Restriction Map of RSC8/YFR037C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

RSC8/YFR037C on chromosome VI from coordinates 229186 to 227513.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 BseGI | MlyI | PleI | | FokI | | |AccI BslFI | | ||Hpy166II SecI* | TspRI | | |||HinfI MnlI McrI* \ \ \ \ \\\\ \ \ ATGAGCGACACTGAAAAGGATAAGGATGTCCCTATGGTAGACTCGCACGAAGCGACCGAG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCGCTGTGACTTTTCCTATTCCTACAGGGATACCATCTGAGCGTGCTTCGCTGGCTC / / / // /// / / / / TspRI BslFI BseGI || ||| HinfI | McrI* SecI* || ||FokI MnlI || |AccI || Hpy166II |PleI MlyI M S D T E K D K D V P M V D S H E A T E * A T L K R I R M S L W * T R T K R P R E R H * K G * G C P Y G R L A R S D R G ----:----|----:----|----:----|----:----|----:----|----:----| X L S V S F S L S T G I T S E C S A V S X S R C Q F P Y P H G * P L S A R L S R H A V S F L I L I D R H Y V R V F R G L NlaIV TaqII Hin4II* |CviJI | BseRI TaqII BccI DdeI MnlI | MnlI \\ \ \ \ \ \ \ \ \ GAGCCACCCACCACAAGCACCAACACGCCATCTTTCCCTCACTTAGCACAGGAACAGGCG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGGTGGGTGGTGTTCGTGGTTGTGCGGTAGAAAGGGAGTGAATCGTGTCCTTGTCCGC // / / / / // / / || | BseRI TaqII BccI |MnlI | MnlI || TaqII DdeI Hin4II* |CviJI NlaIV E P P T T S T N T P S F P H L A Q E Q A S H P P Q A P T R H L S L T * H R N R R A T H H K H Q H A I F P S L S T G T G E ----:----|----:----|----:----|----:----|----:----|----:----| S G G V V L V L V G D K G * K A C S C A P A V W W L C W C A M K G E S L V P V P L W G G C A G V R W R E R V * C L F L R MwoI | AluI TfiI | CviJI BsaXI HinfI BsaXI | | SetI | TspEI \ \ \ \ \ \ \ AAGGAGGAATCTGCCACATTGGGAGCAGAAGTAGCTCATAAGAAAATCAATTACGAGCAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCTCCTTAGACGGTGTAACCCTCGTCTTCATCGAGTATTCTTTTAGTTAATGCTCGTT // / / / / / |BsaXI | | CviJI BsaXI TspEI HinfI | | AluI TfiI | SetI MwoI K E E S A T L G A E V A H K K I N Y E Q R R N L P H W E Q K * L I R K S I T S K G G I C H I G S R S S S * E N Q L R A R ----:----|----:----|----:----|----:----|----:----|----:----| F S S D A V N P A S T A * L F I L * S C S P P I Q W M P L L L L E Y S F * N R A L L F R G C Q S C F Y S M L F D I V L L AsuI* DraII |CviJI |HaeIII |BmgT120I || DdeI || SauI* || | BseRI || | | SetI || | | GsuI || | | NlaIV BssKI || | | Eco57MI | HpaII MnlI || | | |BssKI | ScrFI | AlwNI || | | |EcoRII | CauII* | | Hin4II* || | | || ScrFI | |TspGWI | | | BsrI || | | || BseBI HphI | ||DraIII \ \ \ \ \\ \ \ \\ \ \ \ \\\ GAAGCACAGAAACTGGAGGAGAAGGCCCTTAGGTTCCTGGCAAAGCAAACTCACCCGGTG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCGTGTCTTTGACCTCCTCTTCCGGGAATCCAAGGACCGTTTCGTTTGAGTGGGCCAC // // /// //// / / / / / /// || |BsrI ||| |||| | | | HphI | ||BssKI || Hin4II* ||| |||| | | EcoRII | |HpaII |AlwNI ||| |||| | | BssKI | CauII* MnlI ||| |||| | BseBI | ScrFI ||| |||| | ScrFI DraIII ||| |||| NlaIV TspGWI ||| |||Eco57MI ||| |||GsuI ||| ||SauI* ||| ||DdeI ||| |SetI ||| BseRI ||DraII ||AsuI* |BmgT120I HaeIII CviJI E A Q K L E E K A L R F L A K Q T H P V K H R N W R R R P L G S W Q S K L T R * S T E T G G E G P * V P G K A N S P G D ----:----|----:----|----:----|----:----|----:----|----:----| S A C F S S S F A R L N R A F C V * G T L L V S V P P S P G * T G P L A F E G P F C L F Q L L L G K P E Q C L L S V R H BinI* |TaqI |AsuII || MboI || XhoII || | DpnI || | |BstKTI || | || BsiI* || | || | MboI || | || | |MboII || | || | ||DpnI || | || | |||TaqI || | || | |||BstKTI || | || | |||| BinI* || | || | |||| | MboI HphI || | || | |||| | XhoII | Hpy99I MnlI || | || | |||| | | DpnI \ \ \ \\ \ \\ \ \\\\ \ \ \ ATTATTCCGTCGTTTGCCTCTTGGTTTGATATTTCGAAGATCCACGAGATCGAAAAAAGA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TAATAAGGCAGCAAACGGAGAACCAAACTATAAAGCTTCTAGGTGCTCTAGCTTTTTTCT // / / / // / /// // / // |HphI MnlI | | || | ||| || | |DpnI Hpy99I | | || | ||| || | BstKTI | | || | ||| || BinI* | | || | ||| |TaqI | | || | ||| MboI | | || | ||DpnI | | || | |BstKTI | | || | MboII | | || | BsiI* | | || XhoII | | || MboI | | |DpnI | | BstKTI | AsuII | TaqI BinI* I I P S F A S W F D I S K I H E I E K R L F R R L P L G L I F R R S T R S K K D Y S V V C L L V * Y F E D P R D R K K I ----:----|----:----|----:----|----:----|----:----|----:----| I I G D N A E Q N S I E F I W S I S F L S * E T T Q R K T Q Y K S S G R S R F F N N R R K G R P K I N R L D V L D F F S BstKTI | Hpy178III* TfiI SetI | | TspDTI HinfI | Hpy178III* \ \ \ \ \ \ TCCAATCCCGACTTTTTCAACGATTCATCAAGGTTCAAGACACCAAAGGCATATAAGGAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AGGTTAGGGCTGAAAAAGTTGCTAAGTAGTTCCAAGTTCTGTGGTTTCCGTATATTCCTG / / / / / / XhoII | TspDTI | SetI Hpy178III* MboI Hpy178III* HinfI TfiI S N P D F F N D S S R F K T P K A Y K D P I P T F S T I H Q G S R H Q R H I R T Q S R L F Q R F I K V Q D T K G I * G H ----:----|----:----|----:----|----:----|----:----|----:----| D L G S K K L S E D L N L V G F A Y L S I W D R S K * R N M L T * S V L P M Y P G I G V K E V I * * P E L C W L C I L V AflIII |BceAI ||MaeII |||BsaAI ||||Csp6I |||||RsaI |||||SetI SplI* ApoI |||||TaiI |Csp6I TspEI |||||| Tsp4CI* ||RsaI SspI AciI \ \\\\\\ \ \\\ \ \ ACAAGAAATTTTATCATCAACACGTACCGTCTTTCGCCGTACGAATATTTGACCATTACC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTCTTTAAAATAGTAGTTGTGCATGGCAGAAAGCGGCATGCTTATAAACTGGTAATGG / / ///// /// / TspEI | ||||Tsp4CI* ||| SspI ApoI | |||Csp6I ||SplI* | ||RsaI |Csp6I | |AflIII RsaI | |MaeII | BsaAI | BceAI TaiI SetI T R N F I I N T Y R L S P Y E Y L T I T Q E I L S S T R T V F R R T N I * P L P K K F Y H Q H V P S F A V R I F D H Y R ----:----|----:----|----:----|----:----|----:----|----:----| V L F K I M L V Y R R E G Y S Y K V M V C L F N * * * C T G D K A T R I N S W * C S I K D D V R V T K R R V F I Q G N G Hin4I | FatI | NcoI | StyI | SecI* MnlI | DsaI* | TfiI | MboII | HinfI | |CviAII | | Hin4I | || NlaIII | | | MluI | || | BseGI | | | AflIII | || | | TaqI | | | | FnuDII* NspBII* | || | | | FokI | | | | | MboII \ \ \\ \ \ \ \ \ \ \ \ \ \ GCTGTGAGAAGAAATGTTGCCATGGATGTTGCCTCGATAGTGAAGATTCACGCGTTCTTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CGACACTCTTCTTTACAACGGTACCTACAACGGAGCTATCACTTCTAAGTGCGCAAGAAC / / // // / / / / / /// NspBII* Hin4I || || BseGI TaqI | | | ||AflIII AciI || |DsaI* | | | ||MluI || |SecI* | | | |MboII || |StyI | | | FnuDII* || |NcoI | | HinfI || |FatI | | TfiI || CviAII | Hin4I |NlaIII FokI MboII MnlI A V R R N V A M D V A S I V K I H A F L L * E E M L P W M L P R * * R F T R S W C E K K C C H G C C L D S E D S R V L G ----:----|----:----|----:----|----:----|----:----|----:----| A T L L F T A M S T A E I T F I * A N K R Q S F F H Q W P H Q R S L S S E R T R S H S S I N G H I N G R Y H L N V R E Q BssKI SecI* EcoRII | ScrFI | BseBI | | AsuI* | | AvaII | | |BmgT120I AsuI* | | || BfiI |BmgT120I CviJI | | || | CviJI ||CviJI | MseI TspEI Hpy188I | | || | | BsrI ||HaeIII \ \ \ \ \ \ \\ \ \ \ \\\ GAAAAATGGGGCTTAATCAATTATCAGATTGACCCCAGGACCAAGCCCAGTCTTATTGGG 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTTTACCCCGAATTAGTTAATAGTCTAACTGGGGTCCTGGTTCGGGTCAGAATAACCC / / / / ///// / / | MseI | Hpy188I ||||| CviJI BmgT120I CviJI TspEI ||||| BsrI HaeIII ||||AvaII CviJI ||||AsuI* |||BmgT120I |||BfiI ||EcoRII ||BssKI |SecI* BseBI ScrFI E K W G L I N Y Q I D P R T K P S L I G K N G A * S I I R L T P G P S P V L L G K M G L N Q L S D * P Q D Q A Q S Y W A ----:----|----:----|----:----|----:----|----:----|----:----| S F H P K I L * * I S G L V L G L R I P P F I P S L * N D S Q G W S W A W D * Q F F P A * D I I L N V G P G L G T K N P AsuI* |BmgT120I ||CviJI Hpy178III* ||HaeIII | AciI MseI CviJI \\\ \ \ \ \ CCAAGTTTTACGGGCCACTTCCAAGTGGTTCTGGACACTCCGCAGGGGTTAAAGCCATTT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTCAAAATGCCCGGTGAAGGTTCACCAAGACCTGTGAGGCGTCCCCAATTTCGGTAAA / // / / / / AsuI* |AsuI* | AciI | CviJI BmgT120I Hpy178III* MseI HaeIII CviJI P S F T G H F Q V V L D T P Q G L K P F Q V L R A T S K W F W T L R R G * S H F K F Y G P L P S G S G H S A G V K A I F ----:----|----:----|----:----|----:----|----:----|----:----| G L K V P W K W T T R S V G C P N F G N A L N * P G S G L P E P C E A P T L A M W T K R A V E L H N Q V S R L P * L W K MboI AciI BclI BsrBI | DpnI Hin4II* | NlaIV Hin4II* | |BstKTI | MnlI BccI | BseRI | Hpy178III* \ \\ \ \ \ \ \ \ \ TTACCAGAGAATGTGATCAAGCAAGAAGTGGAAGGAGGAGATGGAGCGGAACCACAAGTC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AATGGTCTCTTACACTAGTTCGTTCTTCACCTTCCTCCTCTACCTCGCCTTGGTGTTCAG // / / / / / / / / || BclI | MnlI BccI | | NlaIV Hin4II* || MboI Hin4II* | BseRI |DpnI | AciI BstKTI BsrBI L P E N V I K Q E V E G G D G A E P Q V Y Q R M * S S K K W K E E M E R N H K S T R E C D Q A R S G R R R W S G T T S Q ----:----|----:----|----:----|----:----|----:----|----:----| K G S F T I L C S T S P P S P A S G C T K V L S H S * A L L P L L L H L P V V L * W L I H D L L F H F S S I S R F W L D Hpy178III* | BsgI | | AclI | | MaeII | | | SetI | | | TaiI | | | |Hpy166II | | | || MboII ApoI | | | || |TfiI CviRI* TspEI MseI BarI | | | || |HinfI | BarI \ \ \ \ \ \ \\ \\ \ \ AAGAAGGAATTTCCCGTTAATCTCACAATCAAGAAGAACGTTTACGATTCTGCACAAGAC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTCCTTAAAGGGCAATTAGAGTGTTAGTTCTTCTTGCAAATGCTAAGACGTGTTCTG / / // // / / / / / / | TspEI |BarI || | | | | | CviRI* | ApoI MseI || | | | | | BarI Hpy178III* || | | | | HinfI || | | | | TfiI || | | | MboII || | | Hpy166II || | MaeII || | AclI || TaiI || SetI |BsgI Hpy178III* K K E F P V N L T I K K N V Y D S A Q D R R N F P L I S Q S R R T F T I L H K T E G I S R * S H N Q E E R L R F C T R L ----:----|----:----|----:----|----:----|----:----|----:----| L F S N G T L R V I L F F T * S E A C S * S P I E R * D * L * S S R K R N Q V L L L F K G N I E C D L L V N V I R C L V CviRI* BssKI | EcoT22I EcoRII | | GsuI | ScrFI TfiI | | Eco57MI | BseBI HinfI Hpy166II \ \ \ \ \ \ \ TTCAATGCATTACAAGACGAAAGTAGAAACTCCAGGCAGATTCACAAAGTTTACATTTGC 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTTACGTAATGTTCTGCTTTCATCTTTGAGGTCCGTCTAAGTGTTTCAAATGTAAACG / / / / / / / | | Eco57MI | | HinfI Hpy166II | | GsuI | | TfiI | CviRI* | EcoRII EcoT22I | BssKI BseBI ScrFI F N A L Q D E S R N S R Q I H K V Y I C S M H Y K T K V E T P G R F T K F T F A Q C I T R R K * K L Q A D S Q S L H L P ----:----|----:----|----:----|----:----|----:----|----:----| K L A N C S S L L F E L C I * L T * M Q S * H M V L R F Y F S W A S E C L K C K E I C * L V F T S V G P L N V F N V N A FatI ApaLI |MwoI Cac8I |CviAII | CviRI* || AciI | Hpy166II || NspI | | SduI || NlaIII Hin6I | | BseSI || | MaeIII PleI |GlaI | | HgiAI* || | | HinfI |MlyI ||HhaI TspEI | | |BsaXI \\ \ \ \ \\ \\\ \ \ \ \\ CATACATGCGGTAACGAGTCAATCAATGTGCGCTACCACAATTTGCGTGCACGGGACACC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTATGTACGCCATTGCTCAGTTAGTTACACGCGATGGTGTTAAACGCACGTGCCCTGTGG / / // / / / / /// / / / / | | || AciI | HinfI PleI ||Hin6I | | | ApaLI | | |FatI MaeIII MlyI |GlaI | | Hpy166II | | CviAII HhaI | | CviRI* | NlaIII | | BsaXI | NspI | HgiAI* MwoI | Cac8I | BseSI | SduI TspEI H T C G N E S I N V R Y H N L R A R D T I H A V T S Q S M C A T T I C V H G T P Y M R * R V N Q C A L P Q F A C T G H Q ----:----|----:----|----:----|----:----|----:----|----:----| W V H P L S D I L T R * W L K R A R S V G Y M R Y R T L * H A S G C N A H V P C M C A T V L * D I H A V V I Q T C P V G MslI | HgiCI* SetI | |Eco57I | BslFI | |Eco57MI | | SduI MnlI | ||NlaIV TspDTI | | HgiAI* | BsaXI | ||| MboII | Hpy188I \ \ \ \ \ \ \\\ \ \ \ AACCTGTGCTCCCGTTGTTTCCAAGAGGGTCATTTCGGTGCCAACTTTCAATCTTCAGAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGACACGAGGGCAACAAAGGTTCTCCCAGTAAAGCCACGGTTGAAAGTTAGAAGTCTA / / / / / // / / / / / SetI | BslFI | BsaXI || | | MboII TspDTI Hpy188I HgiAI* MnlI || | HgiCI* SduI || NlaIV |Eco57MI |Eco57I MslI N L C S R C F Q E G H F G A N F Q S S D T C A P V V S K R V I S V P T F N L Q I P V L P L F P R G S F R C Q L S I F R F ----:----|----:----|----:----|----:----|----:----|----:----| L R H E R Q K W S P * K P A L K * D E S W G T S G N N G L P D N R H W S E I K L V Q A G T T E L L T M E T G V K L R * I BsrI |SfaNI ||Hpy188I ||| BssKI ||| EcoRII MseI ||| | ScrFI Hpy188I | TspGWI ||| | BseBI \ \ \ \\\ \ \ TTCATCAGATTAGAAAACAACGGAAACTCGGTTAAAAAAAACTGGTCAGACCAGGAGATG 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| AAGTAGTCTAATCTTTTGTTGCCTTTGAGCCAATTTTTTTTGACCAGTCTGGTCCTCTAC / // / / / / / Hpy188I |MseI | | | | EcoRII TspGWI | | | | BssKI | | | BseBI | | | ScrFI | | SfaNI | Hpy188I BsrI F I R L E N N G N S V K K N W S D Q E M S S D * K T T E T R L K K T G Q T R R C H Q I R K Q R K L G * K K L V R P G D A ----:----|----:----|----:----|----:----|----:----|----:----| K M L N S F L P F E T L F F Q D S W S I N * * I L F C R F S P * F F S T L G P S E D S * F V V S V R N F F V P * V L L H GsuI Eco57MI | BsrI TaqII | | BbvII* | MboII | | | TspRI | | MaeII MnlI | | | MboII | | |PmaCI MwoI | | | |TspDTI | | |BsaAI \ \ \ \ \\ \ \ \\ CTACTATTGCTGGAGGGTATTGAAATGTATGAAGACCAGTGGGAGAAGATTGCTGACCAC 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GATGATAACGACCTCCCATAACTTTACATACTTCTGGTCACCCTCTTCTAACGACTGGTG / / / / / / / / / | MnlI | TspRI TspDTI TaqII | | BstXI MwoI | BsrI BbvII* | | BsaAI Eco57MI MboII | | PmaCI GsuI | TaiI | SetI MboII L L L L E G I E M Y E D Q W E K I A D H Y Y C W R V L K C M K T S G R R L L T T T I A G G Y * N V * R P V G E D C * P R ----:----|----:----|----:----|----:----|----:----|----:----| S S N S S P I S I Y S S W H S F I A S W A V I A P P Y Q F T H L G T P S S Q Q G * * Q Q L T N F H I F V L P L L N S V V DdeI Bpu10I | HindIII | | AluI | | CviJI | | | SetI | | | | MnlI | | | | | MboI | | | | | | FokI SetI CviRI* | | | | | | DpnI TaiI SduI BbvII* | | | | | | |TaqI OliI BseSI | MboII | | | | | | |PvuI MslI | OliI | | ApoI | | | | | | |McrI* | BstXI | MslI | | TspEI | | | | | | |BstKTI \ \ \ \ \ \ \ \ \ \ \ \ \ \\ GTGGGTGGGCACAAGCGTGTAGAAGACTGCATTGAAAAATTCCTAAGCTTACCGATCGAG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| CACCCACCCGTGTTCGCACATCTTCTGACGTAACTTTTTAAGGATTCGAATGGCTAGCTC // / / / / / /// // // /// |MslI BseSI MslI | BbvII* | ||| || || ||FokI |OliI SduI OliI | MboII | ||| || || |TaqI MaeII CviRI* | ||| || || MboI | ||| || |DpnI | ||| || BstKTI | ||| || McrI* | ||| || PvuI | ||| |MnlI | ||| HindIII | ||CviJI | ||AluI | |Bpu10I | |DdeI | SetI TspEI ApoI V G G H K R V E D C I E K F L S L P I E W V G T S V * K T A L K N S * A Y R S R G W A Q A C R R L H * K I P K L T D R G ----:----|----:----|----:----|----:----|----:----|----:----| T P P C L R T S S Q M S F N R L K G I S R P H A C A H L L S C Q F I G L S V S R H T P V L T Y F V A N F F E * A * R D L BccI |MwoI |CviJI ||AciI ||BisI |||BlsI BseGI ||||TauI | Hpy188I ||||FnuDII* \ \ \\\\\ GACAACTACATCCGAGAAGTTGTTGGTTCAACGCTGAATGGTAAGGGTGGCGACAGCCGC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTGATGTAGGCTCTTCAACAACCAAGTTGCGACTTACCATTCCCACCGCTGTCGGCG / / / //// BseGI Hpy188I | |||FnuDII* | |||AciI | ||BisI | |BlsI | CviJI | TauI | BccI MwoI D N Y I R E V V G S T L N G K G G D S R T T T S E K L L V Q R * M V R V A T A A Q L H P R S C W F N A E W * G W R Q P R ----:----|----:----|----:----|----:----|----:----|----:----| S L * M R S T T P E V S F P L P P S L R P C S C G L L Q Q N L A S H Y P H R C G V V V D S F N N T * R Q I T L T A V A A BetI* |HpaII |BtgZI || TaqI || AsuII SfaNI || | BccI | BsmI Hpy178III* \\ \ \ \ \ \ GATGGTAGTGTGTCCGGTTCGAAGTTGATGGAATGCGTGAATGATGCTGTCCAGACGCTA 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCATCACACAGGCCAAGCTTCAACTACCTTACGCACTTACTACGACAGGTCTGCGAT /// // / / / ||| |BccI | SfaNI Hpy178III* ||| AsuII BsmI ||| TaqI ||BtgZI |BetI* HpaII D G S V S G S K L M E C V N D A V Q T L M V V C P V R S * W N A * M M L S R R Y W * C V R F E V D G M R E * C C P D A T ----:----|----:----|----:----|----:----|----:----|----:----| S P L T D P E F N I S H T F S A T W V S R H Y H T R N S T S P I R S H H Q G S A I T T H G T R L Q H F A H I I S D L R * SetI | BsmAI | Eco31I | Hpy188I | | TaqI | | |Hpy178III* | | || MboI | | || BglII | | || XhoII | | || | DpnI | | || | |BstKTI | | || | || Hpy188I HgaI Hpy99I | | || | || | TatI CviRI* | TspEI | | || | || | |Csp6I \ \ \ \ \ \\ \ \\ \ \\ CTGCAAGGCGACGACAAATTGGGTAAGGTCTCTGATAAGTCGAGAGAGATCTCCGAAAAG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GACGTTCCGCTGCTGTTTAACCCATTCCAGAGACTATTCAGCTCTCTCTAGAGGCTTTTC / / / / / / // // / / | Hpy99I | SetI | | || || | Hpy188I | HgaI TspEI | | || || XhoII CviRI* | | || || BglII | | || || MboI | | || |DpnI | | || BstKTI | | |Hpy178III* | | TaqI | Eco31I | BsmAI Hpy188I L Q G D D K L G K V S D K S R E I S E K C K A T T N W V R S L I S R E R S P K S A R R R Q I G * G L * * V E R D L R K V ----:----|----:----|----:----|----:----|----:----|----:----| S C P S S L N P L T E S L D L S I E S F V A L R R C I P Y P R Q Y T S L S R R F Q L A V V F Q T L D R I L R S L D G F L AluI CviJI | SetI | | FatI | | NcoI | | StyI | | SecI* | | DsaI* | | |CviAII CviJI | | || NlaIII RsaI | MboII | | || | TspEI \ \ \ \ \ \\ \ \ TACATTGAAGAAAGCCAAGCGATAATCCAAGAGTTAGTCAAGCTGACCATGGAGAAATTA 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| ATGTAACTTCTTTCGGTTCGCTATTAGGTTCTCAATCAGTTCGACTGGTACCTCTTTAAT /// / / / / / // / ||TatI | MboII | | | |DsaI* TspEI |Csp6I CviJI | | | |SecI* RsaI | | | |StyI | | | |NcoI | | | |FatI | | | CviAII | | NlaIII | CviJI | AluI SetI Y I E E S Q A I I Q E L V K L T M E K L T L K K A K R * S K S * S S * P W R N * H * R K P S D N P R V S Q A D H G E I R ----:----|----:----|----:----|----:----|----:----|----:----| Y M S S L W A I I W S N T L S V M S F N T C Q L F G L S L G L T L * A S W P S I V N F F A L R Y D L L * D L Q G H L F * Hpy166II | AluI | CviJI | | SetI | | | MboI | | | | DpnI | | | | |XbaI | | | | |BstKTI | | | | ||MaeI | | | | ||Hpy178III* BccI BsrI Hin4II* \ \ \ \ \\\ \ \ \ GAGAGCAAGTTTACAAAGCTGTGCGATCTAGAAACGCAACTGGAGATGGAAAAACTGAAA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTCGTTCAAATGTTTCGACACGCTAGATCTTTGCGTTGACCTCTACCTTTTTGACTTT / / / // / // / / / | | CviJI || | |XbaI | BsrI Eco57MI | | AluI || | | BccI Hin4II* | SetI || | Hpy178III* GsuI Hpy166II || | MaeI || MboI |DpnI BstKTI E S K F T K L C D L E T Q L E M E K L K R A S L Q S C A I * K R N W R W K N * N E Q V Y K A V R S R N A T G D G K T E I ----:----|----:----|----:----|----:----|----:----|----:----| S L L N V F S H S R S V C S S I S F S F L S C T * L A T R D L F A V P S P F V S L A L K C L Q A I * F R L Q L H F F Q F DdeI | TspRI | TaqII TfiI | | Hpy166II HinfI | | | TfiI |SfaNI | | | HinfI || Hpy188I McrI* | | | Hin4I GsuI || | Hin4I |BseMII | | | Hin4I Eco57MI || | Hin4I ||BspCNI | | | | Hpy178III* \ \\ \ \ \\\ \ \ \ \ \ TATGTGAAGGAATCTGAAAAGATGCTGAACGACCGATTATCACTGAGTAAACAGATTCTT 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| ATACACTTCCTTAGACTTTTCTACGACTTGCTGGCTAATAGTGACTCATTTGTCTAAGAA /// / /// / // / / / ||| Hin4I ||| TspRI || | | Hpy178III* ||| Hin4I ||BspCNI || | HinfI ||SfaNI |BseMII || | TfiI |Hpy188I McrI* || Hpy166II HinfI || Hin4I TfiI || Hin4I |DdeI TaqII Y V K E S E K M L N D R L S L S K Q I L M * R N L K R C * T T D Y H * V N R F L C E G I * K D A E R P I I T E * T D S * ----:----|----:----|----:----|----:----|----:----|----:----| Y T F S D S F I S F S R N D S L L C I R I H S P I Q F S A S R G I I V S Y V S E I H L F R F L H Q V V S * * Q T F L N K Csp6I |RsaI |BsrI ||MboII TaqI ||| MboI BseRI ||| | DpnI | GsuI ||| | |BstKTI SetI MnlI | Eco57MI ||| | || Hpy188I \ \ \ \ \\\ \ \\ \ GACCTGAACAAGTCGCTGGAGGAGTTGAATGTGTCGAAGAAACTGGTACTGATCTCGGAG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CTGGACTTGTTCAGCGACCTCCTCAACTTACACAGCTTCTTTGACCATGACTAGAGCCTC / / / // / // // / / SetI MnlI | |TaqI | || || | Hpy188I | Eco57MI | || || MboI | GsuI | || |DpnI BseRI | || BstKTI | |Csp6I | MboII | RsaI BsrI D L N K S L E E L N V S K K L V L I S E T * T S R W R S * M C R R N W Y * S R S P E Q V A G G V E C V E E T G T D L G A ----:----|----:----|----:----|----:----|----:----|----:----| S R F L D S S S N F T D F F S T S I E S Q G S C T A P P T S H T S S V P V S R P V Q V L R Q L L Q I H R L F Q Y Q D R L MnlI MlyI AsuI* PleI AvaII | AccI |BmgT120I | |Hpy166II ||BssKI | ||HinfI SpeI ||EcoRII | ||| AvaI |MaeI ||| ScrFI BtgZI | ||| |BmeT110I || Hin4II* ||| BseBI BbvII* \ \\\ \\ \\ \ \\\ \ \ CAAGTAGACTCGGGCATACAACTAGTGGAGAAGGACCAGGAGGGCGATGACGAAGACGGC 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCATCTGAGCCCGTATGTTGATCACCTCTTCCTGGTCCTCCCGCTACTGCTTCTGCCG // // / // /// / // / / / || || | |AvaI ||SpeI | || | EcoRII TstI || || | BmeT110I |MaeI | || | BssKI || || HinfI Hin4II* | || BseBI || |AccI | || ScrFI || Hpy166II | |AvaII |PleI | |AsuI* MlyI | BmgT120I MnlI Q V D S G I Q L V E K D Q E G D D E D G K * T R A Y N * W R R T R R A M T K T A S R L G H T T S G E G P G G R * R R R Q ----:----|----:----|----:----|----:----|----:----|----:----| C T S E P M C S T S F S W S P S S S S P A L L S P C V V L P S P G P P R H R L R L Y V R A Y L * H L L V L L A I V F V A MboII |TstI |CfrI MaeII || CviJI AflIII || HaeIII | SetI || | BceAI | TaiI || | | FatI | | Hin4II* BcgI || | | |CviAII | | | TstI Hin4II* || | | || NlaIII | | | | MnlI | MlyI || | | || |BceAI | | | | | MwoI | PleI \\ \ \ \\ \\ \ \ \ \ \ \ \ \ AATACGGCCACAGGACATGGCGTGAAACGTGTAGGCAAGGAAGGCGAGGAAGTAGGCGAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGCCGGTGTCCTGTACCGCACTTTGCACATCCGTTCCTTCCGCTCCTTCATCCGCTT / / / // // / / / /// / // // | | CfrI || || | | | ||| MwoI || |PleI | HaeIII || || | | | ||| MnlI || MlyI | CviJI || || | | | ||Hin4II* |Hin4II* BbvII* || || | | | |TstI BcgI BtgZI || || | | | AflIII MboII || || | | MaeII || || | TaiI || || | SetI || || BceAI || |FatI || CviAII |NlaIII BceAI N T A T G H G V K R V G K E G E E V G E I R P Q D M A * N V * A R K A R K * A K Y G H R T W R E T C R Q G R R G S R R R ----:----|----:----|----:----|----:----|----:----|----:----| L V A V P C P T F R T P L S P S S T P S C Y P W L V H R S V H L C P L R P L L R I R G C S M A H F T Y A L F A L F Y A F HinfI | BsrDI | | CviRI* | | | TspEI | | | | TseI | | | | CviRI* | | | | |BisI | | | | ||BlsI | | | | |||CviJI | | | | |||| BcgI | | | | |||| BssKI | | | | |||| SecI* | | | | |||| EcoRII | | | | |||| | ScrFI | | | | |||| | BseBI | | | | |||| | | TatI | | | | |||| | | SetI | | | | |||| | | Bsp1407I | | | | |||| | | |BbvI | | | | |||| | | |Csp6I | | | | |||| | | |Hpy166II | | | | |||| | | || SecI* | | | | |||| | | || DsaI* | | | | |||| | | ||RsaI |Tsp4CI* \ \ \ \ \\\\ \ \ \\\ \\ GGCGACTCCATTGCAAAATTGCAGCCCCAGGTGTACAAACCGTGGTCATTGTAA 1630 1640 1650 1660 1670 ----:----|----:----|----:----|----:----|----:----|---- CCGCTGAGGTAACGTTTTAACGTCGGGGTCCACATGTTTGGCACCAGTAACATT // / ///// //// ///// / / |HinfI CviRI* ||||| |||| ||||| | DsaI* BsrDI ||||| |||| ||||| | SecI* ||||| |||| ||||| Tsp4CI* ||||| |||| ||||BbvI ||||| |||| |||Bsp1407I ||||| |||| |||TatI ||||| |||| ||Csp6I ||||| |||| |RsaI ||||| |||| Hpy166II ||||| |||EcoRII ||||| |||BssKI ||||| ||SecI* ||||| |BseBI ||||| |ScrFI ||||| SetI ||||CviJI ||||BcgI ||||TseI |||BisI ||BlsI |CviRI* TspEI G D S I A K L Q P Q V Y K P W S L * A T P L Q N C S P R C T N R G H C X R L H C K I A A P G V Q T V V I V X ----:----|----:----|----:----|----:----|----:----|---- P S E M A F N C G W T Y L G H D N Y L R S W Q L I A A G P T C V T T M T A V G N C F Q L G L H V F R P * Q L # Enzymes that cut Frequency Isoschizomers AccI 2 FblI,XmiI AciI 5 BspACI,SsiI AclI 1 Psp1406I AflIII 3 AluI 4 AluBI AlwNI 1 CaiI ApaLI 1 Alw44I,VneI ApoI 3 AcsI,XapI AsuI* 5 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 3 BpiI,BpuAI,BstV2I,BbsI BccI 5 BceAI 3 BcgI 1 BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 2 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmeT110I 1 BmgT120I 5 Bpu10I 1 BsaAI 2 BstBAI,Ppu21I BsaXI 2 BseBI 6 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 1 BseRI 4 BseSI 2 BaeGI,BstSLI BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 1 BsrBI 1 AccBSI,MbiI BsrDI 1 BseMI,Bse3DI BsrI 6 BseNI,Bse1I,BsrSI BssKI 7 BstSCI,StyD4I BstKTI 8 BstXI 1 BtgZI 2 Cac8I 1 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I CfrI 1 AcoI,EaeI Csp6I 5 CviQI,RsaNI CviAII 4 CviJI 15 CviKI-1 CviRI* 7 HpyCH4V DdeI 4 BstDEI,HpyF3I DpnI 8 MalI DraII 1 EcoO109I DraIII 1 AdeI DsaI* 3 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 1 AcuI Eco57MI 6 EcoRII 6 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 4 FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 GlaI 1 GsuI 5 BpmI HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 8 HpyAV Hin6I 1 HinP1I,HspAI HindIII 1 HinfI 11 HpaII 2 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 9 Hpy99I 2 MaeI 2 FspBI,BfaI,XspI MaeII 4 HpyCH4IV MaeIII 1 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 11 McrI* 3 BsiEI,BstMCI,Bsh1285I MluI 1 MlyI 4 SchI MnlI 13 MseI 4 Tru1I,Tru9I MslI 3 RseI,SmiMI MwoI 5 HpyF10VI,BstMWI NcoI 2 Bsp19I NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 4 BspLI,BmiI,PspN4I NspBII* 1 MspA1I NspI 1 BstNSI,XceI OliI 2 AleI PleI 4 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PvuI 1 MvrI,Ple19I,BpvUI RsaI 5 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 7 BmrFI,MspR9I,Bme1390I SduI 3 MhlI,Bsp1286I SecI* 6 BseDI,BssECI,BsaJI SetI 14 SfaNI 3 LweI SpeI 1 BcuI,AhlI SplI* 1 Pfl23II,PspLI,BsiWI SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 4 TaqI 7 TaqII 4 TatI 2 TauI 1 TfiI 7 PfeI TseI 1 ApeKI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 9 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 3 TscAI TstI 1 XbaI 1 XhoII 3 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AcyI AflII AgeI AhaIII* AjuI AlfI AloI ApaI AscI Asp718I AvrII BaeI BalI BamHI BbvCI Bce83I* BciVI BdaI BglI BmtI BplI BsaBI BsePI BseYI BsiYI* Bsp120I BspHI BspLU11I* BspMI BspMII* BspOI BssNAI Bst1107I BstAPI BstEII BstZ17I BtrI BtsI Cfr10I Cfr9I ClaI CspCI DinI DrdI Eam1105I EciI Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRI EcoRV EgeI EheI Esp3I EspI* FalI FauI FseI FspAI GsaI HaeII HgiJII* HindII HpaI KasI KpnI Ksp632I* MauBI MfeI MmeI MroNI MstI* NaeI NarI NdeI NgoMIV NheI NmeAIII NotI NruI PacI PasI PflMI PfoI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuII RsrII SacI SacII SalI SanDI SapI ScaI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SrfI Sse232I* Sse8387I StuI SwaI TsoI Tsp45I TspMI Tth111I VspI XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769