Restriction Map of DDI2/YFL061W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

DDI2/YFL061W on chromosome VI from coordinates 9545 to 10222.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.6210

CviJI MaeIII HaeIII Tsp45I | BsrI | Tsp4CI* TspGWI | MslI | |Csp6I |MnlI | | BstXI | ||RsaI || MaeI SetI | | | TspRI \ \\\ \\ \ \ \ \ \ \ ATGTCACAGTACGGATTTGTAAGAGTTCCTAGAGAGGTAGAAAAGGCCATTCCAGTGGTG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGTGTCATGCCTAAACATTCTCAAGGATCTCTCCATCTTTTCCGGTAAGGTCACCAC / // / / / / / / / | |Csp6I | MnlI | SetI | | MslI | RsaI TspGWI MaeI | BstXI Tsp4CI* | TspRI Tsp45I | BsrI MaeIII HaeIII CviJI M S Q Y G F V R V P R E V E K A I P V V C H S T D L * E F L E R * K R P F Q W * V T V R I C K S S * R G R K G H S S G E ----:----|----:----|----:----|----:----|----:----|----:----| X D C Y P N T L T G L S T S F A M G T T X T V T R I Q L L E * L P L F P W E L P H * L V S K Y S N R S L Y F L G N W H H BceAI CviRI* | BsmI | | MaeI | | |SetI | | |HphI | | || SecI* | | || DsaI* | | || | EciI Tsp4CI* | | || | AsuI* |MnlI | | || | |BmgT120I || TspRI | | || | ||CviJI || | MaeI | | || | ||HaeIII AciI || | | CviJI \ \ \\ \ \\\ \ \\ \ \ \ AATGCACCTAGACCACGGGCCGTTGTTCCGCCTCCAAACAGTGAAACTGCTAGGCTTGTT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTACGTGGATCTGGTGCCCGGCAACAAGGCGGAGGTTTGTCACTTTGACGATCCGAACAA /// / / / / // / / // / / ||| | MaeI | | |AsuI* AciI | |MnlI | CviJI ||| HphI | | BmgT120I | Tsp4CI* MaeI ||BceAI | | HaeIII TspRI |SetI | | CviJI CviRI* | DsaI* BsmI | SecI* EciI N A P R P R A V V P P P N S E T A R L V M H L D H G P L F R L Q T V K L L G L F C T * T T G R C S A S K Q * N C * A C S ----:----|----:----|----:----|----:----|----:----|----:----| F A G L G R A T T G G G F L S V A L S T S H V * V V P R Q E A E L C H F Q * A Q I C R S W P G N N R R W V T F S S P K N Hpy178III* | AciI | BisI | |BlsI | ||TauI TspEI \ \\\ \ CGGGAATATGCCGCTAAAGAATTGACTGCCCCCGTTCTAAACCACTCTTTGCGTGTTTTT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GCCCTTATACGGCGATTTCTTAACTGACGGGGGCAAGATTTGGTGAGAAACGCACAAAAA / //// / | |||AciI TspEI | ||BisI | |BlsI | TauI Hpy178III* R E Y A A K E L T A P V L N H S L R V F G N M P L K N * L P P F * T T L C V F F G I C R * R I D C P R S K P L F A C F S ----:----|----:----|----:----|----:----|----:----|----:----| R S Y A A L S N V A G T R F W E K R T K E P I H R * L I S Q G R E L G S K A H K P F I G S F F Q S G G N * V V R Q T N K MboI | DpnI AluI | |BstKTI CviJI | ||Hpy178III* | SetI FatI | ||| BslFI | | BsmAI |CviAII | ||| |BinI* | | Eco31I TspEI || NlaIII | ||| || HphI \ \ \ \ \\ \ \ \\\ \\ \ CAATATAGTGTAGCTATCATAAGAGACCAATTTCCAGCATGGGACTTGGATCAGGAAGTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GTTATATCACATCGATAGTATTCTCTGGTTAAAGGTCGTACCCTGAACCTAGTCCTTCAA / / / / / // // / / / / | CviJI Eco31I | | |FatI || | | | BslFI | AluI BsmAI | | CviAII || | | | HphI SetI | NlaIII || | | BinI* TspEI || | Hpy178III* || MboI |DpnI BstKTI Q Y S V A I I R D Q F P A W D L D Q E V N I V * L S * E T N F Q H G T W I R K F I * C S Y H K R P I S S M G L G S G S F ----:----|----:----|----:----|----:----|----:----|----:----| * Y L T A I M L S W N G A H S K S * S T E I Y H L * * L L G I E L M P S P D P L L I T Y S D Y S V L K W C P V Q I L F N Csp6I |RsaI AarI ||MaeII BspMI |||MaeIII | FatI |||Tsp45I | BspHI |||| SetI | |CviAII |||| TaiI | |Hpy178III* |||| | TspDTI | || NlaIII |||| | | SetI | || | CviRI* CviJI \\\\ \ \ \ \ \\ \ \ \ TTGTACGTCACCTGCTTACTTCATGATATTGCAACAACAGATAAGAATATGAGAGCCACG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AACATGCAGTGGACGAATGAAGTACTATAACGTTGTTGTCTATTCTTATACTCTCGGTGC // /// / / /// / / || ||| Tsp45I | ||BspHI CviRI* CviJI || ||| MaeIII | ||FatI || ||SetI | |Hpy178III* || |TspDTI | |CviAII || MaeII | BspMI |Csp6I | AarI RsaI NlaIII TaiI SetI L Y V T C L L H D I A T T D K N M R A T C T S P A Y F M I L Q Q Q I R I * E P R V R H L L T S * Y C N N R * E Y E S H E ----:----|----:----|----:----|----:----|----:----|----:----| K Y T V Q K S * S I A V V S L F I L A V K T R * R S V E H Y Q L L L Y S Y S L W Q V D G A * K M I N C C C I L I H S G R AluI CviJI MslI MboII | SetI MseI \ \ \ \ \ AAGATGTCATTTGAGTATTATGGTGGCATACTTTCAAGGGAGCTTGTATTTAATGCGACA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTACAGTAAACTCATAATACCACCGTATGAAAGTTCCCTCGAACATAAATTACGCTGT / / / / / / MslI MboII | CviJI MseI SetI | AluI SetI K M S F E Y Y G G I L S R E L V F N A T R C H L S I M V A Y F Q G S L Y L M R Q D V I * V L W W H T F K G A C I * C D R ----:----|----:----|----:----|----:----|----:----|----:----| F I D N S Y * P P M S E L S S T N L A V S S T M Q T N H H C V K L P A Q I * H S L H * K L I I T A Y K * P L K Y K I R C Hpy178III* | CviRI* | | BseMII BccI | | |BspCNI MaeIII | | ||CviRI* Tsp45I | | ||| MnlI | BssKI | | ||| MaeIII CviJI | EcoRII | | ||| | AlwNI HaeIII | | ScrFI XcmI SetI | SfaNI | ||| | |DdeI | HphI | | BseBI |TsoI \ \ \ \ \\\ \ \\ \ \ \ \ \ \\ GGTGGAAATCAGGACTATGCAGATGCAGTAACTGAGGCCATCATTCGTCACCAGGATTTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCACCTTTAGTCCTGATACGTCTACGTCATTGACTCCGGTAGTAAGCAGTGGTCCTAAAC / / / // // / / / / / / / / / / | | | || || | | | | HphI | | | | XcmI | | | || || | | | HaeIII | | | | TsoI | | | || || | | | CviJI | | | EcoRII | | | || || | | DdeI | | | BssKI | | | || || | MaeIII | | BseBI | | | || || AlwNI | | ScrFI | | | || |MnlI | Tsp45I | | | || CviRI* | MaeIII | | | |BspCNI BccI | | | BseMII | | CviRI* | SfaNI Hpy178III* G G N Q D Y A D A V T E A I I R H Q D L V E I R T M Q M Q * L R P S F V T R I * W K S G L C R C S N * G H H S S P G F D ----:----|----:----|----:----|----:----|----:----|----:----| P P F * S * A S A T V S A M M R * W S K L H F D P S H L H L L Q P W * E D G P N T S I L V I C I C Y S L G D N T V L I Q BslFI | StyI | SecI* | | SetI | | |BsiYI* | | || CviJI | | || | SduI | | || | HgiJII* | | || | | MwoI | | || | | |SfeI* BfiI | | || | | || CviRI* CviJI | | || | | || | PstI BsrI |BsrI | | || | | || | | MmeI \ \\ \ \ \\ \ \ \\ \ \ \ ACTGGGACTGGCTACATTACCACCTTGGGGCTCATTCTGCAGATTGCTACTACGCTTGAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGACCCTGACCGATGTAATGGTGGAACCCCGAGTAAGACGTCTAACGATGATGCGAACTG / // /// // / / / / / / BsrI |CviJI ||| || | | | | | MmeI BfiI ||| || | | | | SfeI* BsrI ||| || | | | CviRI* ||| || | | PstI ||| || | MwoI ||| || CviJI ||| |HgiJII* ||| |SduI ||| SecI* ||| StyI ||BsiYI* |BslFI SetI T G T G Y I T T L G L I L Q I A T T L D L G L A T L P P W G S F C R L L L R L T W D W L H Y H L G A H S A D C Y Y A * Q ----:----|----:----|----:----|----:----|----:----|----:----| V P V P * M V V K P S M R C I A V V S S S Q S Q S C * W R P A * E A S Q * * A Q S P S A V N G G Q P E N Q L N S S R K V Tth111I |BinI* || MboI || BamHI || XhoII || Hpy188I || | DpnI || | NlaIV || | |BstKTI || | || BinI* || | || |TspDTI || | || || MboI || | || || | DpnI || | || || | |BstKTI || | || || | || Hpy188I || | || || | || |TfiI || | || || | || |HinfI || | || || | || || BsaBI || | || || | || || | TaqI BsgI || | || || | || || | ClaI Tsp4CI* MseI | TspEI \\ \ \\ \\ \ \\ \\ \ \ \ \ \ \ AATGTCGGATCCAATACCGATCTGATTCATATCGATACAGTTAGTGCCATTAACGAGCAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TTACAGCCTAGGTTATGGCTAGACTAAGTATAGCTATGTCAATCACGGTAATTGCTCGTT // / // / / / // / // / / // || | || | | | || | |BsaBI | Tsp4CI* |BsgI || | || | | | || | HinfI ClaI MseI || | || | | | || | TfiI TaqI || | || | | | || Hpy188I || | || | | | || MboI || | || | | | |DpnI || | || | | | BstKTI || | || | | BinI* || | || | TspDTI || | || XhoII || | || BamHI || | || MboI || | |NlaIV || | |DpnI || | BstKTI || Hpy188I |BinI* Tth111I N V G S N T D L I H I D T V S A I N E Q M S D P I P I * F I S I Q L V P L T S N C R I Q Y R S D S Y R Y S * C H * R A I ----:----|----:----|----:----|----:----|----:----|----:----| L T P D L V S R I * I S V T L A M L S C C H R I W Y R D S E Y R Y L * H W * R A I D S G I G I Q N M D I C N T G N V L L TspRI | AvaI BsrI | XhoI TspRI | SmlI | FatI | |TaqI XcmI | |CviAII Tsp4CI* | |BmeT110I TsoI |CviRI* | || NlaIII | Hpy166II | ||Hpy178III* \ \\ \ \\ \ \ \ \ \\\ TTTCCAAGACTGCACTGGTTATCATGTTTTGCTACGGTGGTGGACACTGAAAACTCGAGA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AAAGGTTCTGACGTGACCAATAGTACAAAACGATGCCACCACCTGTGACTTTTGAGCTCT / / / / / / // / / // | TsoI | | BsrI | |FatI | Hpy166II |Hpy178III* TspEI | CviRI* | CviAII | TspRI |SmlI TspRI NlaIII Tsp4CI* |XhoI XcmI |AvaI BmeT110I TaqI F P R L H W L S C F A T V V D T E N S R F Q D C T G Y H V L L R W W T L K T R E S K T A L V I M F C Y G G G H * K L E K ----:----|----:----|----:----|----:----|----:----|----:----| N G L S C Q N D H K A V T T S V S F E L I E L V A S T I M N Q * P P P C Q F S S K W S Q V P * * T K S R H H V S F V R S SecI* DsaI* |Tsp4CI* || AsuI* || |NlaIV || |BmgT120I || ||CviJI || ||HaeIII || ||| TaqII NdeI || ||| |BsrI BstXI HphI | CviRI* \\ \\\ \\ \ \ \ \ AAACCGTGGGGCCACACCAGTTCTTTGGGTGATGATTTTTCAAAGAAAGTCATATGCAAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGCACCCCGGTGTGGTCAAGAAACCCACTACTAAAAAGTTTCTTTCAGTATACGTTA / / /// // / / / / | | ||| |BsrI BstXI HphI | CviRI* | | ||| TaqII NdeI | | ||AsuI* | | |BmgT120I | | |HaeIII | | |CviJI | | NlaIV | DsaI* | SecI* Tsp4CI* K P W G H T S S L G D D F S K K V I C N N R G A T P V L W V M I F Q R K S Y A I T V G P H Q F F G * * F F K E S H M Q Y ----:----|----:----|----:----|----:----|----:----|----:----| F G H P W V L E K P S S K E F F T M H L F V T P G C W N K P H H N K L S L * I C F R P A V G T R Q T I I K * L F D Y A I ACATTTGGGTATAACTAA 670 ----:----|----:--- TGTAAACCCATATTGATT T F G Y N * H L G I T X I W V * L X ----:----|----:--- V N P Y L * Y M Q T Y S C K P I V L # Enzymes that cut Frequency Isoschizomers AarI 1 AciI 2 BspACI,SsiI AluI 2 AluBI AlwNI 1 CaiI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I BamHI 1 BccI 1 BceAI 1 BfiI 1 BmrI,BmuI BinI* 3 AlwI,BspPI,AclWI BisI 1 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 1 BmeT110I 1 BmgT120I 2 BsaBI 1 Bse8I,BseJI BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseMII 1 BsgI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrI 5 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 3 BstXI 2 ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 2 CviQI,RsaNI CviAII 3 CviJI 10 CviKI-1 CviRI* 7 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 3 MalI DsaI* 2 BtgI,BstDSI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI EcoRII 1 AjnI,Psp6I,PspGI FatI 3 HaeIII 4 BsnI,BsuRI,BshFI,PhoI HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HinfI 1 HphI 4 AsuHPI Hpy166II 1 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 2 MaeI 3 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 4 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 1 MmeI 1 MnlI 3 MseI 2 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 3 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I PstI 1 RsaI 2 AfaI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 8 SfaNI 1 LweI SfeI* 1 BstSFI,SfcI,BfmI SmlI 1 SmoI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 2 TaqII 1 TauI 1 TfiI 1 PfeI TsoI 2 Tsp45I 3 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 2 TspEI 3 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 4 TscAI Tth111I 1 PflFI,PsyI,AspI XcmI 2 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI ApoI AscI Asp718I AsuII AvaII AvrII BaeI BalI BarI BbvCI BbvI BbvII* Bce83I* BcgI BciVI BclI BdaI BetI* BglI BglII BmtI BplI Bpu10I BsaAI BsaXI BseGI BsePI BseRI BseSI BseYI BsiI* Bsp120I Bsp1407I BspLU11I* BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstF5I BstZ17I BtgZI BtrI BtsCI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI CspCI DinI DraII DraIII DrdI Eam1105I Ecl136II Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI FnuDII* FokI FseI FspAI GlaI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HhaI Hin4I Hin4II* Hin6I HindII HindIII HinP1I HpaI HpaII Hpy99I HspAI KasI KpnI Ksp632I* MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MstI* NaeI NarI NcoI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TatI TseI TspMI TstI VspI XbaI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769