Restriction Map of ECO1/YFR027W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

ECO1/YFR027W on chromosome VI from coordinates 207452 to 208297.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.28545

AluI CviJI |MaeI TspDTI AciI ||SetI | FauI | Cac8I Hpy166II BsrI TspEI \\\ \ \ \ \ \ \ \ ATGAAAGCTAGGAAATCGCAGAGAAAAGCGGGCAGTAAACCAAATCTTATCCAGTCTAAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTTCGATCCTTTAGCGTCTCTTTTCGCCCGTCATTTGGTTTAGAATAGGTCAGATTT / / / / / / / / | | | TspDTI FauI Cac8I Hpy166II BsrI | | MaeI AciI | CviJI | AluI SetI M K A R K S Q R K A G S K P N L I Q S K * K L G N R R E K R A V N Q I L S S L N E S * E I A E K S G Q * T K S Y P V * I ----:----|----:----|----:----|----:----|----:----|----:----| X F A L F D C L F A P L L G F R I W D L X S L * S I A S F L P C Y V L D * G T * H F S P F R L S F R A T F W I K D L R F CviRI* TaqI | MseI AsuII TaqI \ \ \ \ TTGCAAGTTAATAATGGTTCGAAATCGAATAAAATAGTCAAGTGTGATAAATGTGAGATG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTTCAATTATTACCAAGCTTTAGCTTATTTTATCAGTTCACACTATTTACACTCTAC // / / / |CviRI* MseI AsuII TaqI TspEI TaqI L Q V N N G S K S N K I V K C D K C E M C K L I M V R N R I K * S S V I N V R C A S * * W F E I E * N S Q V * * M * D V ----:----|----:----|----:----|----:----|----:----|----:----| N C T L L P E F D F L I T L H S L H S I I A L * Y H N S I S Y F L * T H Y I H S Q L N I I T R F R I F Y D L T I F T L H MboI | DpnI | |BstKTI | || Hin6I | || FnuDII* | || |GlaI | || ||HhaI TseI | || |||BseGI AluI | || |||| MboII CviJI MnlI | || |||| | BsiI* PvuII TaqI |FokI | || |||| | | BccI BbvI NspBII* \ \\ \ \\ \\\\ \ \ \ \ \ TCATATTCCTCGACATCAATAGAAGATCGCGCCATCCACGAGAAATACCACACTTTACAG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGTATAAGGAGCTGTAGTTATCTTCTAGCGCGGTAGGTGCTCTTTATGGTGTGAAATGTC / / / // //// / / / / / TaqI MnlI | || |||| MboII BsiI* BbvI | NspBII* | || |||Hin6I BccI | PvuII | || ||BseGI | CviJI | || ||GlaI | AluI | || |FnuDII* SetI | || |HhaI | || MboI | |DpnI | BstKTI FokI S Y S S T S I E D R A I H E K Y H T L Q H I P R H Q * K I A P S T R N T T L Y S I F L D I N R R S R H P R E I P H F T A ----:----|----:----|----:----|----:----|----:----|----:----| D Y E E V D I S S R A M W S F Y W V K C T M N R S M L L L D R W G R S I G C K V * I G R C * Y F I A G D V L F V V S * L BisI |BlsI |SetI ||FatI ||CviRI* |||CviAII |||| NlaIII |||| | MaeII AccI XmnI |||| | | SetI TspEI |BssNAI Hin4I |||| | | TaiI | BsiYI* SfeI* |Hpy166II Hin4I \\\\ \ \ \ \ \ \ \\ \ CTGCATGGACGTAAATGGTCGCCGAATTGGGGTTCTATAGTATACACAGAGCGAAACCAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GACGTACCTGCATTTACCAGCGGCTTAACCCCAAGATATCATATGTGTCTCGCTTTGGTA /// /// / / / / // / / ||| ||| MaeII | TspEI | |AccI | XmnI ||| ||TaiI BsiYI* | Hpy166II Hin4I ||| ||SetI | BssNAI Hin4I ||| |FatI SfeI* ||| CviAII ||CviRI* ||NlaIII ||TseI |BisI BlsI L H G R K W S P N W G S I V Y T E R N H C M D V N G R R I G V L * Y T Q S E T I A W T * M V A E L G F Y S I H R A K P F ----:----|----:----|----:----|----:----|----:----|----:----| S C P R L H D G F Q P E I T Y V S R F W A A H V Y I T A S N P N * L I C L A F G Q M S T F P R R I P T R Y Y V C L S V M Hpy178III* |SfaNI ||MboI ||| DpnI ||| |TaqI ||| |BstKTI BseRI Tsp4CI* ||| || Hin4I | BslFI | CviRI* ||| || Hin4I | | HphI SetI \ \ \\\ \\ \ \ \ \ \ TCAAGGACGGTGCATCTATCAAGATCGACAGGGACAATAACGCCATTGAACTCCTCACCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTCCTGCCACGTAGATAGTTCTAGCTGTCCCTGTTATTGCGGTAACTTGAGGAGTGGA / / ////// / / / / | CviRI* |||||TaqI BseRI | BslFI SetI Tsp4CI* ||||MboI HphI |||SfaNI ||Hin4I ||Hin4I ||DpnI |BstKTI Hpy178III* S R T V H L S R S T G T I T P L N S S P Q G R C I Y Q D R Q G Q * R H * T P H L K D G A S I K I D R D N N A I E L L T F ----:----|----:----|----:----|----:----|----:----|----:----| E L V T C R D L D V P V I V G N F E E G N L S P A D I L I S L S L L A M S S R V * P R H M * * S R C P C Y R W Q V G * R MnlI BsmAI | Hpy178III* Eco31I MnlI | | BsiYI* |BseRI | TspGWI | | | BccI || MboII \ \ \ \ \ \ \\ \ TTGAAAAAAAGTAGTCCGTCTATTACCCATCAGGAGGAGAAGATTGTATATGTGAGACCA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| AACTTTTTTTCATCAGGCAGATAATGGGTAGTCCTCCTCTTCTAACATATACACTCTGGT // / / / / / / / |TspGWI | | | BccI | | Eco31I MnlI | | Hpy178III* | | BsmAI | BsiYI* | MboII MnlI BseRI L K K S S P S I T H Q E E K I V Y V R P * K K V V R L L P I R R R R L Y M * D Q E K K * S V Y Y P S G G E D C I C E T R ----:----|----:----|----:----|----:----|----:----|----:----| K F F L L G D I V W * S S F I T Y T L G K S F F Y D T * * G D P P S S Q I H S V Q F F T T R R N G M L L L L N Y I H S W Hpy188I | HphI | CviJI SpeI | |FatI |BcgI | ||CviAII |MaeI AluI TaqI | ||| NlaIII |TspGWI CviJI \ \ \\\ \ \\ \ GATAAGTCGAATGGTGAAGTCCGAGCCATGACGGAGATAATGACACTAGTGAATAACGAG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTCAGCTTACCACTTCAGGCTCGGTACTGCCTCTATTACTGTGATCACTTATTGCTC / / /// // / // / / TaqI | ||| |FatI | |SpeI | CviJI | ||| CviAII | MaeI | AluI | ||NlaIII TspGWI SetI | |CviJI BcgI | HphI Hpy188I D K S N G E V R A M T E I M T L V N N E I S R M V K S E P * R R * * H * * I T S * V E W * S P S H D G D N D T S E * R A ----:----|----:----|----:----|----:----|----:----|----:----| S L D F P S T R A M V S I I V S T F L S L Y T S H H L G L W S P S L S V L S Y R I L R I T F D S G H R L Y H C * H I V L SetI | MwoI | |Hin6I | ||GlaI Tsp4CI* | |||HhaI |Csp6I | |||BsmI BcgI ||RsaI MboII \ \\\\ \ \\\ \ CTGAATGCGCCACACGATGAGAATGTCATTTGGAACAGTACCACAGAAGAAAAAGGCAAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GACTTACGCGGTGTGCTACTCTTACAGTAAACCTTGTCATGGTGTCTTCTTTTTCCGTTT / /// / / // / | ||Hin6I BcgI | |Csp6I MboII | |GlaI | RsaI | BsmI Tsp4CI* | HhaI MwoI L N A P H D E N V I W N S T T E E K G K * M R H T M R M S F G T V P Q K K K A K E C A T R * E C H L E Q Y H R R K R Q S ----:----|----:----|----:----|----:----|----:----|----:----| S F A G C S S F T M Q F L V V S S F P L A S H A V R H S H * K S C Y W L L F L C Q I R W V I L I D N P V T G C F F F A F AciI AccI DrdI |BssNAI | McrI* |Hpy166II | | Hpy188I SetI || MmeI | | | TspEI | BsiYI* \\ \ \ \ \ \ \ \ GCGTTTGTATACATAAGAAATGACAGGGCGGTCGGAATAATAATTATAGAGAACCTTTAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGCAAACATATGTATTCTTTACTGTCCCGCCAGCCTTATTATTAATATCTCTTGGAAATA // / / / / / / |AccI | | Hpy188I TspEI SetI BsiYI* |MmeI | McrI* Hpy166II | AciI BssNAI DrdI A F V Y I R N D R A V G I I I I E N L Y R L Y T * E M T G R S E * * L * R T F M V C I H K K * Q G G R N N N Y R E P L W ----:----|----:----|----:----|----:----|----:----|----:----| A N T Y M L F S L A T P I I I I S F R * L T Q I C L F H C P P R F L L * L S G K R K Y V Y S I V P R D S Y Y N Y L V K I BseGI | TfiI Hpy166II | HinfI | BccI | | FokI | MaeII | | |XbaI BsrDI | | SetI | | ||MaeI |MmeI MaeI | | TaiI | | ||Hpy178III* \\ \ \ \ \ \ \ \\\ GGGGGCAATGGTAAAACATCTAGTCGTGGACGTTGGATGGTTTATGATTCTAGAAGATTG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCCCCGTTACCATTTTGTAGATCAGCACCTGCAACCTACCAAATACTAAGATCTTCTAAC // / // // / / // |MmeI MaeI || |MaeII BseGI | |XbaI BsrDI || BccI | Hpy178III* |TaiI | FokI |SetI | MaeI Hpy166II HinfI TfiI G G N G K T S S R G R W M V Y D S R R L G A M V K H L V V D V G W F M I L E D W G Q W * N I * S W T L D G L * F * K I G ----:----|----:----|----:----|----:----|----:----|----:----| P P L P L V D L R P R Q I T * S E L L N H P C H Y F M * D H V N S P K H N * F I P A I T F C R T T S T P H N I I R S S Q TaqII |TaqI Csp6I Csp6I ||Hpy178III* |RsaI Hpy166II ||| ApoI || MboII |RsaI MseI ||| TspEI CviRI* \\ \ \\ \ \\\ \ \ GTACAGAATGTGTACCCCGATTTTAAGATTGGCATATCGAGAATTTGGGTGTGCAGGACA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CATGTCTTACACATGGGGCTAAAATTCTAACCGTATAGCTCTTAAACCCACACGTCCTGT /// /// / / // / / ||MboII ||Csp6I MseI | || TspEI CviRI* |Csp6I |RsaI | || ApoI RsaI Hpy166II | |Hpy178III* | TaqI TaqII V Q N V Y P D F K I G I S R I W V C R T Y R M C T P I L R L A Y R E F G C A G Q T E C V P R F * D W H I E N L G V Q D S ----:----|----:----|----:----|----:----|----:----|----:----| T C F T Y G S K L I P M D L I Q T H L V P V S H T G R N * S Q C I S F K P T C S Y L I H V G I K L N A Y R S N P H A P C MaeII | SetI | TaiI BsgI TspEI | | CviRI* SspI Hpy166II \ \ \ \ \ \ \ GCAAGGAAGTTGGGTATCGCAACCAAATTGATTGACGTTGCAAGAGAAAATATTGTTTAC 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTCCTTCAACCCATAGCGTTGGTTTAACTAACTGCAACGTTCTCTTTTATAACAAATG / / / / / / / / BsgI | | | CviRI* SspI | Tsp4CI* | | MaeII Hpy166II | TaiI | SetI TspEI A R K L G I A T K L I D V A R E N I V Y Q G S W V S Q P N * L T L Q E K I L F T K E V G Y R N Q I D * R C K R K Y C L R ----:----|----:----|----:----|----:----|----:----|----:----| A L F N P I A V L N I S T A L S F I T * L L S T P Y R L W I S Q R Q L L F Y Q K C P L Q T D C G F Q N V N C S F I N N V StyI HphI AvrII SecI* |MaeI || Acc65I || HgiCI* || |Csp6I || ||RsaI || ||SetI || ||NlaIV || |||BssKI || |||SexAI || |||EcoRII || ||||KpnI || |||||ScrFI || |||||BseBI || |||||| SetI || |||||| | FatI AciI Tsp4CI* || |||||| | |CviAII NspBII* | XmnI || |||||| | || NlaIII | TsoI \ \ \\ \\\\\\ \ \\ \ \ \ GGTGAAGTTATTCCTAGGTACCAGGTAGCATGGTCGCAACCCACAGACAGCGGTGGAAAA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CCACTTCAATAAGGATCCATGGTCCATCGTACCAGCGTTGGGTGTCTGTCGCCACCTTTT / / /// ///// / / // / / | | ||| ||||| | | |FatI | AciI | | ||| ||||| | | CviAII NspBII* | | ||| ||||| | NlaIII TsoI | | ||| ||||| EcoRII | | ||| ||||| SexAI | | ||| ||||| BssKI | | ||| ||||BseBI | | ||| ||||ScrFI | | ||| |||SetI | | ||| ||HgiCI* | | ||| ||Acc65I | | ||| |Csp6I | | ||| NlaIV | | ||| RsaI | | ||SecI* | | ||AvrII | | ||StyI | | ||KpnI | | |MaeI | | SetI | HphI XmnI G E V I P R Y Q V A W S Q P T D S G G K V K L F L G T R * H G R N P Q T A V E N * S Y S * V P G S M V A T H R Q R W K T ----:----|----:----|----:----|----:----|----:----|----:----| P S T I G L Y W T A H D C G V S L P P F R H L * E * T G P L M T A V W L C R H F T F N N R P V L Y C P R L G C V A T S F NheI CviJI Cfr10I |MaeI |HpaII |BsrI CviRI* || AccI ||Cac8I | EcoT22I || |BssNAI ||| BmtI | | BceAI MaeIII || |Hpy166II \\\ \ \ \ \ \ \\ \\ CTGGCTAGCAAATACAACGGCATTATGCATAAATCAGGCAAGTTACTATTGCCGGTATAC 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GACCGATCGTTTATGTTGCCGTAATACGTATTTAGTCCGTTCAATGATAACGGCCATATG // /// / / / / // // || ||NheI | CviRI* BceAI MaeIII || |AccI || |MaeI EcoT22I || Hpy166II || Cac8I || BssNAI |CviJI |Cfr10I |BmtI HpaII BsrI L A S K Y N G I M H K S G K L L L P V Y W L A N T T A L C I N Q A S Y Y C R Y T G * Q I Q R H Y A * I R Q V T I A G I H ----:----|----:----|----:----|----:----|----:----|----:----| S A L L Y L P M I C L D P L N S N G T Y V P * C I C R C * A Y I L C T V I A P I Q S A F V V A N H M F * A L * * Q R Y V NdeI \ ATATGA ----:- TATACT / NdeI I * Y X M X ----:- M H C I Y S # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 3 FblI,XmiI AciI 3 BspACI,SsiI AluI 3 AluBI ApoI 1 AcsI,XapI AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvrII 1 AspA2I,BlnI,XmaJI BbvI 1 BseXI,BstV1I,Lsp1109I BccI 3 BceAI 1 BcgI 1 BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmtI 1 BspOI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 2 BstF5I,BtsCI BseRI 2 BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 3 Bst1107I,BstZ17I BstKTI 2 Cac8I 2 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 4 CviQI,RsaNI CviAII 3 CviJI 5 CviKI-1 CviRI* 6 HpyCH4V DpnI 2 MalI DrdI 1 AasI,DseDI Eco31I 1 Bso31I,BspTNI,BsaI EcoRII 1 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 3 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 2 GlaI 2 HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4I 2 Hin6I 2 HinP1I,HspAI HinfI 1 HpaII 1 HapII,BsiSI,MspI HphI 3 AsuHPI Hpy166II 7 Hpy8I Hpy178III* 4 Hpy188III Hpy188I 2 KpnI 1 MaeI 6 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 1 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 4 McrI* 1 BsiEI,BstMCI,Bsh1285I MmeI 2 MnlI 3 MseI 2 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NdeI 1 FauNDI NheI 1 AsuNHI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NspBII* 2 MspA1I PvuII 1 RsaI 4 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SecI* 1 BseDI,BssECI,BsaJI SetI 10 SexAI 1 MabI SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SpeI 1 BcuI,AhlI SspI 1 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 3 TaqI 6 TaqII 1 TfiI 1 PfeI TseI 1 ApeKI TsoI 1 Tsp4CI* 3 HpyCH4III,TaaI,Bst4CI TspDTI 1 TspEI 5 TasI,Tsp509I,Sse9I TspGWI 2 XbaI 1 XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI AsuI* AvaI AvaII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BciVI BclI BdaI BetI* BfiI BglI BglII BinI* BmeT110I BmgT120I BplI Bpu10I BsaAI BsaBI BsaXI BseMII BsePI BseSI BseYI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BsrBI BstAPI BstEII BstXI BtgZI BtrI BtsI CauII* Cfr9I CfrI ClaI CspCI DdeI DinI DraII DraIII DsaI* Eam1105I EciI Ecl136II Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRV EgeI EheI Esp3I EspI* FalI FseI FspAI GsaI GsuI HaeII HaeIII HgaI HgiAI* HgiJII* Hin4II* HindII HindIII HpaI Hpy99I KasI Ksp632I* MauBI MfeI MluI MlyI MroNI MslI MstI* NaeI NarI NcoI NgoMIV NmeAIII NotI NruI NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SduI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TatI TauI Tsp45I TspMI TspRI TstI Tth111I VspI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769