Restriction Map of PMC1/YGL006W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

PMC1/YGL006W on chromosome VII from coordinates 485921 to 489442.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.28494

BcgI XbaI |MaeI ApoI MaeI |Hpy178III* TspEI MwoI BcgI TspDTI \\ \ \ \ \ ATGTCTAGACAAGACGAAAATTCTGCTTTACTAGCGAATAATGAAAATAACAAACCATCG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGATCTGTTCTGCTTTTAAGACGAAATGATCGCTTATTACTTTTATTGTTTGGTAGC / // / / / / / BcgI |XbaI TspEI MwoI | BcgI TspDTI Hpy178III* ApoI MaeI MaeI M S R Q D E N S A L L A N N E N N K P S C L D K T K I L L Y * R I M K I T N H R V * T R R K F C F T S E * * K * Q T I V ----:----|----:----|----:----|----:----|----:----|----:----| X D L C S S F E A K S A F L S F L L G D X T * V L R F N Q K V L S Y H F Y C V M H R S L V F I R S * * R I I F I V F W R HinfI | AccI | |Hpy166II HindII | || PleI Hpy166II AccI | || |MlyI | MboII |BssNAI | || ||TspEI | TspDTI |Hpy166II | || ||| TspGWI | | MboI ||BccI | || ||| | TspEI | | XhoII ||| PsrI | || ||| | | PsrI | | Hpy188I \\\ \ \ \\ \\\ \ \ \ \ \ \ TATACGGGAAATGAGAACGGAGTCTACGATAATTTCAAATTATCAAAAAGTCAACTTTCG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| ATATGCCCTTTACTCTTGCCTCAGATGCTATTAAAGTTTAATAGTTTTTCAGTTGAAAGC /// /// // / / /// / ||BccI ||| || TspEI TspEI ||| Hpy188I |AccI ||| || PsrI ||MboII Hpy166II ||| |TspGWI |TspDTI BssNAI ||| PleI Hpy166II PsrI ||| MlyI HindII ||AccI |Hpy166II HinfI Y T G N E N G V Y D N F K L S K S Q L S I R E M R T E S T I I S N Y Q K V N F R Y G K * E R S L R * F Q I I K K S T F G ----:----|----:----|----:----|----:----|----:----|----:----| Y V P F S F P T * S L K L N D F L * S E T Y P F H S R L R R Y N * I I L F D V K I R S I L V S D V I I E F * * F T L K R Hin4I Hin4I DpnI MboI | HinfI |BstKTI Hin4I | DpnI | | MboII || BinI* Hin4I | |BstKTI Hpy188I | | | PleI \\ \ \ \ \\ \ \ \ \ \ GATCTTCATAACCCTAAATCAATAAGATCATTTGTCAGATTATTTGGATATGAGTCTAAC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGAAGTATTGGGATTTAGTTATTCTAGTAAACAGTCTAATAAACCTATACTCAGATTG // / / / // / / / // || | | Hin4I || MboI Hpy188I Hin4I |MboII || | | Hin4I |DpnI Hin4I HinfI || | BinI* BstKTI || XhoII || MboI |DpnI BstKTI D L H N P K S I R S F V R L F G Y E S N I F I T L N Q * D H L S D Y L D M S L T S S * P * I N K I I C Q I I W I * V * Q ----:----|----:----|----:----|----:----|----:----|----:----| S R * L G L D I L D N T L N N P Y S D L P D E Y G * I L L I M Q * I I Q I H T * I K M V R F * Y S * K D S * K S I L R V CviRI* MlyI Ksp632I* | Cac8I Hpy178III* |CviJI | MnlI | |MboII |Ksp632I* TspEI \\ \ \ \ \\ \\ \ AGCCTCTTCAAATACTTGAAAACAGATAAAAATGCAGGCATTTCTCTTCCAGAAATATCA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCGGAGAAGTTTATGAACTTTTGTCTATTTTTACGTCCGTAAAGAGAAGGTCTTTATAGT // // / / / / |CviJI |Ksp632I* | Cac8I | Ksp632I* PleI MnlI | MboII Hpy178III* MlyI CviRI* S L F K Y L K T D K N A G I S L P E I S A S S N T * K Q I K M Q A F L F Q K Y Q P L Q I L E N R * K C R H F S S R N I K ----:----|----:----|----:----|----:----|----:----|----:----| L R K L Y K F V S L F A P M E R G S I D C G R * I S S F L Y F H L C K E E L F I A E E F V Q F C I F I C A N R K W F Y * AgeI BetI* Cfr10I TaqI |HpaII TspEI TspEI Hpy178III* \ \\ \ \ \ AATTATCGAAAGACAAACCGGTATAAAAATTATGGCGATAATTCACTTCCTGAAAGAATA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTAATAGCTTTCTGTTTGGCCATATTTTTAATACCGCTATTAAGTGAAGGACTTTCTTAT / / // / / / | TaqI |Cfr10I TspEI TspEI Hpy178III* TspEI |BetI* |AgeI HpaII N Y R K T N R Y K N Y G D N S L P E R I I I E R Q T G I K I M A I I H F L K E Y L S K D K P V * K L W R * F T S * K N T ----:----|----:----|----:----|----:----|----:----|----:----| F * R F V F R Y L F * P S L E S G S L I L N D F S L G T Y F N H R Y N V E Q F F I I S L C V P I F I I A I I * K R F S Y TseI CviJI BbvI |BisI CviRI* |TspEI ||BlsI MseI |TspEI \\ \\\ \ \\ CCAAAGTCTTTTTTACAATTAGTATGGGCTGCTTTTAATGACAAAACAATGCAATTACTG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTCAGAAAAAATGTTAATCATACCCGACGAAAATTACTGTTTTGTTACGTTAATGAC // //// / / / |TspEI |||TseI MseI | TspEI BbvI ||BisI CviRI* |BlsI CviJI P K S F L Q L V W A A F N D K T M Q L L Q S L F Y N * Y G L L L M T K Q C N Y * K V F F T I S M G C F * * Q N N A I T D ----:----|----:----|----:----|----:----|----:----|----:----| G F D K K C N T H A A K L S L V I C N S V L T K K V I L I P Q K * H C F L A I V W L R K * L * Y P S S K I V F C H L * Q Tsp4CI* | AciI | BisI CviRI* | |BlsI | BseGI | ||TauI SfaNI | | SetI | ||NspBII* SetI |Hin4I | | | FokI \ \\\ \ \\ \ \ \ \ ACAGTCGCCGCTGTTGTTTCCTTTGTTTTAGGTCTATACGAACTATGGATGCAACCTCCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCAGCGGCGACAACAAAGGAAACAAAATCCAGATATGCTTGATACCTACGTTGGAGGT / //// / / / / / | |||NspBII* SetI Hin4I SfaNI | SetI | |||AciI CviRI* | ||BisI BseGI | |BlsI | TauI Tsp4CI* T V A A V V S F V L G L Y E L W M Q P P Q S P L L F P L F * V Y T N Y G C N L H S R R C C F L C F R S I R T M D A T S T ----:----|----:----|----:----|----:----|----:----|----:----| V T A A T T E K T K P R Y S S H I C G G S L R R Q Q K R Q K L D I R V I S A V E C D G S N N G K N * T * V F * P H L R W BinI* |Tsp4CI* || MnlI || |MboI Eco57I || ||Hin4II* Eco57MI || |||DpnI | HindII FatI || ||||BstKTI | Hpy166II BspHI || |||||Hpy178III* TspEI | | Hin4II* |CviAII || ||||||Hin4I | MseI | | | BsrI |Hpy178III* \\ \\\\\\\ \ \ \ \ \ \ \\ CAGTATGATCCTGAAGGAAATAAAATTAAGCAAGTTGACTGGATTGAAGGGGTTGCTATC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GTCATACTAGGACTTCCTTTATTTTAATTCGTTCAACTGACCTAACTTCCCCAACGATAG // / /// / / // / / / / / || | ||| | Hpy178III* || | | | BsrI NlaIII || | ||| MboI || | | Hin4II* || | ||DpnI || | Hpy166II || | |BstKTI || | HindII || | Hin4II* || Eco57MI || | Hin4I || Eco57I || FokI |MseI || MnlI TspEI |BinI* Tsp4CI* Q Y D P E G N K I K Q V D W I E G V A I S M I L K E I K L S K L T G L K G L L S V * S * R K * N * A S * L D * R G C Y H ----:----|----:----|----:----|----:----|----:----|----:----| C Y S G S P F L I L C T S Q I S P T A I V T H D Q L F Y F * A L Q S S Q L P Q * L I I R F S I F N L L N V P N F P N S D AciI BisI NlaIII |BlsI | AciI MaeI ||TauI Hin4II* CviRI* \ \ \ \\\ \ \ ATGATTGCGGTCTTTGTGGTAGTTCTAGTGAGTGCCGCTAACGATTACCAGAAGGAGTTG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TACTAACGCCAGAAACACCATCAAGATCACTCACGGCGATTGCTAATGGTCTTCCTCAAC // / / //// / / |BspHI AciI MaeI |||AciI Hin4II* CviRI* |FatI ||BisI Hpy178III* |BlsI CviAII TauI M I A V F V V V L V S A A N D Y Q K E L * L R S L W * F * * V P L T I T R R S C D C G L C G S S S E C R * R L P E G V A ----:----|----:----|----:----|----:----|----:----|----:----| M I A T K T T T R T L A A L S * W F S N * S Q P R Q P L E L S H R * R N G S P T H N R D K H Y N * H T G S V I V L L L Q CviRI* | AluI MboI | CviJI BclI | | SetI Tsp4CI* | DpnI TspEI | | | Hin4II* | TspEI | |BstKTI \ \ \ \ \ \ \ \ \\ CAATTTGCAAAGCTAAATAAAAAGAAGGAAAACCGTAAAATTATAGTCATAAGAAATGAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAAACGTTTCGATTTATTTTTCTTCCTTTTGGCATTTTAATATCAGTATTCTTTACTA / / / / / / / // | | | | Hin4II* Tsp4CI* TspEI |DpnI | | | CviJI BstKTI | | | AluI | | SetI | CviRI* TspEI Q F A K L N K K K E N R K I I V I R N D N L Q S * I K R R K T V K L * S * E M I I C K A K * K E G K P * N Y S H K K * S ----:----|----:----|----:----|----:----|----:----|----:----| C N A F S F L F F S F R L I I T M L F S A I Q L A L Y F S P F G Y F * L * L F H L K C L * I F L L F V T F N Y D Y S I I Hpy178III* | SspI BslFI | | MseI | AgeI | | VspI MaeII | BetI* | | |TspEI | SetI | Cfr10I | | || HphI | TaiI TspDTI HphI | |HpaII \ \ \\ \ \ \ \ \ \ \\ CAGGAAATATTAATTTCCATTCACCACGTTTTAGTCGGTGATGTCATTTCATTACAAACC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GTCCTTTATAATTAAAGGTAAGTGGTGCAAAATCAGCCACTACAGTAAAGTAATGTTTGG / / / / / / / / / / | | | | TspEI | MaeII TspDTI HphI BslFI | | | VspI TaiI | | | MseI SetI | | | HphI | | SspI | Hpy178III* BclI MboI Q E I L I S I H H V L V G D V I S L Q T R K Y * F P F T T F * S V M S F H Y K P G N I N F H S P R F S R * C H F I T N R ----:----|----:----|----:----|----:----|----:----|----:----| * S I N I E M * W T K T P S T M E N C V D P F I L K W E G R K L R H H * K M V F L F Y * N G N V V N * D T I D N * * L G HphI MnlI |AciI | Hin4I TfiI || NspBII* | Hin4I HinfI || | FauI EcoRV | | FokI | BseGI \\ \ \ \ \ \ \ \ \ GGTGATGTTGTCCCCGCTGATTGTGTTATGATATCAGGGAAGTGTGAGGCAGATGAATCA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTACAACAGGGGCGACTAACACAATACTATAGTCCCTTCACACTCCGTCTACTTAGT // / / / / / / / / |Cfr10I | | FauI EcoRV Hin4I FokI | HinfI |BetI* | NspBII* Hin4I | TfiI |AgeI | AciI MnlI BseGI HpaII HphI G D V V P A D C V M I S G K C E A D E S V M L S P L I V L * Y Q G S V R Q M N H * C C P R * L C Y D I R E V * G R * I I ----:----|----:----|----:----|----:----|----:----|----:----| P S T T G A S Q T I I D P F H S A S S D R H H Q G R Q N H * S I L S T H P L H I T I N D G S I T N H Y * P L T L C I F * TspDTI | BccI | | BsrI | | TspRI | | |TfiI ApoI | | |HinfI TspEI | | || Hin4I | BetI* | | || Hin4I HphI | |HpaII MseI \ \ \\ \ \ \ \\ \ TCCATCACTGGTGAATCTAACACAATACAGAAATTTCCGGTGGATAACTCATTAAGAGAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTAGTGACCACTTAGATTGTGTTATGTCTTTAAAGGCCACCTATTGAGTAATTCTCTA / / // / / / // / | | |BccI | HphI | |BetI* MseI | | Hin4I HinfI | HpaII | | Hin4I TfiI TspEI | | BsrI ApoI | TspDTI TspRI S I T G E S N T I Q K F P V D N S L R D P S L V N L T Q Y R N F R W I T H * E I H H W * I * H N T E I S G G * L I K R F ----:----|----:----|----:----|----:----|----:----|----:----| D M V P S D L V I C F N G T S L E N L S M W * Q H I * C L V S I E P P Y S M L L G D S T F R V C Y L F K R H I V * * S I ApoI MaeIII TspEI Tsp45I | MseI TaqI | SetI | |TspEI ClaI TsoI | | MaeII \ \\ \ \ \ \ \ TTCAAAAAATTTAATTCTATCGATAGTCATAACCATAGCAAACCATTAGATATAGGTGAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTTTTTAAATTAAGATAGCTATCAGTATTGGTATCGTTTGGTAATCTATATCCACTG / / / / / / / / | | TspEI ClaI TsoI SetI | Tsp45I | MseI TaqI | MaeIII TspEI TaiI ApoI SetI F K K F N S I D S H N H S K P L D I G D S K N L I L S I V I T I A N H * I * V T Q K I * F Y R * S * P * Q T I R Y R * R ----:----|----:----|----:----|----:----|----:----|----:----| K L F N L E I S L * L W L L G N S I P S N * F I * N * R Y D Y G Y C V M L Y L H E F F K I R D I T M V M A F W * I Y T V MseI SetI SetI TaiI NlaIV |HpaI MaeIII | Hpy178III* |HindII Tsp4CI* | | ApoI |Hpy166II |BbvII* | | TspEI || HphI || MboII | | EcoRI \\ \ \\ \ \ \ \ GTTAACGAAGACGGTAACAAGATTGCTGATTGTATGTTGATTTCAGGTTCCAGAATTCTC 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CAATTGCTTCTGCCATTGTTCTAACGACTAACATACAACTAAAGTCCAAGGTCTTAAGAG / // / / / / / / / | || HphI | BbvII* | | | EcoRI | |MseI | MaeIII | | | TspEI | Hpy166II | MboII | | | ApoI | HindII Tsp4CI* | | Hpy178III* | HpaI | NlaIV MaeII SetI V N E D G N K I A D C M L I S G S R I L L T K T V T R L L I V C * F Q V P E F S * R R R * Q D C * L Y V D F R F Q N S L ----:----|----:----|----:----|----:----|----:----|----:----| T L S S P L L I A S Q I N I E P E L I R R * R L R Y C S Q Q N Y T S K L N W F E N V F V T V L N S I T H Q N * T G S N E MaeII |BtrI Hpy166II || SetI | Tsp4CI* || TaiI | | BspCNI || OliI | | |TspDTI || MslI | | |BseMII || |SecI* | | || FatI CviJI TspGWI || |DsaI* DdeI | | || |CviAII \ \ \\ \\ \ \ \ \\ \\ TCTGGCTTGGGCAGGGGTGTCATCACGTCCGTGGGTATAAACTCAGTTTACGGTCAAACC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AGACCGAACCCGTCCCCACAGTAGTGCAGGCACCCATATTTGAGTCAAATGCCAGTTTGG / / / /// / / / / // / CviJI TspGWI | ||MslI DsaI* | | | || NlaIII | ||OliI SecI* | | | |BseMII | |MaeII | | | |TspDTI | BtrI | | | BspCNI TaiI | | Tsp4CI* SetI | Hpy166II DdeI S G L G R G V I T S V G I N S V Y G Q T L A W A G V S S R P W V * T Q F T V K P W L G Q G C H H V R G Y K L S L R S N H ----:----|----:----|----:----|----:----|----:----|----:----| E P K P L P T M V D T P I F E T * P * V R Q S P C P H * * T R P Y L S L K R D F R A Q A P T D D R G H T Y V * N V T L G SetI CviJI | TatI | MfeI | |Csp6I | Hin4I | ||RsaI MaeIII | Hin4I NlaIII MseI | ||ScaI Tsp4CI* | TspEI \ \ \ \\\ \ \ \ ATGACTTCATTAAATGCCGAACCTGAAAGTACTCCATTACAGTTACATTTGAGCCAATTG 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TACTGAAGTAATTTACGGCTTGGACTTTCATGAGGTAATGTCAATGTAAACTCGGTTAAC // / / /// / / / / / |FatI MseI SetI ||TatI | | | CviJI TspEI CviAII |Csp6I | | Hin4I MfeI ScaI | | Hin4I RsaI | MaeIII Tsp4CI* M T S L N A E P E S T P L Q L H L S Q L * L H * M P N L K V L H Y S Y I * A N W D F I K C R T * K Y S I T V T F E P I G ----:----|----:----|----:----|----:----|----:----|----:----| M V E N F A S G S L V G N C N C K L W N W S K M L H R V Q F Y E M V T V N S G I H S * * I G F R F T S W * L * M Q A L Q Hpy166II | Tsp4CI* AsuI* CviJI | | Hin4I AvaII | TspGWI | | Hin4I TspEI |BmgT120I \ \ \ \ \ \ \\ GCTGATAATATATCCGTTTACGGTTGCGTGTCTGCTATAATTCTTTTCTTGGTCCTTTTC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTATTATATAGGCAAATGCCAACGCACAGACGATATTAAGAAAAGAACCAGGAAAAG / / // / // TspGWI | |Hin4I TspEI |AvaII CviJI | |Hin4I |AsuI* | Tsp4CI* BmgT120I Hpy166II A D N I S V Y G C V S A I I L F L V L F L I I Y P F T V A C L L * F F S W S F S * * Y I R L R L R V C Y N S F L G P F H ----:----|----:----|----:----|----:----|----:----|----:----| A S L I D T * P Q T D A I I R K K T R K P Q Y Y I R K R N R T Q * L E K R P G K S I I Y G N V T A H R S Y N K E Q D K E BseMII |BspCNI || MnlI || |AloI || || BccI || || |DdeI || || |BspMI || || |SauI* || || ||SetI || || ||| BsiYI* || || ||| | BseGI || || ||| | | SetI || || ||| | | NlaIV || || ||| | | | FatI || || ||| | | | |FokI || || ||| | | | |CviAII || || ||| | | | || MboI || || ||| | | | || |BinI* || || ||| | | | || |NlaIII || || ||| | | | || ||DpnI || || ||| | | | || |||XbaI || || ||| | | | || |||BstKTI || || ||| | | | || ||||MaeI || || ||| | | | || ||||Hpy178III* || || ||| | | | || |||||BsaBI || || ||| | | | || ||||||MboI || || ||| | | | || ||||||XhoII || || ||| | | | || ||||||| DpnI MaeI || || ||| | | | || ||||||| |AloI | Csp6I || || ||| | | | || ||||||| |BstKTI | |RsaI || || ||| | | | || ||||||| || AciI | |SetI || || ||| | | | || ||||||| || | BsrBI \ \\ \\ \\ \\\ \ \ \ \\ \\\\\\\ \\ \ \ ACTAGGTACTTATTTTACATAATACCTGAGGATGGCAGGTTCCATGATCTAGATCCCGCT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TGATCCATGAATAAAATGTATTATGGACTCCTACCGTCCAAGGTACTAGATCTAGGGCGA // // /// / / / /// / / / / /// ///// / / || |Csp6I ||| | | | ||| | | | | ||| ||||| | BsrBI || RsaI ||| | | | ||| | | | | ||| ||||| | AciI |MaeI ||| | | | ||| | | | | ||| ||||| XhoII SetI ||| | | | ||| | | | | ||| ||||| MboI ||| | | | ||| | | | | ||| ||||DpnI ||| | | | ||| | | | | ||| |||BstKTI ||| | | | ||| | | | | ||| |||XbaI ||| | | | ||| | | | | ||| ||Hpy178III* ||| | | | ||| | | | | ||| ||MaeI ||| | | | ||| | | | | ||| |BsaBI ||| | | | ||| | | | | ||| AloI ||| | | | ||| | | | | ||| MboI ||| | | | ||| | | | | ||BinI* ||| | | | ||| | | | | ||FokI ||| | | | ||| | | | | ||DpnI ||| | | | ||| | | | | |BstKTI ||| | | | ||| | | | | |FatI ||| | | | ||| | | | | CviAII ||| | | | ||| | | | NlaIII ||| | | | ||| | | NlaIV ||| | | | ||| | SetI ||| | | | ||| BseGI ||| | | | ||BspMI ||| | | | |SauI* ||| | | | |DdeI ||| | | | BsiYI* ||| | | BccI ||| | SetI ||| MnlI ||AloI |BspCNI BseMII T R Y L F Y I I P E D G R F H D L D P A L G T Y F T * Y L R M A G S M I * I P L * V L I L H N T * G W Q V P * S R S R S ----:----|----:----|----:----|----:----|----:----|----:----| V L Y K N * M I G S S P L N W S R S G A * * T S I K C L V Q P H C T G H D L D R S P V * K V Y Y R L I A P E M I * I G S ApoI FauI TspEI TspDTI Tsp4CI* CviJI \ \ \ \ \ CAAAAGGGTTCTAAATTTATGAACATTTTTATCACATCTATCACGGTTATTGTGGTGGCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCCCAAGATTTAAATACTTGTAAAAATAGTGTAGATAGTGCCAATAACACCACCGA / / / / / / FauI TspEI TspDTI Tsp4CI* | Hin4II* ApoI CviJI Q K G S K F M N I F I T S I T V I V V A K R V L N L * T F L S H L S R L L W W L K G F * I Y E H F Y H I Y H G Y C G G C ----:----|----:----|----:----|----:----|----:----|----:----| * F P E L N I F M K I V D I V T I T T A E F P N * I * S C K * * M * * P * Q P P L L T R F K H V N K D C R D R N N H H S Hin4II* | BetI* | BspMII* | |HpaII AluI CviJI | |Hpy178III* CviJI HaeIII | || SetI | SetI | DdeI | || |Hpy166II | MaeIII | Bpu10I CviRI* \ \\ \\ \ \ \ \ \ GTTCCGGAAGGTTTACCATTAGCTGTAACTTTGGCCTTAGCGTTTGCAACAACAAGAATG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGGCCTTCCAAATGGTAATCGACATTGAAACCGGAATCGCAAACGTTGTTGTTCTTAC /// / / / / / / / ||SetI | | CviJI | | Bpu10I CviRI* || | | AluI | | DdeI || | SetI | HaeIII || Hpy166II | CviJI |BspMII* MaeIII |BetI* Hpy178III* HpaII V P E G L P L A V T L A L A F A T T R M F R K V Y H * L * L W P * R L Q Q Q E * S G R F T I S C N F G L S V C N N K N D ----:----|----:----|----:----|----:----|----:----|----:----| T G S P K G N A T V K A K A N A V V L I Q E P L N V M L Q L K P R L T Q L L L F N R F T * W * S Y S Q G * R K C C C S H MboI XhoII AluI | DpnI CviJI | |BstKTI Tsp4CI* Csp6I | SetI | || BinI* | TspEI |RsaI MseI | | BccI | || | SfeI* \ \ \\ \ \ \ \ \ \\ \ \ ACAAAAGACGGTAATTTAGTACGGGTTTTAAGAAGCTGTGAAACGATGGGATCTGCTACT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTTTCTGCCATTAAATCATGCCCAAAATTCTTCGACACTTTGCTACCCTAGACGATGA / / // / / / / // / // | | |Csp6I | | | BccI || | |TspRI | | RsaI | | CviJI || | |PstI | TspEI | | AluI || | BinI* Tsp4CI* | SetI || XhoII MseI || MboI |DpnI BstKTI T K D G N L V R V L R S C E T M G S A T Q K T V I * Y G F * E A V K R W D L L L K R R * F S T G F K K L * N D G I C Y C ----:----|----:----|----:----|----:----|----:----|----:----| V F S P L K T R T K L L Q S V I P D A V S L L R Y N L V P K L F S H F S P I Q * C F V T I * Y P N * S A T F R H S R S S FatI BtsI BspHI TspRI |CviAII | SduI |Hpy178III* CviRI* | HgiAI* || NlaIII | PstI | | Hpy188I BsrI || | Tsp4CI* CviJI \ \ \ \ \ \ \\ \ \ \ GCAGTGTGCTCTGATAAGACTGGCACTTTGACAGAAAATGTCATGACTGTCGTTCGTGGC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCACACGAGACTATTCTGACCGTGAAACTGTCTTTTACAGTACTGACAGCAAGCACCG / / / / / / // / / | | | Hpy188I BsrI | || Tsp4CI* CviJI | | HgiAI* | |BspHI | | BtsI | |FatI | | SduI | Hpy178III* | SfeI* | CviAII CviRI* NlaIII A V C S D K T G T L T E N V M T V V R G Q C A L I R L A L * Q K M S * L S F V A S V L * * D W H F D R K C H D C R S W L ----:----|----:----|----:----|----:----|----:----|----:----| A T H E S L V P V K V S F T M V T T R P Q L T S Q Y S Q C K S L F H * S Q R E H C H A R I L S A S Q C F I D H S D N T A BssKI |AvaI |BssKI |SecI* |Cfr9I ||HpaII ||ScrFI ||CauII* ||BmeT110I |||SmaI |||MwoI ApoI |||ScrFI Hin4I |||CauII* Hin4I Hin4I AluI |||| TspEI TspEI Hin4I CviJI \\\\ \ \ \ \ TTCCCGGGCAATTCTAAATTTGATGATAGTAAATCGTTGCCCGTTAGCGAACAAAGGAAG 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGGCCCGTTAAGATTTAAACTACTATCATTTAGCAACGGGCAATCGCTTGTTTCCTTC / //// / / / / / / | |||| | TspEI TspEI Hin4I | CviJI | |||| Hin4I ApoI Hin4I | AluI | |||| Hin4I SetI | |||BssKI | ||Cfr9I | ||BssKI | ||SecI* | ||AvaI | |BmeT110I | |CauII* | |HpaII | |ScrFI | CauII* | ScrFI | SmaI MwoI F P G N S K F D D S K S L P V S E Q R K S R A I L N L M I V N R C P L A N K G S P G Q F * I * * * * I V A R * R T K E A ----:----|----:----|----:----|----:----|----:----|----:----| K G P L E L N S S L L D N G T L S C L F S G P C N * I Q H Y Y I T A R * R V F S E R A I R F K I I T F R Q G N A F L P L SetI |ApoI |TspEI MboII |EcoRI FokI | BseGI || DdeI | TspEI | | SmlI \\ \ \ \ \ \ \ CTGAATTCTAAGAAAGTTTTTGAAGAAAATTGTTCGTCATCCTTGAGAAATGATTTATTA 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| GACTTAAGATTCTTTCAAAAACTTCTTTTAACAAGCAGTAGGAACTCTTTACTAAATAAT / / / / / / / | DdeI | | | BseGI SmlI EcoRI | | MboII TspEI | TspEI ApoI FokI L N S K K V F E E N C S S S L R N D L L * I L R K F L K K I V R H P * E M I Y * E F * E S F * R K L F V I L E K * F I S ----:----|----:----|----:----|----:----|----:----|----:----| S F E L F T K S S F Q E D D K L F S K N A S N * S L K Q L F N N T M R S F H N I Q I R L F N K F F I T R * G Q S I I * * Hpy178III* | ApoI CviJI | TsoI | Bce83I* | TspEI TaqI | | SspI | EcoRI AciI AsuII Hin4II* PsiI \ \ \ \ \ \ \ \ \ GCCAATATTGTCCTGAATTCTACCGCCTTCGAAAACAGAGATTATAAGAAAAACGATAAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CGGTTATAACAGGACTTAAGATGGCGGAAGCTTTTGTCTCTAATATTCTTTTTGCTATTT / / // / / / / / | SspI || EcoRI AciI | Hin4II* PsiI Bce83I* || TspEI AsuII CviJI || ApoI TaqI |Hpy178III* TsoI A N I V L N S T A F E N R D Y K K N D K P I L S * I L P P S K T E I I R K T I K Q Y C P E F Y R L R K Q R L * E K R * K ----:----|----:----|----:----|----:----|----:----|----:----| A L I T R F E V A K S F L S * L F F S L L W Y Q G S N * R R R F C L N Y S F R Y G I N D Q I R G G E F V S I I L F V I F XbaI ApoI |MaeI TspEI |Hpy178III* \ \\ AATACAAATGGTAGTAAAAATATGTCAAAAAATTTGAGTTTTTTAGATAAGTGTAAATCT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGTTTACCATCATTTTTATACAGTTTTTTAAACTCAAAAAATCTATTCACATTTAGA / TspEI ApoI N T N G S K N M S K N L S F L D K C K S I Q M V V K I C Q K I * V F * I S V N L Y K W * * K Y V K K F E F F R * V * I * ----:----|----:----|----:----|----:----|----:----|----:----| F V F P L L F I D F F K L K K S L H L D F Y L H Y Y F Y T L F N S N K L Y T Y I I C I T T F I H * F I Q T K * I L T F R MboI |MboII ||DpnI |||BstKTI MseI BdaI ||||TspEI BdaI |AhaIII* BdaI MnlI ||||| BinI* BdaI \\ \ \ \\\\\ \ \ AGATTATCGTTTTTTAAAAAAGGCAACAGGGAAGATGACGAGGATCAATTATTCAAAAAT 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| TCTAATAGCAAAAAATTTTTTCCGTTGTCCCTTCTACTGCTCCTAGTTAATAAGTTTTTA // // / / /// / // / |XbaI |MseI BdaI MnlI ||| | |BinI* BdaI Hpy178III* AhaIII* BdaI ||| | TspEI BdaI MaeI ||| MboI ||DpnI |BstKTI MboII R L S F F K K G N R E D D E D Q L F K N D Y R F L K K A T G K M T R I N Y S K M I I V F * K R Q Q G R * R G S I I Q K C ----:----|----:----|----:----|----:----|----:----|----:----| L N D N K L F P L L S S S S S * N N L F * I I T K * F L C C P L H R P D I I * F S * R K K F F A V P F I V L I L * E F I HindII Hpy166II BsiYI* DdeI | AjuI | CviJI AjuI CviJI TspGWI \ \ \ \ \ \ \ GTCAACAAGGGTAGGCAAGAACCCTTTATTGGCTCTAAAACGGAAACAGCCTTACTCAGT 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTGTTCCCATCCGTTCTTGGGAAATAACCGAGATTTTGCCTTTGTCGGAATGAGTCA / / / / / / / / | AjuI BsiYI* CviJI AjuI | | DdeI Hpy166II | TspGWI HindII CviJI V N K G R Q E P F I G S K T E T A L L S S T R V G K N P L L A L K R K Q P Y S V Q Q G * A R T L Y W L * N G N S L T Q F ----:----|----:----|----:----|----:----|----:----|----:----| T L L P L C S G K I P E L V S V A K S L H * C P Y A L V R * Q S * F P F L R V * D V L T P L F G K N A R F R F C G * E T BssKI |HpaII ||ScrFI ||CauII* MboI ||| TspEI | DpnI BspCNI ||| | CviRI* | |BccI |BseMII ||| | | SspI | |BstKTI \\ \\\ \ \ \ \ \\ TTGGCAAGATTATCATTAGGATTACAACCGGGAGAATTGCAATATTTGAGAGATCAACCG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AACCGTTCTAATAGTAATCCTAATGTTGGCCCTCTTAACGTTATAAACTCTCTAGTTGGC // / / // / // / |BseMII | BssKI || SspI || MboI BspCNI CauII* |CviRI* || BccI HpaII TspEI |DpnI ScrFI BstKTI L A R L S L G L Q P G E L Q Y L R D Q P W Q D Y H * D Y N R E N C N I * E I N R G K I I I R I T T G R I A I F E R S T D ----:----|----:----|----:----|----:----|----:----|----:----| K A L N D N P N C G P S N C Y K L S * G N P L I I M L I V V P L I A I N S L D V Q C S * * * S * L R S F Q L I Q S I L R TspGWI MseI TaqI | TspEI \ \ \ \ ATGGAAAAGTTTAATATCGAAAAAGTTGTTCAAACAATTCCGTTTGAAAGTTCTCGTAAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTTTCAAATTATAGCTTTTTCAACAAGTTTGTTAAGGCAAACTTTCAAGAGCATTT / / / / MseI TaqI TspGWI TspEI M E K F N I E K V V Q T I P F E S S R K W K S L I S K K L F K Q F R L K V L V N G K V * Y R K S C S N N S V * K F S * M ----:----|----:----|----:----|----:----|----:----|----:----| I S F N L I S F T T * V I G N S L E R L S P F T * Y R F L Q E F L E T Q F N E Y H F L K I D F F N N L C N R K F T R T F AsuI* |BmgT120I ||MroNI ||CviJI ||Cfr10I ||HaeIII |||HpaII ||||NaeI TatI ||||Cac8I |Csp6I ||||| CviJI ||RsaI ||||| |DdeI ||Hin4II* TspDTI SetI \\\\\ \\ \\\ \ \ TGGGCCGGCTTAGTGGTAAAGTACAAAGAAGGCAAAAATAAAAAACCATTTTACAGGTTT 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCGGCCGAATCACCATTTCATGTTTCTTCCGTTTTTATTTTTTGGTAAAATGTCCAAA ///// / //// / / ||||| DdeI |||TatI | SetI ||||Cfr10I ||Csp6I TspDTI ||||MroNI |RsaI ||||CviJI Hin4II* |||HpaII ||Cac8I ||NaeI |AsuI* BmgT120I HaeIII CviJI W A G L V V K Y K E G K N K K P F Y R F G P A * W * S T K K A K I K N H F T G F G R L S G K V Q R R Q K * K T I L Q V F ----:----|----:----|----:----|----:----|----:----|----:----| H A P K T T F Y L S P L F L F G N * L N I P R S L P L T C L L C F Y F V M K C T P G A * H Y L V F F A F I F F W K V P K MnlI |Csp6I SetI ||RsaI |TseI |||EcoP15I |CviRI* |||| ApoI ||BisI TspEI BsgI |||| TspEI MseI |||BlsI | BbvI |TspEI |||| EcoRI Hpy188I \ \\\\ \ \ \\ \\\\ \ \ TTCATTAAAGGTGCAGCAGAAATTGTTTCCAAGAATTGTTCGTACAAGAGGAATTCAGAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAATTTCCACGTCGTCTTTAACAAAGGTTCTTAACAAGCATGTTCTCCTTAAGTCTA // //// / // / / // / // |SetI |||TseI | |BsgI | | || EcoP15I |Hpy188I MseI ||BisI | BbvI | | |Csp6I EcoRI |BlsI TspEI | | RsaI TspEI CviRI* | MnlI ApoI TspEI F I K G A A E I V S K N C S Y K R N S D S L K V Q Q K L F P R I V R T R G I Q M H * R C S R N C F Q E L F V Q E E F R * ----:----|----:----|----:----|----:----|----:----|----:----| K M L P A A S I T E L F Q E Y L L F E S K * * L H L L F Q K W S N N T C S S N L E N F T C C F N N G L I T R V L P I * I MnlI MboII HgaI SfaNI \ \ \ \ GATACTTTGGAAGAAATCAATGAGGACAATAAAAAAGAAACTGATGATGAAATCAAAAAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGAAACCTTCTTTAGTTACTCCTGTTATTTTTTCTTTGACTACTACTTTAGTTTTTA / / / / MnlI MboII | TspDTI HgaI D T L E E I N E D N K K E T D D E I K N I L W K K S M R T I K K K L M M K S K I Y F G R N Q * G Q * K R N * * * N Q K S ----:----|----:----|----:----|----:----|----:----|----:----| S V K S S I L S S L L F S V S S S I L F H Y K P L F * H P C Y F L F Q H H F * F I S Q F F D I L V I F F F S I I F D F I Hpy188I | DdeI | | MwoI | | Hpy188I BspCNI TspDTI |MwoI | | CviJI |BseMII \ \\ \ \ \ \\ CTTGCGTCCGATGCTCTCAGAGCCATAAGTGTTGCCCACAAAGATTTCTGCGAATGTGAT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| GAACGCAGGCTACGAGAGTCTCGGTATTCACAACGGGTGTTTCTAAAGACGCTTACACTA / // / // / // / | |Hpy188I | || | |BseMII SetI | MwoI | || | BspCNI SfaNI | || CviJI | |DdeI | Hpy188I MwoI L A S D A L R A I S V A H K D F C E C D L R P M L S E P * V L P T K I S A N V I C V R C S Q S H K C C P Q R F L R M * * ----:----|----:----|----:----|----:----|----:----|----:----| R A D S A R L A M L T A W L S K Q S H S D Q T R H E * L W L H Q G C L N R R I H K R G I S E S G Y T N G V F I E A F T I AluI CviJI Hin4I | SetI | TseI TseI | Cac8I | AluI AluI | |BbvI | CviJI CviJI | |AsuI* | PvuII |BisI | ||CviJI | NspBII* ||BlsI | ||HaeIII | |BisI MlyI ||SetI | ||BmgT120I | ||BlsI PleI HinfI ||Hin4I | |||NlaIV | ||SetI |HphI | BbvI ||| Hpy178III* \ \\\\ \ \\\ \\ \ \ \\\ \ AGCTGGCCCCCTGAACAGCTGCGTGATAAAGACTCACCAAATATAGCTGCTCTTGACTTG 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TCGACCGGGGGACTTGTCGACGCACTATTTCTGAGTGGTTTATATCGACGAGAACTGAAC / / //// / / //// // / / // //// / | | |||| | | |||| |PleI | BbvI || |||TseI Hpy178III* | | |||| | | |||| MlyI HinfI || ||BisI | | |||| | | |||| HphI || |BlsI | | |||| | | |||TseI || CviJI | | |||| | | ||BisI || AluI | | |||| | | |BlsI |SetI | | |||| | | NspBII* Hin4I | | |||| | | PvuII | | |||| | | CviJI | | |||| | | AluI | | |||| | SetI | | |||| Hin4I | | |||BbvI | | ||AsuI* | | |BmgT120I | | |NlaIV | | HaeIII | | CviJI | Cac8I CviJI AluI S W P P E Q L R D K D S P N I A A L D L A G P L N S C V I K T H Q I * L L L T C L A P * T A A * * R L T K Y S C S * L A ----:----|----:----|----:----|----:----|----:----|----:----| L Q G G S C S R S L S E G F I A A R S K Y S A G Q V A A H Y L S V L Y L Q E Q S A P G R F L Q T I F V * W I Y S S K V Q CviJI | MseI | |TspEI | || BccI | || | XbaI | || | |MaeI | || | |Hpy178III* | || | || Hpy166II | || | || | TfiI | || | || | HinfI MseI Tsp4CI* | || | || | | Hpy178III* MaeII \ \ \ \\ \ \\ \ \ \ \ CTATTTAACAGTCAAAAGGGCTTAATTCTAGATGGTTTACTTGGGATTCAAGACCCTTTA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| GATAAATTGTCAGTTTTCCCGAATTAAGATCTACCAAATGAACCCTAAGTTCTGGGAAAT / / / / // // / / / / | Tsp4CI* | | || |XbaI Hpy166II | | TaiI MseI | | || Hpy178III* | | SetI | | || MaeI | Hpy178III* | | |TspEI HinfI | | BccI TfiI | MseI CviJI L F N S Q K G L I L D G L L G I Q D P L Y L T V K R A * F * M V Y L G F K T L Y I * Q S K G L N S R W F T W D S R P F T ----:----|----:----|----:----|----:----|----:----|----:----| S N L L * F P K I R S P K S P I * S G K A I * C D F P S L E L H N V Q S E L G K * K V T L L A * N * I T * K P N L V R * HinfI | TatI | |Csp6I | ||RsaI | ||BsgI | |||PleI | ||||MlyI | ||||| Tsp4CI* | ||||| | TspRI | ||||| | | MaeII | ||||| | | | SetI BsaAI | ||||| | | | TaiI | SetI | ||||| | | | |BstXI | TaiI | ||||| | | | || MaeIII | |CviRI* | ||||| | | | || | TsoI | || Cac8I | ||||| | | | || | | Tsp4CI* MaeIII \ \\ \ \ \\\\\ \ \ \ \\ \ \ \ \ CGTGCAGGCGTTAGGGAGTCAGTACAACAGTGCCAACGTGCTGGTGTAACTGTGCGTATG 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| GCACGTCCGCAATCCCTCAGTCATGTTGTCACGGTTGCACGACCACATTGACACGCATAC // / / / / /// / // / / / || | Cac8I | | ||| | || MaeII | Tsp4CI* || CviRI* | | ||| | |BstXI | MaeIII |MaeII | | ||| | TaiI TsoI BsaAI | | ||| | SetI | | ||| Tsp4CI* | | ||TspRI | | ||PleI | | ||MlyI | | ||TatI | | |Csp6I | | RsaI | BsgI HinfI R A G V R E S V Q Q C Q R A G V T V R M V Q A L G S Q Y N S A N V L V * L C V W C R R * G V S T T V P T C W C N C A Y G ----:----|----:----|----:----|----:----|----:----|----:----| R A P T L S D T C C H W R A P T V T R I V H L R * P T L V V T G V H Q H L Q A Y T C A N P L * Y L L A L T S T Y S H T H MnlI | Hpy178III* MaeIII | |NruI Tsp45I MseI | |FnuDII* TfiI | BsrI HphI | || TspEI HinfI \ \ \ \ \\ \ \ GTTACTGGTGACAATATATTAACAGCAAAAGCAATCGCGAGGAATTGTGCGATTCTTTCT 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| CAATGACCACTGTTATATAATTGTCGTTTTCGTTAGCGCTCCTTAACACGCTAAGAAAGA / / / / / / // / / | BsrI | | MseI MnlI || TspEI HinfI MaeIII | HphI |Hpy178III* TfiI Tsp45I FnuDII* MaeIII NruI V T G D N I L T A K A I A R N C A I L S L L V T I Y * Q Q K Q S R G I V R F F L Y W * Q Y I N S K S N R E E L C D S F Y ----:----|----:----|----:----|----:----|----:----|----:----| T V P S L I N V A F A I A L F Q A I R E P * Q H C Y I L L L L L R S S N H S E K N S T V I Y * C C F C D R P I T R N K R ApoI TspEI EcoRI | TspRI | | Hpy188I MwoI | | | MseI | CviRI* | | | |HpaI Hpy188I | Hin4II* | | | |HindII MnlI | CviJI | | BsrDI | | | |Hpy166II \ \ \ \ \ \ \ \ \ \\ ACTGATATTAGTTCAGAGGCTTATTCTGCAATGGAAGGCACTGAATTCAGAAAGTTAACG 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTATAATCAAGTCTCCGAATAAGACGTTACCTTCCGTGACTTAAGTCTTTCAATTGC / / / / // / / // // MnlI | | MwoI || | TspRI |Hpy188I |MseI | CviJI || BsrDI EcoRI Hpy166II Hpy188I |CviRI* TspEI HindII Hin4II* ApoI HpaI T D I S S E A Y S A M E G T E F R K L T L I L V Q R L I L Q W K A L N S E S * R * Y * F R G L F C N G R H * I Q K V N E ----:----|----:----|----:----|----:----|----:----|----:----| V S I L E S A * E A I S P V S N L F N V * Q Y * N L P K N Q L P L C Q I * F T L S I N T * L S I R C H F A S F E S L * R DdeI | MboII | BbvII* ApoI | | BseMII MaeII TspEI | | |BspCNI | SetI TfiI | MseI | | ||SetI DdeI | TaiI HinfI | |BcgI | | ||| MnlI SauI* \ \ \ \ \\ \ \ \\\ \ \ AAAAACGAACGTATAAGAATCCTGCCAAATTTAAGGGTCTTAGCAAGGTCTTCGCCTGAG 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTGCTTGCATATTCTTAGGACGGTTTAAATTCCCAGAATCGTTCCAGAAGCGGACTC / / / // / / / // / / | MaeII HinfI || MseI | | || MnlI SauI* TaiI TfiI |TspEI | | |BspCNI DdeI SetI |ApoI | | BbvII* BcgI | | BseMII | | SetI | DdeI MboII K N E R I R I L P N L R V L A R S S P E K T N V * E S C Q I * G S * Q G L R L R K R T Y K N P A K F K G L S K V F A * G ----:----|----:----|----:----|----:----|----:----|----:----| F F S R I L I R G F K L T K A L D E G S S F R V Y L F G A L N L P R L L T K A Q F V F T Y S D Q W I * P D * C P R R R L FokI | AciI | | MaeIII | | Tsp45I | | | BccI Hin4II* | | | | BsaXI BcgI | BccI | | | | |BsrI | SetI | | BsaXI BseGI | | | | |TspRI \ \ \ \ \ \ \ \ \ \ \\ GATAAAAGGTTATTAGTAGAAACATTGAAGGGGATGGGAGATGTTGTTGCGGTCACTGGC 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTTCCAATAATCATCTTTGTAACTTCCCCTACCCTCTACAACAACGCCAGTGACCG / / / / / / / / / / / | SetI | | BccI BseGI | | | | Eco57MI BcgI | BsaXI | | | | GsuI Hin4II* | | | BsrI | | Tsp45I | | MaeIII | | BsaXI | | BccI | TspRI | AciI FokI D K R L L V E T L K G M G D V V A V T G I K G Y * * K H * R G W E M L L R S L A * K V I S R N I E G D G R C C C G H W R ----:----|----:----|----:----|----:----|----:----|----:----| S L L N N T S V N F P I P S T T A T V P P Y F T I L L F M S P S P L H Q Q P * Q I F P * * Y F C Q L P H S I N N R D S A AluI CviJI | SetI | |MseI | ||AhaIII* | ||| NheI | ||| AluI | ||| CviJI | ||| |MaeI | ||| ||SetI GsuI | ||| ||Cac8I Eco57MI | ||| ||| AluI |SfaNI | ||| ||| BmtI || Csp6I | ||| ||| CviJI || |RsaI BtgZI | ||| ||| | SetI BaeI \\ \\ \ \ \\\ \\\ \ \ \ GATGGTACGAACGATGCTCCAGCTTTAAAGCTAGCTGATGTTGGTTTCTCAATGGGTATT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCATGCTTGCTACGAGGTCGAAATTTCGATCGACTACAACCAAAGAGTTACCCATAA // / / / /// / /// / |Csp6I | | | ||| | ||CviJI BaeI |SfaNI | | | ||| | ||NheI RsaI | | | ||| | ||AluI | | | ||| | |MaeI | | | ||| | Cac8I | | | ||| | SetI | | | ||| CviJI | | | ||| AluI | | | ||| BmtI | | | ||SetI | | | |MseI | | | AhaIII* | | CviJI | | AluI | SetI BtgZI D G T N D A P A L K L A D V G F S M G I M V R T M L Q L * S * L M L V S Q W V F W Y E R C S S F K A S * C W F L N G Y F ----:----|----:----|----:----|----:----|----:----|----:----| S P V F S A G A K F S A S T P K E I P I R H Y S R H E L K L A L Q H Q N R L P Y I T R V I S W S * L * S I N T E * H T N BglI BetI* MwoI |HpaII TspGWI ||MnlI | CviJI ||| Csp6I SetI | | BaeI ||| |RsaI |MnlI | | |Hpy188I Hin4I DdeI \\\ \\ \\ \ \ \\ \ \ TCCGGTACGGAGGTTGCCAGAGAGGCTTCTGACATTATTTTGATGACTGATGATTTCTCA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCCATGCCTCCAACGGTCTCTCCGAAGACTGTAATAAAACTACTGACTACTAAAGAGT / //// / / // // / / // | |||| | MnlI || || | Hin4I |DdeI | |||| SetI || || Hpy188I SetI | |||Csp6I || |CviJI | ||RsaI || BaeI | |BetI* |TspGWI | HpaII MwoI MnlI BglI S G T E V A R E A S D I I L M T D D F S P V R R L P E R L L T L F * * L M I S Q R Y G G C Q R G F * H Y F D D * * F L S ----:----|----:----|----:----|----:----|----:----|----:----| E P V S T A L S A E S M I K I V S S K E K R Y P P Q W L P K Q C * K S S Q H N R G T R L N G S L S R V N N Q H S I I E * HindII Hpy166II |BspCNI AluI ||BseMII CviJI |||Hin4I BsmAI | SetI |||| MseI MboII TspDTI \ \ \\\\ \ \ \ GCTATTGTCAACGCTATTAAGTGGGGAAGATGTGTTTCAGTCTCCATAAAAAAGTTCATA 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| CGATAACAGTTGCGATAATTCACCCCTTCTACACAAAGTCAGAGGTATTTTTTCAAGTAT / /// / / / / CviJI ||Hpy166II MseI MboII | BsmAI AluI ||BseMII TspDTI ||HindII |BspCNI Hin4I A I V N A I K W G R C V S V S I K K F I L L S T L L S G E D V F Q S P * K S S Y Y C Q R Y * V G K M C F S L H K K V H T ----:----|----:----|----:----|----:----|----:----|----:----| A I T L A I L H P L H T E T E M F F N M L * Q * R * * T P F I H K L R W L F T * S N D V S N L P S S T N * D G Y F L E Y BtsI TspRI |FokI Tsp4CI* ||MseI | TspEI |||TspDTI | | MseI |||| AclI | | VspI |||| MaeII | | |TspEI AciI |||| | TspGWI Hin4I | | || HphI | OliI |||| | |SetI Hin4I | | || | MseI | MslI |||| | |TaiI BseGI CviRI* \ \ \\ \ \ \ \ \\\\ \ \\ \ \ CAGTTTCAATTAATTGTTAATATCACCGCAGTGATTTTAACGTTCGTTTCATCCGTTGCA 2710 2720 2730 2740 2750 2760 ----:----|----:----|----:----|----:----|----:----|----:----| GTCAAAGTTAATTAACAATTATAGTGGCGTCACTAAAATTGCAAGCAAAGTAGGCAACGT / // // / / / / / // / / / / Tsp4CI* || || MseI | MslI | | || | BseGI | CviRI* || |TspEI | OliI | | || MaeII Hin4I || HphI | AciI | | || AclI Hin4I |VspI TspRI | | |TspGWI |MseI | | |FokI TspEI | | MseI | | TaiI | | SetI | TspDTI BtsI Q F Q L I V N I T A V I L T F V S S V A S F N * L L I S P Q * F * R S F H P L H V S I N C * Y H R S D F N V R F I R C I ----:----|----:----|----:----|----:----|----:----|----:----| C N * N I T L I V A T I K V N T E D T A V T E I L Q * Y * R L S K L T R K M R Q L K L * N N I D G C H N * R E N * G N C TatI |Csp6I ||RsaI ||ScaI ||| TspDTI ||| | AciI ||| | PshAI ||| | | AsuI* ||| | | AvaII ||| | | Hin4I ||| | | Hin4I ||| | | |BmgT120I ||| | | || Tsp4CI* ||| | | || | BceAI ||| | | || | | MboI ||| | | || | | | DpnI ||| | | || | | | |BstKTI ||| | | || | | | || BinI* ||| | | || | | | || | BciVI ||| | | || | | | || | | FatI ||| | | || | | | || | | |MmeI ||| | | || | | | || | | |CviAII MaeI SfaNI ||| | | || | | | || | | || NlaIII \ \ \\\ \ \ \\ \ \ \ \\ \ \ \\ \ TCTAGTGATGAAACATCAGTACTGACGGCGGTCCAACTGTTATGGATCAATCTAATCATG 2770 2780 2790 2800 2810 2820 ----:----|----:----|----:----|----:----|----:----|----:----| AGATCACTACTTTGTAGTCATGACTGCCGCCAGGTTGACAATACCTAGTTAGATTAGTAC / / /// / / / // / / // / / // // MaeI SfaNI ||| | | | || | | || MboI | || |FatI ||| | | | || | | |DpnI | || CviAII ||| | | | || | | BstKTI | |NlaIII ||| | | | || | BceAI | MmeI ||| | | | || Tsp4CI* BinI* ||| | | | |AvaII BciVI ||| | | | |AsuI* ||| | | | BmgT120I ||| | | AciI ||| | PshAI ||| Hin4I ||| Hin4I ||TatI |TspDTI |Csp6I ScaI RsaI S S D E T S V L T A V Q L L W I N L I M L V M K H Q Y * R R S N C Y G S I * S W * * * N I S T D G G P T V M D Q S N H G ----:----|----:----|----:----|----:----|----:----|----:----| D L S S V D T S V A T W S N H I L R I M M * H H F M L V S P P G V T I S * D L * R T I F C * Y Q R R D L Q * P D I * D H MaeI | TseI | |BisI | ||BlsI | |||AluI | |||CviJI | |||| SetI | |||| |MwoI TspRI | |||| || AluI |BinI* | |||| || CviJI || MboI | |||| || | SetI || TsoI FatI | |||| || | |BbvI || | DpnI |CviAII | |||| || | || CviJI || | |BstKTI || NlaIII \ \\\\ \\ \ \\ \ \\ \ \\ \\ \ GATACTCTAGCAGCTTTAGCTTTAGCCACTGATAAACCCGATCCAAATATCATGGACAGA 2830 2840 2850 2860 2870 2880 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGAGATCGTCGAAATCGAAATCGGTGACTATTTGGGCTAGGTTTATAGTACCTGTCT / /// / / /// / / // / / // | ||| | | ||BbvI | | || MboI | |FatI | ||| | | |CviJI | | |DpnI | CviAII | ||| | | TspRI | | BstKTI NlaIII | ||| | CviJI | TsoI | ||| | AluI BinI* | ||| SetI | ||CviJI | ||MwoI | ||TseI | ||AluI | |BisI | BlsI | SetI MaeI D T L A A L A L A T D K P D P N I M D R I L * Q L * L * P L I N P I Q I S W T E Y S S S F S F S H * * T R S K Y H G Q K ----:----|----:----|----:----|----:----|----:----|----:----| S V R A A K A K A V S L G S G F I M S L P Y E L L K L K L W Q Y V R D L Y * P C I S * C S * S * G S I F G I W I D H V S StyI AvrII SecI* |MaeI ||SetI ||| AsuI* ||| |NlaIV ||| |BmgT120I ||| ||CviJI ||| ||HaeIII ||| |||AciI ||| |||BisI ||| ||||BlsI ||| |||||TauI HindII TfiI ||| |||||BsrBI Hpy166II HinfI \\\ \\\\\\ \ \ AAACCTAGGGGCCGCTCAACTTCTTTGATTTCTGTGTCAACTTGGAAAATGATTCTATCA 2890 2900 2910 2920 2930 2940 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGATCCCCGGCGAGTTGAAGAAACTAAAGACACAGTTGAACCTTTTACTAAGATAGT / // ///// / / SetI || ||||BsrBI Hpy166II HinfI || ||||AciI HindII TfiI || |||BisI || ||AsuI* || ||BlsI || |BmgT120I || |HaeIII || |CviJI || |TauI || NlaIV |SecI* |AvrII |StyI MaeI K P R G R S T S L I S V S T W K M I L S N L G A A Q L L * F L C Q L G K * F Y H T * G P L N F F D F C V N L E N D S I T ----:----|----:----|----:----|----:----|----:----|----:----| F G L P R E V E K I E T D V Q F I I R D F V * P G S L K K S K Q T L K S F S E I F R P A A * S R Q N R H * S P F H N * * AluI CviJI | SetI AsuI* | |BsrDI |BmgT120I | || CviRI* ||CviJI | || | TspDTI ||HaeIII | || | | MaeIII CviRI* ||| MboII \ \\ \ \ \ \ \\\ \ CAAGCTACATTGCAGTTGATAGTTACTTTCATTTTGCATTTTTACGGGCCAGAGTTATTC 2950 2960 2970 2980 2990 3000 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCGATGTAACGTCAACTATCAATGAAAGTAAAACGTAAAAATGCCCGGTCTCAATAAG / // / / / / /// | |BsrDI | TspDTI MaeIII CviRI* ||MboII | CviJI CviRI* |AsuI* | AluI BmgT120I SetI HaeIII CviJI Q A T L Q L I V T F I L H F Y G P E L F K L H C S * * L L S F C I F T G Q S Y S S Y I A V D S Y F H F A F L R A R V I L ----:----|----:----|----:----|----:----|----:----|----:----| C A V N C N I T V K M K C K * P G S N N V L * M A T S L * K * K A N K R A L T I L S C Q L Q Y N S E N Q M K V P W L * E HphI | MboII | |TspDTI Hpy178III* | || MaeIII BbvI | FatI | || Tsp45I TseI | FatI | |CviAII | || | AlfI |BisI | |BsmI | || NlaIII | || | AlfI ||BlsI | |CviAII | || |MslI | || | |TspDTI ||| AlwNI | || NlaIII \ \\ \\ \ \\ \ \\ \\\ \ \ \\ \ TTCAAGAAACATGAAGATGAAATAACAAGTCACCAACAGCAGCAACTGAATGCCATGACA 3010 3020 3030 3040 3050 3060 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTCTTTGTACTTCTACTTTATTGTTCAGTGGTTGTCGTCGTTGACTTACGGTACTGT / / /// / / // / /// // /// | | ||MslI | | || Tsp45I ||AlwNI || ||FatI | | |FatI | | || MaeIII ||TseI || |CviAII | | CviAII | | |TspDTI |BisI || BbvI | NlaIII | | AlfI BlsI |NlaIII Hpy178III* | | AlfI BsmI | TspDTI | MboII HphI F K K H E D E I T S H Q Q Q Q L N A M T S R N M K M K * Q V T N S S N * M P * H Q E T * R * N N K S P T A A T E C H D I ----:----|----:----|----:----|----:----|----:----|----:----| K L F C S S S I V L * W C C C S F A M V R * S V H L H F L L D G V A A V S H W S E L F M F I F Y C T V L L L L Q I G H C TaqI |Hpy178III* || TspEI || | Hin4II* AlfI FatI || | | Hin4I AlfI CviRI* |CviAII || | | Hin4I | EcoP15I |TspEI || NlaIII || | | | BccI \ \ \\ \\ \ \\ \ \ \ \ TTCAACACTTTTGTTTGGTTGCAATTTTTTACCATGTTAGTATCGAGAAAATTAGATGAA 3070 3080 3090 3100 3110 3120 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTGTGAAAACAAACCAACGTTAAAAAATGGTACAATCATAGCTCTTTTAATCTACTT / / / / / // // // / / AlfI EcoP15I | TspEI | |FatI || || TspEI SetI AlfI CviRI* | CviAII || |Hin4II* BccI NlaIII || Hin4I || Hin4I |Hpy178III* TaqI F N T F V W L Q F F T M L V S R K L D E S T L L F G C N F L P C * Y R E N * M K Q H F C L V A I F Y H V S I E K I R * R ----:----|----:----|----:----|----:----|----:----|----:----| N L V K T Q N C N K V M N T D L F N S S M * C K Q K T A I K * W T L I S F I L H E V S K N P Q L K K G H * Y R S F * I F AjuI | AciI | BisI | |BlsI | |GsuI | |Eco57MI | ||TauI | ||| TspEI | ||| | MboII TspDTI | ||| | | ApoI | HphI Hin4I | ||| | | TspEI SetI | | MnlI BsrI Hin4I | ||| | | | XmnI \ \ \ \ \ \ \ \\\ \ \ \ \ GGTGATGGTATATCAAACTGGAGAGGCAGGATTTCTGCCGCCAATTTGAATTTCTTCCAA 3130 3140 3150 3160 3170 3180 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTACCATATAGTTTGACCTCTCCGTCCTAAAGACGGCGGTTAAACTTAAAGAAGGTT / / / / / / //// / / / / | | MnlI | Hin4I AjuI |||| | TspEI TspEI BsiYI* | HphI | Hin4I |||| MboII XmnI PflMI TspDTI BsrI |||AciI ApoI ||BisI |BlsI Eco57MI GsuI TauI G D G I S N W R G R I S A A N L N F F Q V M V Y Q T G E A G F L P P I * I S S K * W Y I K L E R Q D F C R Q F E F L P R ----:----|----:----|----:----|----:----|----:----|----:----| P S P I D F Q L P L I E A A L K F K K W L H H Y I L S S L C S K Q R W N S N R G T I T Y * V P S A P N R G G I Q I E E L Hpy178III* | MboI | | DpnI | | MslI | | |FatI | | |BstKTI | | ||CviAII | | ||| NlaIII | | ||| | MboI | | ||| | | DpnI | | ||| | | |BstKTI | | ||| | | || TseI | | ||| | | || |BisI | | ||| | | || ||BlsI | | ||| | | || |||AluI | | ||| | | || |||CviJI PflMI | | ||| | | || |||PvuII BsiYI* | | ||| | | || |||NspBII* | AjuI | | ||| | | || |||| SetI BbvI \ \ \ \ \\\ \ \ \\ \\\\ \ \ GACTTGGGTAGAAACTATTATTTTCTCACGATCATGGCGATCATTGGCAGCTGTCAAGTT 3190 3200 3210 3220 3230 3240 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAACCCATCTTTGATAATAAAAGAGTGCTAGTACCGCTAGTAACCGTCGACAGTTCAA / ///// // // / /// AjuI ||||| || || MboI ||NspBII* ||||| || |DpnI ||PvuII ||||| || BstKTI ||CviJI ||||| |FatI ||TseI ||||| CviAII ||AluI ||||MboI |BisI |||NlaIII BlsI ||MslI SetI ||DpnI |BstKTI Hpy178III* D L G R N Y Y F L T I M A I I G S C Q V T W V E T I I F S R S W R S L A A V K F L G * K L L F S H D H G D H W Q L S S F ----:----|----:----|----:----|----:----|----:----|----:----| S K P L F * * K R V I M A I M P L Q * T L S P Y F S N N E * S * P S * Q C S D L V Q T S V I I K E R D H R D N A A T L N MseI | FatI Hin6I | |CviAII |GlaI | || NlaIII ||HhaI \ \\ \ \\\ TTAATCATGTTTTTTGGTGGCGCACCATTTTCTATTGCCAGACAAACCAAATCAATGTGG 3250 3260 3270 3280 3290 3300 ----:----|----:----|----:----|----:----|----:----|----:----| AATTAGTACAAAAAACCACCGCGTGGTAAAAGATAACGGTCTGTTTGGTTTAGTTACACC / / // /// | | |FatI ||Hin6I | | CviAII |GlaI | NlaIII HhaI BbvI MseI L I M F F G G A P F S I A R Q T K S M W * S C F L V A H H F L L P D K P N Q C G N H V F W W R T I F Y C Q T N Q I N V D ----:----|----:----|----:----|----:----|----:----|----:----| K I M N K P P A G N E I A L C V L D I H K L * T K Q H R V M K * Q W V F W I L T * D H K K T A C W K R N G S L G F * H P AciI SecI* DsaI* | AciI | FnuDII* | NspBII* BsmAI | |SacII | FatI | || Csp6I | |CviAII | || |RsaI | || NlaIII TfiI | || || Tsp4CI* | || |MslI MaeI HinfI \ \\ \\ \ \ \\ \\ \ \ ATAACCGCGGTACTGTGTGGTATGTTGTCTCTAATCATGGGGGTGCTAGTGAGAATCTGC 3310 3320 3330 3340 3350 3360 ----:----|----:----|----:----|----:----|----:----|----:----| TATTGGCGCCATGACACACCATACAACAGAGATTAGTACCCCCACGATCACTCTTAGACG // / /// // /// / / || | ||Tsp4CI* || ||MslI MaeI HinfI || | |Csp6I || |FatI TfiI || | RsaI || CviAII || DsaI* |BsmAI || SecI* NlaIII || AciI |NspBII* |FnuDII* |AciI SacII I T A V L C G M L S L I M G V L V R I C * P R Y C V V C C L * S W G C * * E S A N R G T V W Y V V S N H G G A S E N L P ----:----|----:----|----:----|----:----|----:----|----:----| I V A T S H P I N D R I M P T S T L I Q S L R P V T H Y T T E L * P P A L S F R Y G R Y Q T T H Q R * D H P H * H S D A Csp6I |RsaI ||MaeII Hin4II* |||BsaAI | BbvI HpaII |||SnaBI | | BtsI | TseI |||| MlyI | | TspRI | CviJI |||| PleI | | TspDTI | |BisI TfiI |||| SetI | | | SetI | ||BlsI HinfI |||| TaiI \ \ \ \ \ \\\ \ \\\\ \ CCCGATGAAGTAGCAGTGAAGGTATTTCCGGCTGCTTTCGTTCAAAGATTCAAGTACGTA 3370 3380 3390 3400 3410 3420 ----:----|----:----|----:----|----:----|----:----|----:----| GGGCTACTTCATCGTCACTTCCATAAAGGCCGACGAAAGCAAGTTTCTAAGTTCATGCAT / // / ///// / ////// | || BbvI ||||TseI | |||||PleI | |SetI |||BisI | ||||MlyI | TspDTI ||BlsI | |||MaeII | BtsI |CviJI | ||SnaBI Hin4II* HpaII | ||BsaAI TspRI | |Csp6I | RsaI | TaiI | SetI HinfI TfiI P D E V A V K V F P A A F V Q R F K Y V P M K * Q * R Y F R L L S F K D S S T Y R * S S S E G I S G C F R S K I Q V R I ----:----|----:----|----:----|----:----|----:----|----:----| G S S T A T F T N G A A K T * L N L Y T G R H L L L S P I E P Q K R E F I * T R G I F Y C H L Y K R S S E N L S E L V Y HinfI | AvaI | XhoI | SmlI | PspXI | |TaqI | |BmeT110I | || DdeI Hin6I | || | Hpy188I |GlaI | || | | MnlI |Eco47III | || | | | BspCNI MmeI ||MnlI | || | | | |BseMII | MslI ||HhaI | || | | | || BsrI | | Hpy99I |||HaeII \ \\ \ \ \ \\ \ \ \ \ \\\\ TTTGGACTCGAGTTCCTCAGAAAAAACCATACTGGAAAACACGACGATGAAGAAGCGCTG 3430 3440 3450 3460 3470 3480 ----:----|----:----|----:----|----:----|----:----|----:----| AAACCTGAGCTCAAGGAGTCTTTTTTGGTATGACCTTTTGTGCTGCTACTTCTTCGCGAC / // // / // / / / / //// / | |PspXI |DdeI | || BsrI | | MslI |||| TspDTI | |SmlI | | |BseMII | Hpy99I |||| MboII | |XhoI | | BspCNI MmeI |||Hin6I | |AvaI | MnlI ||Eco47III | | Hpy188I ||GlaI | BmeT110I ||MnlI | TaqI |HhaI HinfI HaeII F G L E F L R K N H T G K H D D E E A L L D S S S S E K T I L E N T T M K K R C W T R V P Q K K P Y W K T R R * R S A V ----:----|----:----|----:----|----:----|----:----|----:----| N P S S N R L F F W V P F C S S S S A S I Q V R T G * F F G Y Q F V R R H L L A K S E L E E S F V M S S F V V I F F R Q MboII |TspDTI || TfiI || HinfI || | Hpy188I || | | Hpy178III* || | | | HinfI || | | | | Hpy166II || | | | | | AciI || | | | | | |PleI || | | | | | ||MlyI MseI \\ \ \ \ \ \ \\\ \ TTGGAGGAATCTGATAGTCCAGAGTCCACCGCCTTTTATTAA 3490 3500 3510 3520 ----:----|----:----|----:----|----:----|-- AACCTCCTTAGACTATCAGGTCTCAGGTGGCGGAAAATAATT // / // / / |Hpy188I | || PleI MseI HinfI | || MlyI TfiI | || AciI | |Hpy166II | HinfI Hpy178III* L E E S D S P E S T A F Y * W R N L I V Q S P P P F I X G G I * * S R V H R L L L X ----:----|----:----|----:----|----:----|-- N S S D S L G S D V A K * * T P P I Q Y D L T W R R K N Q L F R I T W L G G G K I L # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 14 BspACI,SsiI AclI 1 Psp1406I AgeI 2 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AjuI 2 AlfI 2 AloI 1 AluI 15 AluBI AlwNI 1 CaiI ApoI 13 AcsI,XapI AsuI* 6 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI AvrII 1 AspA2I,BlnI,XmaJI BaeI 1 BbvI 8 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 9 Bce83I* 1 BpuEI BceAI 1 BcgI 2 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BdaI 2 BetI* 5 BsaWI BglI 1 BinI* 7 AlwI,BspPI,AclWI BisI 12 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 12 BmeT110I 2 BmgT120I 6 BmtI 1 BspOI Bpu10I 1 BsaAI 2 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BsaXI 1 BseGI 6 BstF5I,BtsCI BseMII 7 BsgI 2 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 7 BspHI 2 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 2 AccBSI,MbiI BsrDI 2 BseMI,Bse3DI BsrI 7 BseNI,Bse1I,BsrSI BssKI 3 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstKTI 13 BstXI 1 BtgZI 1 BtrI 1 BmgBI,AjiI BtsI 3 Cac8I 5 BstC8I CauII* 3 BcnI,BpuMI,NciI,AsuC2I Cfr10I 3 BsrFI,BssAI,Bse118I Cfr9I 1 TspMI,XmaCI,XmaI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 11 CviQI,RsaNI CviAII 12 CviJI 37 CviKI-1 CviRI* 15 HpyCH4V DdeI 11 BstDEI,HpyF3I DpnI 13 MalI DsaI* 2 BtgI,BstDSI Eco47III 1 Aor51HI,AfeI Eco57I 1 AcuI Eco57MI 3 EcoP15I 2 EcoRI 5 EcoRV 1 Eco32I FatI 12 FauI 2 SmuI FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 6 GlaI 2 GsuI 2 BpmI HaeII 1 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 15 Hin4II* 11 HpyAV Hin6I 2 HinP1I,HspAI HindII 7 HincII HinfI 15 HpaI 2 KspAI HpaII 9 HapII,BsiSI,MspI HphI 10 AsuHPI Hpy166II 14 Hpy8I Hpy178III* 20 Hpy188III Hpy188I 11 Hpy99I 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 12 FspBI,BfaI,XspI MaeII 8 HpyCH4IV MaeIII 10 MboI 13 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 13 MfeI 1 MunI MlyI 6 SchI MmeI 2 MnlI 15 MroNI 1 NgoMIV MseI 23 Tru1I,Tru9I MslI 6 RseI,SmiMI MwoI 7 HpyF10VI,BstMWI NaeI 1 PdiI NheI 1 AsuNHI NlaIII 12 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 5 MspA1I OliI 2 AleI PflMI 1 BasI,AccB7I,Van91I PleI 6 PpsI PshAI 1 BstPAI,BoxI PsiI 1 AanI PspXI 1 PsrI 1 PstI 1 PvuII 2 RsaI 11 AfaI SacII 1 KspI,Cfr42I,Sfr303I,SgrBI,SstII SauI* 2 Bse21I,Bsu36I,Eco81I,AxyI ScaI 2 BmcAI,AssI,ZrmI ScrFI 3 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 4 BseDI,BssECI,BsaJI SetI 40 SfaNI 4 LweI SfeI* 1 BstSFI,SfcI,BfmI SmaI 1 SmlI 2 SmoI SnaBI 1 Eco105I,BstSNI SspI 3 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 8 TaqI 6 TatI 4 TauI 4 TfiI 9 PfeI TseI 8 ApeKI TsoI 4 Tsp45I 4 NmuCI Tsp4CI* 16 HpyCH4III,TaaI,Bst4CI TspDTI 17 TspEI 42 TasI,Tsp509I,Sse9I TspGWI 7 TspRI 8 TscAI VspI 2 PshBI,AseI XbaI 4 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AflIII ApaI ApaLI AscI Asp718I BalI BamHI BarI BbvCI BfiI BglII BplI BseBI BsePI BseRI BseSI BseYI BsiI* Bsp120I Bsp1407I BspLU11I* Bst2UI BstAPI BstEII BstNI BstOI CfrI CspCI DinI DraII DraIII DrdI Eam1105I EciI Ecl136II Eco31I EcoICRI EcoNI EcoRII EcoT22I EgeI EheI Esp3I EspI* FalI FseI FspAI GsaI HgiCI* HgiJII* HindIII KasI KpnI MauBI McrI* MluI Mph1103I MstI* MvaI NarI NcoI NdeI NmeAIII NotI NsiI NspI PacI PasI PfoI PmaCI PmeI PpiI PpuMI PspOMI PvuI RsrII SacI SalI SanDI SapI SexAI SfiI SfoI SgfI SgrAI SgrDI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TstI Tth111I XcmI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769