Restriction Map of HEM2/YGL040C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

HEM2/YGL040C on chromosome VII from coordinates 420555 to 419527.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 CviRI* | EcoT22I | | AluI | | CviJI | | PvuII AarI | | NspBII* BspMI | | | SetI | EcoP15I | | | |ApoI | | TsoI | | | |TspEI | | | MaeI SetI \ \ \ \\ \ \ \ \ \ ATGCATACAGCTGAATTTTTGGAAACAGAACCAACAGAAATCTCATCTGTTCTAGCAGGT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTATGTCGACTTAAAAACCTTTGTCTTGGTTGTCTTTAGAGTAGACAAGATCGTCCA / / / / / / / / / / | | | | TspEI | | | | HphI | | | | ApoI | | | SetI | | | NspBII* | | MaeI | | | PvuII | EcoP15I | | | CviJI | BspMI | | | AluI | AarI | | SetI TsoI | CviRI* EcoT22I M H T A E F L E T E P T E I S S V L A G C I Q L N F W K Q N Q Q K S H L F * Q V A Y S * I F G N R T N R N L I C S S R W ----:----|----:----|----:----|----:----|----:----|----:----| X C V A S N K S V S G V S I E D T R A P X A Y L Q I K P F L V L L F R M Q E L L H M C S F K Q F C F W C F D * R N * C T BseMII FatI |BspCNI TaqII AflIII || BtsI Tsp4CI* BspLU11I* || | BsmAI | HgaI HindII |CviAII HphI || | | DdeI | | TspRI Hpy166II || NspI | PsiI || | | |TspRI | | | MwoI | DdeI || NlaIII \ \ \\ \ \ \\ \ \ \ \ \ \ \\ \ GGTTATAATCACCCACTGCTGAGACAGTGGCAAAGTGAGCGTCAACTGACTAAGAACATG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCAATATTAGTGGGTGACGACTCTGTCACCGTTTCACTCGCAGTTGACTGATTCTTGTAC / // / / / // / / / / // | || TspRI | | |Tsp4CI* MwoI Hpy166II | | |BspLU11I* | || BtsI | | TaqII HgaI HindII | | |AflIII | |BspCNI | TspRI | | |FatI | BseMII | DdeI | | CviAII PsiI BsmAI | NlaIII | NspI DdeI G Y N H P L L R Q W Q S E R Q L T K N M V I I T H C * D S G K V S V N * L R T C L * S P T A E T V A K * A S T D * E H V ----:----|----:----|----:----|----:----|----:----|----:----| P * L * G S S L C H C L S R * S V L F M H N Y D G V A S V T A F H A D V S * S C T I I V W Q Q S L P L T L T L Q S L V H MlyI PleI TspDTI Hpy188I |TspEI | AciI | Hpy178III* || HinfI \ \ \ \ \\ \ TTGATTTTTCCGCTATTCATCTCCGATAATCCAGATGACTTTACTGAAATTGACTCTCTA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AACTAAAAAGGCGATAAGTAGAGGCTATTAGGTCTACTGAAATGACTTTAACTGAGAGAT / / / / // / / / TspDTI AciI Hpy188I Hpy178III* || | | SetI || | HinfI || TspEI |PleI MlyI L I F P L F I S D N P D D F T E I D S L * F F R Y S S P I I Q M T L L K L T L Y D F S A I H L R * S R * L Y * N * L S T ----:----|----:----|----:----|----:----|----:----|----:----| N I K G S N M E S L G S S K V S I S E R T S K E A I * R R Y D L H S * Q F Q S E Q N K R * E D G I I W I V K S F N V R * CfrI | BalI | CviJI | HaeIII TfiI | |StyI SetI HinfI CviJI MseI CviJI | |SecI* \ \ \ \ \ \ \\ CCTAATATCAATAGAATCGGTGTAAATAGGCTAAAAGACTACTTAAAGCCATTAGTGGCC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GGATTATAGTTATCTTAGCCACATTTATCCGATTTTCTGATGAATTTCGGTAATCACCGG / / / / / / HinfI CviJI | CviJI | CfrI TfiI MseI HaeIII CviJI BalI P N I N R I G V N R L K D Y L K P L V A L I S I E S V * I G * K T T * S H * W P * Y Q * N R C K * A K R L L K A I S G Q ----:----|----:----|----:----|----:----|----:----|----:----| G L I L L I P T F L S F S * K F G N T A V * Y * Y F R H L Y A L L S S L A M L P R I D I S D T Y I P * F V V * L W * H G BseGI | BssKI | SecI* | EcoRII | | MnlI | | ScrFI | | BseBI | | | Acc65I | | | HgiCI* | | | |Csp6I | | | ||RsaI | | | ||NlaIV | | | |||BinI* | | | ||||StyI | | | ||||KpnI | | | ||||SecI* | | | ||||| MboI | | | ||||| BamHI | | | ||||| XhoII | | | ||||| | DpnI MboI | | | ||||| | NlaIV | DpnI | | | ||||| | |XcmI | |BstKTI | | | ||||| | |BstKTI | || FokI | | | ||||| | ||BsrI \ \\ \ \ \ \ \\\\\ \ \\\ AAGGGTTTGCGTTCTGTGATCTTGTTTGGTGTGCCTCTCATCCCTGGTACCAAGGATCCA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCCAAACGCAAGACACTAGAACAAACCACACGGAGAGTAGGGACCATGGTTCCTAGGT / // / / / / ////// /// / SecI* || MboI FokI BseGI | |||||| ||| XhoII StyI |DpnI | |||||| ||| BamHI BstKTI | |||||| ||| MboI | |||||| ||NlaIV | |||||| ||TspRI | |||||| ||XcmI | |||||| ||DpnI | |||||| ||BsrI | |||||| |BstKTI | |||||| SecI* | |||||| StyI | |||||HgiCI* | |||||Acc65I | |||||BinI* | ||||Csp6I | |||NlaIV | |||RsaI | ||EcoRII | ||BssKI | |SecI* | |KpnI | BseBI | ScrFI MnlI K G L R S V I L F G V P L I P G T K D P R V C V L * S C L V C L S S L V P R I Q G F A F C D L V W C A S H P W Y Q G S S ----:----|----:----|----:----|----:----|----:----|----:----| L P K R E T I K N P T G R M G P V L S G W P N A N Q S R T Q H A E * G Q Y W P D L T Q T R H D Q K T H R E D R T G L I W BinI* | Csp6I | TspRI | |RsaI | || AciI | || NspBII* | || |BisI | || ||BlsI | || |||TauI | || |||BinI* | || |||CviJI | || |||AlwNI | || |||| MboI | || |||| | DpnI | || |||| | |BstKTI | || |||| | || SfeI* | || |||| | || | CviRI* | || |||| | || | | PstI | || |||| | || | | Sse8387I | || |||| | || | | |AsuI* TspDTI | || |||| | || | | ||BmgT120I | SetI | || |||| | || | | |||CviJI | | MseI | || |||| | || | | |||HaeIII | | | ApoI | || |||| | || | | ||||BsrI | | | TspEI Hpy178III* \ \\ \\\\ \ \\ \ \ \\\\\ \ \ \ \ \ GTGGGTACAGCGGCTGACGATCCTGCAGGGCCAGTCATTCAAGGTATTAAATTCATTCGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CACCCATGTCGCCGACTGCTAGGACGTCCCGGTCAGTAAGTTCCATAATTTAAGTAAGCA / // ///// // // / / /// // / / / | || ||||| || || | | ||AsuI* |SetI | TspEI Hpy178III* | || ||||| || || | | |BmgT120I TspDTI | ApoI | || ||||| || || | | |HaeIII MseI | || ||||| || || | | |CviJI | || ||||| || || | | BsrI | || ||||| || || | SfeI* | || ||||| || || CviRI* | || ||||| || |Sse8387I | || ||||| || |PstI | || ||||| || MboI | || ||||| |DpnI | || ||||| BstKTI | || ||||BinI* | || |||CviJI | || ||BisI | || ||AciI | || |BlsI | || NspBII* | || AlwNI | || TauI | |Csp6I | RsaI BinI* V G T A A D D P A G P V I Q G I K F I R W V Q R L T I L Q G Q S F K V L N S F V G Y S G * R S C R A S H S R Y * I H S * ----:----|----:----|----:----|----:----|----:----|----:----| T P V A A S S G A P G T M * P I L N M R L P Y L P Q R D Q L A L * E L Y * I * E H T C R S V I R C P W D N L T N F E N T FatI BsmAI |CviAII Tsp4CI* |BtgZI || CfrI \ \\ \\ \ GAGTATTTCCCTGAACTGTATATTATTTGCGATGTCTGTCTCTGTGAATACACTTCTCAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTCATAAAGGGACTTGACATATAATAAACGCTACAGACAGAGACACTTATGTGAAGAGTA / // / / Tsp4CI* |BtgZI | CviAII BsmAI NlaIII E Y F P E L Y I I C D V C L C E Y T S H S I S L N C I L F A M S V S V N T L L M V F P * T V Y Y L R C L S L * I H F S W ----:----|----:----|----:----|----:----|----:----|----:----| S Y K G S S Y I I Q S T Q R Q S Y V E * H T N G Q V T Y * K R H R D R H I C K E L I E R F Q I N N A I D T E T F V S R M FauI NlaIII |BalI |CviJI |HaeIII XbaI ||BsrDI MaeII |MaeI ||| AciI Csp6I MseI | SetI |Hpy178III* ||| |BsiYI* BccI |RsaI VspI | TaiI ||BsmAI \\\ \\ \ \\ \ \ \ \\\ GGCCATTGCGGGGTTCTATACGATGATGGTACTATTAATAGAGAACGTAGTGTCTCTAGA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGTAACGCCCCAAGATATGCTACTACCATGATAATTATCTCTTGCATCACAGAGATCT //// / / / // / / / // |||| | AciI BccI |Csp6I VspI | MaeII |XbaI |||| BsiYI* RsaI MseI TaiI Hpy178III* |||CfrI SetI MaeI ||FauI |HaeIII |CviJI |BalI BsrDI FatI G H C G V L Y D D G T I N R E R S V S R A I A G F Y T M M V L L I E N V V S L D P L R G S I R * W Y Y * * R T * C L * I ----:----|----:----|----:----|----:----|----:----|----:----| P W Q P T R Y S S P V I L L S R L T E L H G N R P E I R H H Y * * Y L V Y H R * A M A P N * V I I T S N I S F T T D R S AluI CviJI | SetI | | Hin6I | | |GlaI | | |MstI* TseI | | |FspAI |BisI | | ||HhaI ||BlsI | | ||| Tsp4CI* |||AluI | | ||| | DraIII |||CviJI BbvI | | ||| | |TspRI |||PvuII |MseI | | ||| | ||BfiI |||NspBII* ||HpaI | | ||| | ||| CviJI |||| SetI ||HindII | | ||| | ||| |NlaIV |||| |MwoI ||Hpy166II | | ||| | ||| || BsrI TspRI \\\\ \\ \\\ \ \ \\\ \ \\\ \\ \ \ TTAGCAGCTGTGGCAGTTAACTACGCTAAAGCTGGTGCGCACTGTGTGGCTCCCAGTGAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AATCGTCGACACCGTCAATTGATGCGATTTCGACCACGCGTGACACACCGAGGGTCACTA / /// /// / / /// / / /// | ||NspBII* ||BbvI | CviJI ||| | | ||TspRI | ||PvuII |MseI | AluI ||| | | ||BsrI | ||CviJI Hpy166II SetI ||| | | |NlaIV | ||MwoI HindII ||| | | CviJI | ||TseI HpaI ||| | BfiI | ||AluI ||| Tsp4CI* | |BisI ||| DraIII | BlsI ||Hin6I | SetI |FspAI BsmAI |MstI* |GlaI TspRI HhaI L A A V A V N Y A K A G A H C V A P S D * Q L W Q L T T L K L V R T V W L P V I S S C G S * L R * S W C A L C G S Q * Y ----:----|----:----|----:----|----:----|----:----|----:----| N A A T A T L * A L A P A C Q T A G L S I L L Q P L * S R * L Q H A S H P E W H * C S H C N V V S F S T R V T H S G T I MboI BccI | DpnI |MboI | |BstKTI || DpnI | || Hpy188I || |TaqI | || | BinI* CviRI* || |ClaI | || | | MnlI CviJI | MwoI || |BstKTI | || | | |MseI | MseI | | CviJI \\ \\ \ \\ \ \ \\ \ \ \ \ \ ATGATCGATGGTAGGATCAGAGATATTAAACGAGGCTTAATAAATGCAAACTTGGCTCAC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TACTAGCTACCATCCTAGTCTCTATAATTTGCTCCGAATTATTTACGTTTGAACCGAGTG /// // // / // / / / / / / ||| |ClaI || | || MseI | MseI | MwoI CviJI ||| |TaqI || | |MnlI CviJI CviRI* ||| MboI || | BinI* ||DpnI || Hpy188I |BstKTI || MboI BccI |DpnI BstKTI M I D G R I R D I K R G L I N A N L A H * S M V G S E I L N E A * * M Q T W L T D R W * D Q R Y * T R L N K C K L G S Q ----:----|----:----|----:----|----:----|----:----|----:----| I I S P L I L S I L R P K I F A F K A * Y S R H Y S * L Y * V L S L L H L S P E H D I T P D S I N F S A * Y I C V Q S V Hin4II* | TseI | CviRI* TspGWI | |BisI | AsuI* | ||BlsI | |BmgT120I | |||AluI | ||BbvI | |||CviJI | ||SfaNI | ||||DdeI BbvI | ||CviJI SetI | |||||SetI |AciI | ||HaeIII \ \ \\\\\\ \\ \ \\\ AAGACCTTCGTGTTATCCTATGCAGCTAAGTTTAGCGGTAATCTATATGGGCCATTCCGT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTGGAAGCACAATAGGATACGTCGATTCAAATCGCCATTAGATATACCCGGTAAGGCA / / //// / // / // / SetI Hin4II* |||| DdeI |BbvI TspGWI || SfaNI |||CviJI AciI || BbvI |||TseI |AsuI* |||AluI BmgT120I ||BisI HaeIII |BlsI CviJI |SetI CviRI* K T F V L S Y A A K F S G N L Y G P F R R P S C Y P M Q L S L A V I Y M G H S V D L R V I L C S * V * R * S I W A I P * ----:----|----:----|----:----|----:----|----:----|----:----| L V K T N D * A A L N L P L R Y P G N R C S R R T I R H L * T * R Y D I H A M G L G E H * G I C S L K A T I * I P W E T MwoI | AluI | CviJI | | SetI | | | TaqI SetI TseI | | | AsuII HphI | Cfr10I |BisI | | | | BsiYI* MaeIII | BsiYI* ||BlsI | | | | | Hin4II* | TspEI | |HpaII \\\ \ \ \ \ \ \ \ \ \ \\ GATGCTGCTTGTTCAGCTCCTTCGAATGGTGATAGGAAATGTTACCAATTACCTCCTGCC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGACGAACAAGTCGAGGAAGCTTACCACTATCCTTTACAATGGTTAATGGAGGACGG /// / / / / / / / / / / ||| | | CviJI | | Hin4II* HphI | | BsiYI* ||| | | AluI | AsuII | TspEI ||| | SetI | TaqI | SetI ||| MwoI BsiYI* MaeIII ||TseI |BisI BlsI D A A C S A P S N G D R K C Y Q L P P A M L L V Q L L R M V I G N V T N Y L L P C C L F S S F E W * * E M L P I T S C R ----:----|----:----|----:----|----:----|----:----|----:----| S A A Q E A G E F P S L F H * W N G G A H H Q K N L E K S H H Y S I N G I V E Q I S S T * S R R I T I P F T V L * R R G MnlI |McrI* || MmeI || | BssKI || | CviJI || | EcoRII || | HaeIII || | | ScrFI || | | BseBI || | | | MaeII || | | | |BsaAI || | | | || SetI HgiCI* || | | | || TaiI | SetI Hpy99I || | | | || |MwoI Hin4II* | NlaIV Tsp4CI* \\ \ \ \ \\ \\ \ \ \ \ GGTCGTGGCCTGGCACGTAGGGCGTTGGAAAGGGATATGAGTGAAGGTGCCGACGGTATT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGCACCGGACCGTGCATCCCGCAACCTTTCCCTATACTCACTTCCACGGCTGCCATAA /// / / // // / / / / / ||MmeI | | || |MaeII Hin4II* | | | Tsp4CI* || | | || BsaAI | | HgiCI* || | | || MwoI | | Hpy99I || | | |TaiI | NlaIV || | | |SetI SetI || | | EcoRII || | | BssKI || | BseBI || | ScrFI || HaeIII || CviJI |Cfr10I HpaII McrI* MnlI G R G L A R R A L E R D M S E G A D G I V V A W H V G R W K G I * V K V P T V L S W P G T * G V G K G Y E * R C R R Y Y ----:----|----:----|----:----|----:----|----:----|----:----| P R P R A R L A N S L S I L S P A S P I R D H G P V Y P T P F P Y S H L H R R Y T T A Q C T P R Q F P I H T F T G V T N CviRI* | BseGI | | ApoI MseI Hin4II* MnlI | | TspEI | CviJI | DdeI |SfaNI | | | FokI \ \ \ \ \\ \ \ \ \ ATTGTTAAGCCTTCCACTTTCTACTTAGATATAATGAGGGATGCAAGTGAAATTTGTAAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TAACAATTCGGAAGGTGAAAGATGAATCTATATTACTCCCTACGTTCACTTTAAACATTT / / / // / / / / | CviJI Hin4II* |MnlI SfaNI CviRI* | FokI MseI DdeI BseGI TspEI ApoI I V K P S T F Y L D I M R D A S E I C K L L S L P L S T * I * * G M Q V K F V K C * A F H F L L R Y N E G C K * N L * R ----:----|----:----|----:----|----:----|----:----|----:----| I T L G E V K * K S I I L S A L S I Q L * Q * A K W K R S L Y L S P H L H F K Y N N L R G S E V * I Y H P I C T F N T F MaeIII | BsrDI | |FatI | ||CviAII | ||| TseI | ||| NspI | ||| NlaIII | ||| |BisI | ||| |SfeI* | ||| ||BlsI | ||| |||TseI | ||| |||CviRI* | ||| ||||BisI | ||| |||||BlsI MaeII | ||| |||||PstI AflIII | ||| ||||||AluI Hin6I |PmaCI | ||| ||||||CviJI |GlaI |BsaAI | ||| ||||||PvuII |MstI* || SetI | ||| ||||||NspBII* ||HhaI || TaiI BbvI | ||| ||||||| SetI \\\ \\ \ \ \ \\\ \\\\\\\ \ GACTTACCAATCTGCGCATATCACGTGTCGGGCGAATACGCAATGTTACATGCTGCAGCT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAATGGTTAGACGCGTATAGTGCACAGCCCGCTTATGCGTTACAATGTACGACGTCGA /// / // / / / // //////// ||Hin6I | || AflIII | | || |||||||NspBII* |MstI* | |MaeII | | || |||||||PvuII |GlaI | BsaAI | | || |||||||CviJI HhaI | PmaCI | | || |||||||TseI TaiI | | || |||||||AluI SetI | | || ||||||SfeI* | | || ||||||BisI | | || |||||BlsI | | || |||||SetI | | || ||||CviRI* | | || ||||TseI | | || |||BisI | | || ||BlsI | | || ||PstI | | || |FatI | | || CviAII | | |MaeIII | | NlaIII | | NspI | BsrDI BbvI D L P I C A Y H V S G E Y A M L H A A A T Y Q S A H I T C R A N T Q C Y M L Q L L T N L R I S R V G R I R N V T C C S * ----:----|----:----|----:----|----:----|----:----|----:----| S K G I Q A Y * T D P S Y A I N C A A A L S V L R R M D R T P R I R L T V H Q L V * W D A C I V H R A F V C H * M S C S BdaI BdaI MnlI |MfeI |SetI |TspEI || FauI || BbvII* || SmlI || | MboII || Hpy178III* BbvI || | | TfiI || | BdaI | SetI || | | HinfI || | BdaI \ \ \\ \ \ \ \\ \ \ GAAAAAGGTGTTGTTGATTTGAAGACAATTGCCTTTGAATCTCATCAAGGTTTCTTGAGG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTCCACAACAACTAAACTTCTGTTAACGGAAACTTAGAGTAGTTCCAAAGAACTCC / / / / / / / / /// SetI BbvI BdaI | BbvII* HinfI | MnlI ||SmlI BdaI | MboII TfiI SetI |Hin4I TspEI |Hin4I MfeI |BdaI |BdaI Hpy178III* FauI E K G V V D L K T I A F E S H Q G F L R K K V L L I * R Q L P L N L I K V S * G K R C C * F E D N C L * I S S R F L E G ----:----|----:----|----:----|----:----|----:----|----:----| S F P T T S K F V I A K S D * * P K K L Q F L H Q Q N S S L Q R Q I E D L N R S F F T N N I Q L C N G K F R M L T E Q P BseMII |BspCNI || CviJI || |NlaIV || || Hin4I AciI || || Hin4I |Hin4I || || Hpy178III* |Hin4I MseI || || |DdeI || HgiCI* VspI || || || TsoI || | NlaIV | Bce83I* || || || | MaeI BsrI \\ \ \ \ \ \\ \\ \\ \ \ \ GCGGGTGCCAGATTAATCATCACTTATTTGGCTCCTGAGTTCCTAGACTGGTTAGATGAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCCACGGTCTAATTAGTAGTGAATAAACCGAGGACTCAAGGATCTGACCAATCTACTT / / / / / // / // /// / / | | | | VspI || | || ||DdeI MaeI BsrI | | | | MseI || | || |TsoI | | | Bce83I* || | || Hpy178III* | | HgiCI* || | |NlaIV | NlaIV || | CviJI AciI || Hin4I || Hin4I |BspCNI BseMII A G A R L I I T Y L A P E F L D W L D E R V P D * S S L I W L L S S * T G * M K G C Q I N H H L F G S * V P R L V R * R ----:----|----:----|----:----|----:----|----:----|----:----| A P A L N I M V * K A G S N R S Q N S S P P H W I L * * K N P E Q T G L S T L H R T G S * D D S I Q S R L E * V P * I F GAAAACTAA ----:---- CTTTTGATT E N * K T X K L X ----:---- S F * L F S F V L # Enzymes that cut Frequency Isoschizomers AarI 1 Acc65I 1 Asp718I AciI 5 BspACI,SsiI AflIII 2 AluI 6 AluBI AlwNI 1 CaiI ApoI 3 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI BalI 2 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvI 5 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 2 Bce83I* 1 BpuEI BdaI 2 BfiI 1 BmrI,BmuI BinI* 4 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BmgT120I 2 BsaAI 2 BstBAI,Ppu21I BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseMII 2 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BsmAI 3 Alw26I,BstMAI BspCNI 2 BspLU11I* 1 PscI,PciI BspMI 1 BfuAI,Acc36I,BveI BsrDI 2 BseMI,Bse3DI BsrI 4 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 5 BtgZI 1 BtsI 1 Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 3 CviQI,RsaNI CviAII 3 CviJI 19 CviKI-1 CviRI* 6 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 5 MalI DraIII 1 AdeI EcoP15I 1 EcoRII 2 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 3 FauI 2 SmuI FokI 2 FspAI 1 GlaI 2 HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 3 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 4 HpyAV Hin6I 2 HinP1I,HspAI HindII 2 HincII HinfI 3 HpaI 1 KspAI HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 2 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 2 Hpy99I 1 KpnI 1 MaeI 3 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 2 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 1 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 1 MunI MlyI 1 SchI MmeI 1 MnlI 5 MseI 8 Tru1I,Tru9I MstI* 2 AviII,FspI,NsbI,Acc16I MwoI 5 HpyF10VI,BstMWI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NspBII* 4 MspA1I NspI 2 BstNSI,XceI PleI 1 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PsiI 1 AanI PstI 2 PvuII 3 RsaI 3 AfaI ScrFI 2 BmrFI,MspR9I,Bme1390I SecI* 3 BseDI,BssECI,BsaJI SetI 17 SfaNI 2 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI Sse8387I 1 SdaI,SbfI StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 2 TaqII 1 TauI 1 TfiI 2 PfeI TseI 5 ApeKI TsoI 2 Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 6 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 5 TscAI VspI 2 PshBI,AseI XbaI 1 XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI AccI AclI AcyI AflII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI AscI AvaI AvaII AvrII BaeI BarI BbvCI BceAI BcgI BciVI BclI BetI* BglI BglII BmeT110I BmtI BplI Bpu10I BsaBI BsaXI BsePI BseRI BseSI BseYI BsgI BsiI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspHI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtrI Cac8I CauII* Cfr9I CspCI DinI DraII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoRV EgeI EheI Esp3I EspI* FalI FaqI FnuDII* FseI GsaI GsuI HaeII HgiAI* HgiJII* HindIII KasI Ksp632I* MauBI MluI MroNI MslI NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI OliI PacI PasI PflMI PfoI PmeI PpiI PpuMI PshAI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SduI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* SspI StuI SwaI TatI Tsp45I TspMI TstI Tth111I XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769