \\ \\\ \ \ \ \ CCTCAAAATTCTCCATCGAATTTAAGAGATTGGTTGGCCCCATTAAATGCATATGATAGT 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GGAGTTTTAAGAGGTAGCTTAAATTCTCTAACCAACCGGGGTAATTTACGTATACTATCA / / / / / /// / / / / | | | | MseI ||AsuI* | | | NdeI | | | TspEI || | | CviRI* | | | BccI || | EcoT22I | | | ApoI || MseI | | TaqI |BmgT120I | BceAI |NlaIV TspEI HaeIII MnlI CviJI ApoI P Q N S P S N L R D W L A P L N A Y D S L K I L H R I * E I G W P H * M H M I V S K F S I E F K R L V G P I K C I * * * ----:----|----:----|----:----|----:----|----:----|----:----| G * F E G D F K L S Q N A G N F A Y S L E E F N E M S N L L N T P G M L H M H Y R L I R W R I * S I P Q G W * I C I I T Csp6I Hpy166II |RsaI ||TspRI ||| Tsp4CI* ||| | Hpy99I BsrI MmeI ||| | Hpy188I \ \ \\\ \ \ GACGATGTTCCAGTTCCAAAGTATTCGCCAAATGATAAAGTCAGTGTACCGTCGGAAGAC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTACAAGGTCAAGGTTTCATAAGCGGTTTACTATTTCAGTCACATGGCAGCCTTCTG / / / / //// / | BsrI MmeI TspRI |||| Hpy188I Tsp45I |||Tsp4CI* MaeIII |||Hpy99I ||Csp6I |RsaI Hpy166II D D V P V P K Y S P N D K V S V P S E D T M F Q F Q S I R Q M I K S V Y R R K T R C S S S K V F A K * * S Q C T V G R Q ----:----|----:----|----:----|----:----|----:----|----:----| S S T G T G F Y E G F S L T L T G D S S H R H E L E L T N A L H Y L * H V T P L V I N W N W L I R W I I F D T Y R R F V Tsp4CI* | BinI* | | MboI BbvII* | | | DpnI | MboII | | | |BstKTI MnlI \ \ \ \ \ \\ \ AAACAAGAACTTGAACAAAAAAGACTACAACAGTTAGAAAGCGATCCTCCCCCTTGTGAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGTTCTTGAACTTGTTTTTTCTGATGTTGTCAATCTTTCGCTAGGAGGGGGAACACTA / / / // / / BbvII* | | || MboI MnlI MboII | | |DpnI | | BstKTI | BinI* Tsp4CI* K Q E L E Q K R L Q Q L E S D P P P C D N K N L N K K D Y N S * K A I L P L V M T R T * T K K T T T V R K R S S P L * * ----:----|----:----|----:----|----:----|----:----|----:----| L C S S S C F L S C C N S L S G G G Q S C V L V Q V F F V V V T L F R D E G K H F L F K F L F S * L L * F A I R G R T I MseI \ GACTATTAA ----:---- CTGATAATT / MseI D Y * T I X L L X ----:---- S * * H S N V I L # Enzymes that cut Frequency Isoschizomers AatII 2 AccI 4 FblI,XmiI AciI 7 BspACI,SsiI AclI 2 Psp1406I AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AlfI 4 AluI 3 AluBI ApoI 3 AcsI,XapI AsuI* 3 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 3 BceAI 2 BciVI 2 BfuI BetI* 2 BsaWI BinI* 3 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmeT110I 1 BmgT120I 3 BplI 2 Bpu10I 1 BsaAI 2 BstBAI,Ppu21I BsaXI 1 BseGI 2 BstF5I,BtsCI BseMII 2 BseRI 1 BseSI 2 BaeGI,BstSLI BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 6 Alw26I,BstMAI BspCNI 2 BspHI 1 CciI,PagI,RcaI BsrI 3 BseNI,Bse1I,BsrSI BssNAI 1 Bst1107I,BstZ17I BstKTI 4 BstXI 1 Cac8I 5 BstC8I Csp6I 1 CviQI,RsaNI CviAII 4 CviJI 13 CviKI-1 CviRI* 7 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 4 MalI Ecl136II 1 EcoICRI Eco31I 1 Bso31I,BspTNI,BsaI EcoP15I 1 EcoT22I 2 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FalI 2 FatI 4 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 2 Eco24I,EcoT38I,FriOI,BanII Hin4I 3 Hin4II* 1 HpyAV HindII 3 HincII HinfI 8 HpaI 1 KspAI HpaII 2 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 9 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 7 Hpy99I 3 MaeI 3 FspBI,BfaI,XspI MaeII 12 HpyCH4IV MaeIII 5 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MlyI 1 SchI MmeI 3 MnlI 16 MseI 9 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 2 BstNSI,XceI OliI 1 AleI PleI 1 PpsI PsrI 1 RsaI 1 AfaI SacI 1 Psp124BI,SstI SalI 1 SduI 4 MhlI,Bsp1286I SetI 20 SfaNI 5 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SnaBI 2 Eco105I,BstSNI SphI 1 PaeI,BbuI TaiI 12 TaqI 7 TfiI 7 PfeI TseI 2 ApeKI TsoI 1 Tsp45I 2 NmuCI Tsp4CI* 9 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 9 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 2 TscAI XbaI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I ZraI 2 # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AbsI Acc65I AflII AflIII AgeI AhaIII* AjuI AloI AlwNI ApaI ApaLI AscI Asp718I AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BcgI BclI BdaI BfiI BglI BglII BmtI BsaBI BseBI BsePI BseYI BsmI Bsp120I Bsp1407I BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI Bst2UI BstAPI BstEII BstNI BstOI BstSCI BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Eco47III Eco57I Eco57MI EcoNI EcoRI EcoRII EcoRV EgeI EheI EspI* FseI FspAI GlaI GsaI GsuI HaeII HgaI HhaI Hin6I HindIII HinP1I HspAI KasI KpnI Ksp632I* MauBI McrI* MfeI MluI MroNI MstI* MvaI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PstI PvuI PvuII RsrII SacII SanDI SapI SauI* ScaI ScrFI SecI* SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SplI* SrfI Sse232I* Sse8387I SspI StuI StyD4I StyI SwaI TaqII TatI TauI TspMI TstI Tth111I VspI XcmI XmaCI XmaI XmaIII* XmnI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769