Restriction Map of MIG1/YGL035C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

MIG1/YGL035C on chromosome VII from coordinates 433062 to 431548.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 DrdI | Hin4I | Hin4I | | AclI | | MaeII | | | BccI MaeIII CviRI* | | | |SetI Tsp45I | CviJI | | | |TaiI | Hin4II* \ \ \ \ \ \\ \ \ ATGCAAAGCCCATATCCAATGACACAAGTGTCTAACGTTGATGATGGGTCACTATTGAAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTTTCGGGTATAGGTTACTGTGTTCACAGATTGCAACTACTACCCAGTGATAACTTC / / // / // / / / | CviJI |Hin4I | |BccI | | Hin4I CviRI* |Hin4I | MaeII | | Hin4I DrdI | AclI | Tsp45I TaiI | MaeIII SetI Hin4II* M Q S P Y P M T Q V S N V D D G S L L K C K A H I Q * H K C L T L M M G H Y * R A K P I S N D T S V * R * * W V T I E G ----:----|----:----|----:----|----:----|----:----|----:----| X C L G Y G I V C T D L T S S P D S N F X A F G M D L S V L T * R Q H H T V I S H L A W I W H C L H R V N I I P * * Q L Hpy188I | KasI | HgiCI* | |AcyI TseI | |NarI AluI | |Hin6I CviJI | ||GlaI |BisI | ||DinI FatI ||BlsI | ||NlaIV |CviAII Hin4I ||SetI | |||HhaI || NspI Hin4I BbvI ||| MnlI | ||||HaeII || NlaIII \ \ \\\ \ \ \\\\\ \\ \ GAGAGTAAAAGCAAGTCCAAAGTAGCTGCGAAGTCAGAGGCGCCAAGACCACATGCTTGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTCATTTTCGTTCAGGTTTCATCGACGCTTCAGTCTCCGCGGTTCTGGTGTACGAACA / / ///// / ///// / // BbvI | ||||MnlI | ||||HgiCI* | |FatI | |||TseI | ||||KasI | CviAII | ||BisI | |||Hin6I NlaIII | |BlsI | |||NarI NspI | CviJI | |||AcyI | AluI | ||NlaIV SetI | ||DinI | ||GlaI | |HhaI | HaeII Hpy188I E S K S K S K V A A K S E A P R P H A C R V K A S P K * L R S Q R R Q D H M L V E * K Q V Q S S C E V R G A K T T C L S ----:----|----:----|----:----|----:----|----:----|----:----| S L L L L D L T A A F D S A G L G C A Q P S Y F C T W L L Q S T L P A L V V H K L T F A L G F Y S R L * L R W S W M S T TspDTI |FatI ||CviAII ||| NlaIII ||| | ApoI ||| | TspEI AluI BsrI ||| | EcoRI CviJI | BsmAI ||| | | BdaI | SetI | | Hpy188I ||| | | BdaI \ \ \ \ \ \\\ \ \ \ CCTATCTGTCATAGAGCTTTTCACAGACTGGAACATCAGACGAGACACATGAGAATTCAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGATAGACAGTATCTCGAAAAGTGTCTGACCTTGTAGTCTGCTCTGTGTACTCTTAAGTA / / / / / / / // / / | CviJI BsrI | | | | || | EcoRI | AluI | | | | || | TspEI SetI | | | | || | ApoI | | | | || BdaI | | | | || BdaI | | | | |FatI | | | | CviAII | | | NlaIII | | TspDTI | BsmAI Hpy188I P I C H R A F H R L E H Q T R H M R I H L S V I E L F T D W N I R R D T * E F I Y L S * S F S Q T G T S D E T H E N S Y ----:----|----:----|----:----|----:----|----:----|----:----| G I Q * L A K * L S S C * V L C M L I * D * R D Y L K E C V P V D S S V C S F E R D T M S S K V S Q F M L R S V H S N M CviJI | HphI BdaI | |MluI BdaI | |AflIII |BdaI | || FnuDII* |BdaI | || |OliI |BssKI | || |MslI |SecI* | || || MaeIII || HpaII XmnI MslI | || || Tsp45I || ScrFI |FokI | SetI | || || |MnlI || CauII* BseGI || SetI \ \ \ \\ \\ \\ \\ \ \ \\ \ ACAGGTGAGAAGCCTCACGCGTGTGACTTCCCCGGATGTGTGAAAAGGTTCAGTAGAAGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCCACTCTTCGGAGTGCGCACACTGAAGGGGCCTACACACTTTTCCAAGTCATCTTCG / / / //// // /// / // / MslI | | |||MnlI |BdaI ||| BseGI |XmnI FokI SetI | | ||| |BdaI ||BssKI SetI | | ||| | |SecI* | | ||| | |HpaII | | ||| | CauII* | | ||| | ScrFI | | ||| Tsp45I | | ||| MaeIII | | ||| BdaI | | ||| BdaI | | ||AflIII | | ||MluI | | |MslI | | |OliI | | FnuDII* | HphI CviJI T G E K P H A C D F P G C V K R F S R S Q V R S L T R V T S P D V * K G S V E A R * E A S R V * L P R M C E K V Q * K R ----:----|----:----|----:----|----:----|----:----|----:----| V P S F G * A H S K G P H T F L N L L L Y L H S A E R T H S G R I H S F T * Y F C T L L R V R T V E G S T H F P E T S A MnlI | AvaI | XhoI | SmlI | AbsI BarI | BarI | BtgZI | PspXI | | TspDTI | |TaqI | | |TspDTI | |BmeT110I BdaI | | || ApoI | || MnlI BdaI | | || TspEI | || | SetI | BsmAI | | || EcoRI MboII | || | | MnlI \ \ \ \ \\ \ \ \ \\ \ \ \ GATGAACTGACGAGACACAGAAGAATTCATACAAACTCCCACCCTCGAGGTAAAAGAGGC 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTTGACTGCTCTGTGTCTTCTTAAGTATGTTTGAGGGTGGGAGCTCCATTTTCTCCG / / / // / / / / // / BdaI | | || BtgZI | MboII BarI || MnlI BdaI | | |TspDTI EcoRI MnlI |PspXI | | TspDTI TspEI |AbsI | BsmAI ApoI |SmlI BarI |XhoI |AvaI |MnlI BmeT110I TaqI SetI D E L T R H R R I H T N S H P R G K R G M N * R D T E E F I Q T P T L E V K E A * T D E T Q K N S Y K L P P S R * K R Q ----:----|----:----|----:----|----:----|----:----|----:----| S S S V L C L L I * V F E W G R P L L P R H V S S V C F F E Y L S G G E L Y F L I F Q R S V S S N M C V G V R S T F S A SetI | MboII BsrI | | CviJI | AccI | | | SduI | |BssNAI Hin4II* | | | HgiJII* MaeI MaeI | |Hpy166II \ \ \ \ \ \ \ \ \\ AGAAAGAAGAAGGTTGTGGGCTCTCCAATAAATAGTGCTAGTTCTAGTGCTACCAGTATA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTCTTCTTCCAACACCCGAGAGGTTATTTATCACGATCAAGATCACGATGGTCATAT / / // / / / / // Hin4II* SetI || CviJI MaeI MaeI BsrI |AccI |HgiJII* Hpy166II |SduI BssNAI MboII R K K K V V G S P I N S A S S S A T S I E R R R L W A L Q * I V L V L V L P V Y K E E G C G L S N K * C * F * C Y Q Y T ----:----|----:----|----:----|----:----|----:----|----:----| L F F F T T P E G I F L A L E L A V L I C F S S P Q P S E L L Y H * N * H * W Y S L L L N H A R W Y I T S T R T S G T Y MseI HphI |SwaI |ApoI AciI MseI |AhaIII* |TspEI |BceAI SetI |TspEI \\ \\ \\ \ \\ CCAGATTTAAATACGGCAAATTTTTCACCGCCATTACCACAGCAACACCTATCGCCTTTA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTAAATTTATGCCGTTTAAAAAGTGGCGGTAATGGTGTCGTTGTGGATAGCGGAAAT // / / // / / |MseI HphI TspEI |BceAI SetI MseI AhaIII* ApoI AciI SwaI P D L N T A N F S P P L P Q Q H L S P L Q I * I R Q I F H R H Y H S N T Y R L * R F K Y G K F F T A I T T A T P I A F N ----:----|----:----|----:----|----:----|----:----|----:----| G S K F V A F K E G G N G C C C R D G K V L N L Y P L N K V A M V V A V G I A K W I * I R C I K * R W * W L L V * R R * Hpy188I | FalI | FalI | | ApoI | | TspEI | | | MboII | | | | TaqI | | | | |MboI FalI | | | | || DpnI FalI | | | | || |BstKTI |SetI \ \ \ \ \\ \\ \\ ATTCCTATTGCTATTGCTCCGAAAGAAAATTCAAGTCGATCTTCTACAAGAAAAGGTAGA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGGATAACGATAACGAGGCTTTCTTTTAAGTTCAGCTAGAAGATGTTCTTTTCCATCT / / / // / / / TspEI Hpy188I TspEI || MboI | SetI FalI MboII |DpnI FalI FalI ApoI BstKTI FalI TaqI I P I A I A P K E N S S R S S T R K G R F L L L L L R K K I Q V D L L Q E K V E S Y C Y C S E R K F K S I F Y K K R * K ----:----|----:----|----:----|----:----|----:----|----:----| I G I A I A G F S F E L R D E V L F P L L E * Q * Q E S L F N L D I K * L F L Y N R N S N S R F F I * T S R R C S F T S ApoI TspEI | TaqI MboII TsoI | AsuII |BsiYI* | BccI \ \ \\ \ \ AAAACCAAATTCGAAATCGGCGAAAGTGGTGGGAATGACCCATATATGGTTTCTTCTCCC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGGTTTAAGCTTTAGCCGCTTTCACCACCCTTACTGGGTATATACCAAAGAAGAGGG / / // / | AsuII |MboII TsoI | TaqI BsiYI* TspEI ApoI K T K F E I G E S G G N D P Y M V S S P K P N S K S A K V V G M T H I W F L L P N Q I R N R R K W W E * P I Y G F F S Q ----:----|----:----|----:----|----:----|----:----|----:----| F V L N S I P S L P P F S G Y I T E E G F F W I R F R R F H H S H G M Y P K K E F G F E F D A F T T P I V W I H N R R G BstXI | CviJI | |DdeI HphI | || TfiI BsmAI | SetI Hin4II* | || HinfI Esp3I CviJI | | MnlI | TspRI \ \\ \ \ \ \ \ \ \ \ AAAACGATGGCTAAGATTCCCGTCTCGGTGAAGCCTCCACCTTCTTTAGCACTGAATAAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGCTACCGATTCTAAGGGCAGAGCCACTTCGGAGGTGGAAGAAATCGTGACTTATTA // / / / / / / / / / |BstXI | | HinfI | | HphI | | Hin4II* BccI | | TfiI | | SetI | TspRI | DdeI | CviJI MnlI CviJI Esp3I BsmAI K T M A K I P V S V K P P P S L A L N N K R W L R F P S R * S L H L L * H * I I N D G * D S R L G E A S T F F S T E * Y ----:----|----:----|----:----|----:----|----:----|----:----| L V I A L I G T E T F G G G E K A S F L W F S P * S E R R P S A E V K K L V S Y F R H S L N G D R H L R W R R * C Q I I BtsI | MwoI BseGI | |MboII FokI TspDTI | |BbvII* BglI | TspDTI | AciI | || TspRI CviJI MwoI \ \ \ \ \ \\ \ \ \ ATGAACTACCAAACTTCATCCGCTTCCACTGCTTTGTCTTCGTTGAGCAATAGCCATAGT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTGATGGTTTGAAGTAGGCGAAGGTGACGAAACAGAAGCAACTCGTTATCGGTATCA / / / / // / / / / | FokI TspDTI | || | BbvII* | MwoI TspDTI BseGI | || MboII | BglI | |MwoI CviJI | TspRI | BtsI AciI M N Y Q T S S A S T A L S S L S N S H S * T T K L H P L P L L C L R * A I A I V E L P N F I R F H C F V F V E Q * P * W ----:----|----:----|----:----|----:----|----:----|----:----| I F * W V E D A E V A K D E N L L L W L Y S S G F K M R K W Q K T K T S C Y G Y H V V L S * G S G S S Q R R Q A I A M T AccI AcyI |TsoI | BsrDI |Hpy166II | | HgaI || BslFI | | |NheI || | MluI | | ||MaeI || | AflIII | | |||Cac8I || | | FnuDII* | | |||| BmtI \\ \ \ \ \ \ \\\\ \ GGCAGTAGACTGAAACTGAACGCGTTATCGTCCCTACAAATGATGACGCCCATTGCTAGC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTCATCTGACTTTGACTTGCGCAATAGCAGGGATGTTTACTACTGCGGGTAACGATCG / // / / / / / /// | |AccI | | AflIII BsrDI | ||HgaI | Hpy166II | | MluI AcyI | ||NheI TsoI | FnuDII* | |MwoI BslFI | |MaeI | Cac8I | TspRI BmtI G S R L K L N A L S S L Q M M T P I A S A V D * N * T R Y R P Y K * * R P L L A Q * T E T E R V I V P T N D D A H C * Q ----:----|----:----|----:----|----:----|----:----|----:----| P L L S F S F A N D D R C I I V G M A L H C Y V S V S R T I T G V F S S A W Q * A T S Q F Q V R * R G * L H H R G N S A MwoI | Hin6I | |GlaI | ||HhaI | ||BtsI | ||TspRI AsuI* | |||StyI AvaII | |||SecI* Tsp4CI* | |||| TspDTI |BmgT120I ApoI | |||| | Tsp4CI* || Hpy178III* TspEI \ \\\\ \ \ \\ \ \ AGTGCGCCAAGGACTGTTTTCATAGACGGTCCTGAACAGAAACAACTACAACAACAACAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TCACGCGGTTCCTGACAAAAGTATCTGCCAGGACTTGTCTTTGTTGATGTTGTTGTTGTT //// / / / // / |||| | Tsp4CI* | || Hpy178III* |||| SecI* | |AvaII |||| StyI | |AsuI* |||TspDTI | BmgT120I ||Hin6I Tsp4CI* |GlaI BtsI HhaI S A P R T V F I D G P E Q K Q L Q Q Q Q V R Q G L F S * T V L N R N N Y N N N K C A K D C F H R R S * T E T T T T T T K ----:----|----:----|----:----|----:----|----:----|----:----| L A G L V T K M S P G S C F C S C C C C C H A L S Q K * L R D Q V S V V V V V V T R W P S N E Y V T R F L F L * L L L L StyI SecI* | CviJI | HaeIII | |AciI | |BisI | ||BlsI | ||MmeI | |||TauI | |||FnuDII* | ||||MboI MaeII | ||||| DpnI | SetI Tsp4CI* | ||||| |BstKTI HphI | TaiI | TspRI | ||||| || MseI \ \ \ \ \ \ \\\\\ \\ \ AATTCTCTTTCACCACGTTATTCCAACACTGTTATATTACCAAGGCCGCGATCTTTAACG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAGAGAAAGTGGTGCAATAAGGTTGTGACAATATAATGGTTCCGGCGCTAGAAATTGC / / / / / / ///// // / / | TspEI | MaeII | Tsp4CI* ||||| || | MseI | ApoI TaiI TspRI ||||| || MboI HphI SetI ||||| |DpnI ||||| BstKTI ||||FnuDII* ||||AciI |||BisI ||BlsI |HaeIII |CviJI |MmeI |TauI SecI* StyI N S L S P R Y S N T V I L P R P R S L T I L F H H V I P T L L Y Y Q G R D L * R F S F T T L F Q H C Y I T K A A I F N G ----:----|----:----|----:----|----:----|----:----|----:----| F E R E G R * E L V T I N G L G R D K V F N E K V V N N W C Q * I V L A A I K L I R K * W T I G V S N Y * W P R S R * R DdeI | BsmAI | Hpy188I | | SduI | | HgiAI* | | | TspGWI | | | | DdeI | | | | BspCNI TspGWI CviRI* | | | | |BseMII \ \ \ \ \ \ \\ GATTTTCAAGGATTGAACAATGCAAATCCAAACAACAATGGAAGTCTCAGAGCACAAACT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAAGTTCCTAACTTGTTACGTTTAGGTTTGTTGTTACCTTCAGAGTCTCGTGTTTGA / / /// / / // TspGWI CviRI* ||| | | |BseMII ||| | | BspCNI ||| | TspGWI ||| BsmAI ||HgiAI* ||SduI |DdeI Hpy188I D F Q G L N N A N P N N N G S L R A Q T I F K D * T M Q I Q T T M E V S E H K L F S R I E Q C K S K Q Q W K S Q S T N S ----:----|----:----|----:----|----:----|----:----|----:----| S K * P N F L A F G F L L P L R L A C V P N E L I S C H L D L C C H F D * L V F I K L S Q V I C I W V V I S T E S C L S Csp6I |RsaI ||PpiI ||BspCNI |||BseMII |||Ksp632I* ||||Tsp4CI* |||||BsmAI AjuI Hpy188I |||||Eco31I MboII MseI PpiI CfrI \ \\\\\\ \ \ \ \ CAGAGTTCCGTACAGTTGAAGAGACCAAGTTCAGTTTTAAGTTTGAACGACTTGTTGGTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTCAAGGCATGTCAACTTCTCTGGTTCAAGTCAAAATTCAAACTTGCTGAACAACCAA // / //// / / / / / |DdeI | |||| | Eco31I | AjuI PpiI | | |||| | BsmAI MboII MseI | | |||| Ksp632I* | | |||Tsp4CI* | | ||Csp6I | | |BseMII | | |RsaI | | BspCNI | PpiI Hpy188I Q S S V Q L K R P S S V L S L N D L L V R V P Y S * R D Q V Q F * V * T T C W L E F R T V E E T K F S F K F E R L V G W ----:----|----:----|----:----|----:----|----:----|----:----| * L E T C N F L G L E T K L K F S K N T E S N R V T S S V L N L K L N S R S T P L T G Y L Q L S W T * N * T Q V V Q Q N MlyI PleI TfiI HinfI BalI | Hpy188I CviJI | |HinfI MnlI BseGI HaeIII AjuI | || Hpy188I | BsrI |HphI \ \ \ \\ \ \ \ \\ GGCCAAAGAAATACCAACGAATCTGACTCTGATTTTACTACTGGTGGTGAGGATGAAGAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGTTTCTTTATGGTTGCTTAGACTGAGACTAAAATGATGACCACCACTCCTACTTCTT / / // // // / / / / | AjuI || || |Hpy188I | BsrI | HphI | CfrI || || HinfI MnlI BseGI HaeIII || |Hpy188I CviJI || HinfI BalI || TfiI |PleI MlyI G Q R N T N E S D S D F T T G G E D E E A K E I P T N L T L I L L L V V R M K K P K K Y Q R I * L * F Y Y W W * G * R R ----:----|----:----|----:----|----:----|----:----|----:----| P W L F V L S D S E S K V V P P S S S S Q G F F Y W R I Q S Q N * * Q H H P H L A L S I G V F R V R I K S S T T L I F F FokI |BbvII* || MboII || |TspDTI || || MboII || || | BaeI || || | AsuI* || || | AvaII || || | DraII || || | PpuMI || || | |BmgT120I SmlI || || | ||NlaIV TaqI |SetI || || | ||| TspGWI MaeI ClaI || BaeI CviRI* \\ \\ \ \\\ \ \ \ \\ \ \ GACGGACTAAAGGACCCGTCTAACTCTAGTATCGATAACCTTGAGCAAGACTATTTGCAA 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCCTGATTTCCTGGGCAGATTGAGATCATAGCTATTGGAACTCGTTCTGATAAACGTT //// // / / / / / / / |||| |TspGWI MaeI | | | SmlI | Bce83I* |||| |PpuMI | | BaeI CviRI* |||| |DraII | SetI |||| |AvaII ClaI |||| |AsuI* TaqI |||| BmgT120I |||| NlaIV |||BbvII* |||MboII ||FokI |BaeI TspDTI MboII D G L K D P S N S S I D N L E Q D Y L Q T D * R T R L T L V S I T L S K T I C K R T K G P V * L * Y R * P * A R L F A R ----:----|----:----|----:----|----:----|----:----|----:----| S P S F S G D L E L I S L R S C S * K C L R V L P G T * S * Y R Y G Q A L S N A V S * L V R R V R T D I V K L L V I Q L DdeI |BinI* || MboI || XhoII || | DpnI || | |BstKTI Bce83I* || | || SpeI | Hpy178III* DdeI MslI || | || |MaeI \ \ \ \ \\ \ \\ \\ GAGCAATCAAGAAAGAAATCTAAGACTTCCACGCCCACGACAATGCTAAGTAGATCCACT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGTTAGTTCTTTCTTTAGATTCTGAAGGTGCGGGTGCTGTTACGATTCATCTAGGTGA / / / // // / Hpy178III* DdeI MslI || || XhoII || || MboI || |DpnI || BstKTI |DdeI BinI* E Q S R K K S K T S T P T T M L S R S T S N Q E R N L R L P R P R Q C * V D P L A I K K E I * D F H A H D N A K * I H * ----:----|----:----|----:----|----:----|----:----|----:----| S C D L F F D L V E V G V V I S L L D V L A I L F S I * S K W A W S L A L Y I W L L * S L F R L S G R G R C H * T S G S Csp6I |RsaI BseRI || ApoI |TspDTI || TspEI CviRI* || CviRI* \\ \ \ \\ \ AGTGGTACGAATTTGCACACTTTGGGGTATGTAATGAACCAAAATCACTTGCATTTCTCC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TCACCATGCTTAAACGTGTGAAACCCCATACATTACTTGGTTTTAGTGAACGTAAAGAGG // // / / // / || |Csp6I | CviRI* || CviRI* || RsaI TspEI |TspDTI |SpeI ApoI BseRI MaeI S G T N L H T L G Y V M N Q N H L H F S V V R I C T L W G M * * T K I T C I S P W Y E F A H F G V C N E P K S L A F L L ----:----|----:----|----:----|----:----|----:----|----:----| L P V F K C V K P Y T I F W F * K C K E * H Y S N A C K P T H L S G F D S A N R T T R I Q V S Q P I Y H V L I V Q M E G AclI MaeII MnlI | SetI |Hpy178III* | TaiI TseI \\ \ \ \ TCATCATCTCCTGATTTCCAAAAGGAGTTGAACAACAGATTACTGAACGTTCAACAACAG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| AGTAGTAGAGGACTAAAGGTTTTCCTCAACTTGTTGTCTAATGACTTGCAAGTTGTTGTC / / / / | Hpy178III* | MaeII MnlI | AclI TaiI SetI S S S P D F Q K E L N N R L L N V Q Q Q H H L L I S K R S * T T D Y * T F N N S I I S * F P K G V E Q Q I T E R S T T A ----:----|----:----|----:----|----:----|----:----|----:----| E D D G S K W F S N F L L N S F T * C C R M M E Q N G F P T S C C I V S R E V V * * R R I E L L L Q V V S * Q V N L L L BisI MaeII |BlsI CviRI* | SetI || MwoI BbvI | EcoP15I | TaiI \\ \ \ \ \ \ \ CAGCAAGAGCAACATACCCTACTGCAATCACAAAATACGTCAAACCAAAGTCAAAATCAA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GTCGTTCTCGTTGTATGGGATGACGTTAGTGTTTTATGCAGTTTGGTTTCAGTTTTAGTT /// / / / / / ||MwoI BbvI | | | MaeII ||TseI | | TaiI |BisI | | SetI BlsI | EcoP15I CviRI* Q Q E Q H T L L Q S Q N T S N Q S Q N Q S K S N I P Y C N H K I R Q T K V K I K A R A T Y P T A I T K Y V K P K S K S K ----:----|----:----|----:----|----:----|----:----|----:----| C C S C C V R S C D C F V D F W L * F * A A L A V Y G V A I V F Y T L G F D F D L L L L M G * Q L * L I R * V L T L I L MseI | TatI CviJI | |Csp6I MaeIII BccI | BsrI | ||RsaI HphI Tsp45I \ \ \ \ \\\ \ \ AATCAAAATCAAATGATGGCTTCCAGTAGTTCGTTAAGTACAACCCCGTTATTATTGTCA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| TTAGTTTTAGTTTACTACCGAAGGTCATCAAGCAATTCATGTTGGGGCAATAATAACAGT / / / / /// / BccI | BsrI | ||TatI HphI CviJI | |Csp6I | RsaI MseI N Q N Q M M A S S S S L S T T P L L L S I K I K * W L P V V R * V Q P R Y Y C H S K S N D G F Q * F V K Y N P V I I V T ----:----|----:----|----:----|----:----|----:----|----:----| F * F * I I A E L L E N L V V G N N N D F D F D F S P K W Y N T L Y L G T I I T I L I L H H S G T T R * T C G R * * Q * MseI StyI VspI TaqII SecI* |HphI MmeI | DdeI Hpy188I \ \\ \ \ \ \ CCAAGGGTGAATATGATTAATACTGCTATATCCACCCAACAAACCCCCATTTCTCAGTCG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTCCCACTTATACTAATTATGACGATATAGGTGGGTTGTTTGGGGGTAAAGAGTCAGC / / / / / / / / | SecI* | VspI MmeI TaqII | Hpy188I | StyI | MseI DdeI Tsp45I HphI MaeIII P R V N M I N T A I S T Q Q T P I S Q S Q G * I * L I L L Y P P N K P P F L S R K G E Y D * Y C Y I H P T N P H F S V G ----:----|----:----|----:----|----:----|----:----|----:----| G L T F I I L V A I D V W C V G M E * D V L P S Y S * Y Q * I W G V F G W K E T W P H I H N I S S Y G G L L G G N R L R TfiI HinfI | BspCNI | |BseMII Hpy166II | || Hpy178III* | TaqII | || | BsrI | | Tsp4CI* \ \\ \ \ \ \ \ GATTCACAAGTTCAAGAACTGGAAACATTACCACCCATAAGAAGTTTACCGTTGCCCTTC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAGTGTTCAAGTTCTTGACCTTTGTAATGGTGGGTATTCTTCAAATGGCAACGGGAAG // / / / / |BseMII | BsrI | Tsp4CI* BspCNI Hpy178III* Hpy166II HinfI TaqII TfiI D S Q V Q E L E T L P P I R S L P L P F I H K F K N W K H Y H P * E V Y R C P S F T S S R T G N I T T H K K F T V A L P ----:----|----:----|----:----|----:----|----:----|----:----| S E C T * S S S V N G G M L L K G N G K P N V L E L V P F M V V W L F N V T A R I * L N L F Q F C * W G Y S T * R Q G E FatI |CviAII |BsiYI* |Hin4II* || NlaIII \\ \ CCACACATGGACTGA 1510 ----:----|----: GGTGTGTACCTGACT / / // | | |FatI | | CviAII | Hin4II* | NlaIII BsiYI* P H M D * H T W T X T H G L X ----:----|----: G C M S Q G V C P S W V H V S # Enzymes that cut Frequency Isoschizomers AbsI 1 AccI 2 FblI,XmiI AciI 3 BspACI,SsiI AclI 2 Psp1406I AcyI 2 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 2 AhaIII* 1 DraI AjuI 1 AluI 2 AluBI ApoI 7 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BalI 1 MlsI,MluNI,MscI,Msp20I BarI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 3 Bce83I* 1 BpuEI BceAI 1 BdaI 4 BglI 1 BinI* 1 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 1 BmgT120I 2 BmtI 1 BspOI BseGI 3 BstF5I,BtsCI BseMII 3 BseRI 1 BsiYI* 2 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI BspCNI 3 BsrDI 1 BseMI,Bse3DI BsrI 5 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 3 BstXI 1 BtgZI 1 BtsI 2 Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 3 CviQI,RsaNI CviAII 3 CviJI 11 CviKI-1 CviRI* 6 HpyCH4V DdeI 6 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 3 MalI DraII 1 EcoO109I DrdI 1 AasI,DseDI Eco31I 1 Bso31I,BspTNI,BsaI EcoP15I 1 EcoRI 2 Esp3I 1 BsmBI FalI 2 FatI 3 FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 2 HaeII 1 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 2 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 4 HpyAV Hin6I 2 HinP1I,HspAI HinfI 4 HpaII 1 HapII,BsiSI,MspI HphI 7 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 8 KasI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 5 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 3 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 8 MluI 2 MlyI 1 SchI MmeI 2 MnlI 8 MseI 6 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NarI 1 Mly113I NheI 1 AsuNHI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspI 1 BstNSI,XceI OliI 1 AleI PleI 1 PpsI PpiI 1 PpuMI 1 Psp5II,PspPPI PspXI 1 RsaI 3 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 14 SmlI 2 SmoI SpeI 1 BcuI,AhlI StyI 3 Eco130I,EcoT14I,ErhI,BssT1I SwaI 1 SmiI TaiI 4 TaqI 4 TaqII 2 TatI 1 TauI 1 TfiI 3 PfeI TseI 2 ApeKI TsoI 2 Tsp45I 3 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 8 TspEI 8 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 4 TscAI VspI 1 PshBI,AseI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII Acc65I AflII AgeI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AvrII BamHI BbvCI BcgI BciVI BclI BetI* BfiI BglII BplI Bpu10I BsaAI BsaBI BsaXI BseBI BsePI BseSI BseYI BsgI BsiI* BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BsrBI Bst2UI BstAPI BstEII BstNI BstOI BtrI Cfr10I Cfr9I CspCI DraIII DsaI* Eam1105I EciI Ecl136II Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRII EcoRV EcoT22I EspI* FauI FseI FspAI GsaI GsuI HindII HindIII HpaI Hpy99I KpnI MauBI McrI* MfeI Mph1103I MroNI MstI* MvaI NaeI NcoI NdeI NgoMIV NmeAIII NotI NruI NsiI NspBII* PacI PasI PflMI PfoI PmaCI PmeI PshAI PsiI PspOMI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SexAI SfaNI SfeI* SfiI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI TspMI TstI Tth111I XbaI XcmI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769