Restriction Map of YFL051C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

YFL051C on chromosome VI from coordinates 30540 to 30058.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.15629

EMBOSS_001 Hin6I |GlaI ||NheI ||HhaI |||MaeI |||HaeII ||||Cac8I ||||| AluI ||||| BmtI MboII ||||| CviJI TspGWI BbvII* ||||| | SetI \ \ \\\\\ \ \ ATGTCTATACCCCATTCCGTATTTTCGGCACTCTTGGTCTTCGTGGCGCTAGCTACTACA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGATATGGGGTAAGGCATAAAAGCCGTGAGAACCAGAAGCACCGCGATCGATGATGT / / / //// /// / TspGWI | BbvII* |||| ||CviJI SetI MboII |||| ||NheI |||| ||AluI |||| |MaeI |||| Cac8I |||| SetI |||Hin6I |||BmtI ||GlaI |HhaI HaeII M S I P H S V F S A L L V F V A L A T T C L Y P I P Y F R H S W S S W R * L L Q V Y T P F R I F G T L G L R G A S Y Y N ----:----|----:----|----:----|----:----|----:----|----:----| X D I G W E T N E A S K T K T A S A V V X T * V G N R I K P V R P R R P A L * * H R Y G M G Y K R C E Q D E H R * S S C DdeI Bpu10I |SetI || CviJI HindIII || |BarI | AluI MboII || |BsrI | CviJI | SspI || || TatI | | SetI | | MseI || || |Csp6I | | TsoI BccI | | VspI || || ||RsaI | | Cac8I BarI | | |TspEI \\ \\ \\\ \ \ \ \ \ \ \\ ACCTTAGCCAGTACAGAAGCTTGCTTACCAACAAACAAAAGGGAAGATGGTATGAATATT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TGGAATCGGTCATGTCTTCGAACGAATGGTTGTTTGTTTTCCCTTCTACCATACTTATAA / // /// / / / / / / / | || ||| | | HindIII BarI BccI | SspI | || ||| | | Cac8I MboII | || ||| | CviJI | || ||| | TsoI | || ||| | AluI | || ||| SetI | || ||TatI | || |Csp6I | || RsaI | |CviJI | Bpu10I | DdeI | BsrI BarI T L A S T E A C L P T N K R E D G M N I P * P V Q K L A Y Q Q T K G K M V * I L L S Q Y R S L L T N K Q K G R W Y E Y * ----:----|----:----|----:----|----:----|----:----|----:----| V K A L V S A Q K G V F L L S S P I F I L R L W Y L L K S V L L C F P L H Y S Y G * G T C F S A * W C V F P F I T H I N TspDTI | TatI | |Csp6I BstXI | ||RsaI | NlaIV | |||Hpy166II | |CviJI CviJI \ \\\\ \ \\ \ AATTTTTATGAGTACACAATAGGCGACCAAACCACATACTTGGAGCCTGAATATATGGGC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTAAAAATACTCATGTGTTATCCGCTGGTTTGGTGTATGAACCTCGGACTTATATACCCG / // /// / // / | |TspDTI ||TatI BstXI |CviJI CviJI | TspEI |Hpy166II NlaIV VspI |Csp6I MseI RsaI N F Y E Y T I G D Q T T Y L E P E Y M G I F M S T Q * A T K P H T W S L N I W A F L * V H N R R P N H I L G A * I Y G L ----:----|----:----|----:----|----:----|----:----|----:----| L K * S Y V I P S W V V Y K S G S Y I P * N K H T C L L R G F W M S P A Q I Y P I K I L V C Y A V L G C V Q L R F I H A TspDTI SetI | TspGWI NlaIV AciI EciI \ \ \ \ \ TATGAATACTCCAATACAAAGAAGTTAGGTTCCGTTAGCGGACAGACCAATCTCTCCATA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| ATACTTATGAGGTTATGTTTCTTCAATCCAAGGCAATCGCCTGTCTGGTTAGAGAGGTAT / / / / / / | TspGWI | NlaIV AciI EciI TspDTI SetI Y E Y S N T K K L G S V S G Q T N L S I M N T P I Q R S * V P L A D R P I S P Y * I L Q Y K E V R F R * R T D Q S L H I ----:----|----:----|----:----|----:----|----:----|----:----| * S Y E L V F F N P E T L P C V L R E M S H I S W Y L S T L N R * R V S W D R W I F V G I C L L * T G N A S L G I E G Y SetI SduI | MaeIII SfeI* AciI HgiAI* | Tsp45I CviRI* MnlI \ \ \ \ \ \ \ TACTATAGTCCGCCTTGTGAGAGCACTCCTACCTGTGTGACTTATGCAGTTTTGAAGCGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| ATGATATCAGGCGGAACACTCTCGTGAGGATGGACACACTGAATACGTCAAAACTTCGCA / / / / / / / | AciI HgiAI* SetI | CviRI* MnlI SfeI* SduI Tsp45I MaeIII Y Y S P P C E S T P T C V T Y A V L K R T I V R L V R A L L P V * L M Q F * S V L * S A L * E H S Y L C D L C S F E A * ----:----|----:----|----:----|----:----|----:----|----:----| Y * L G G Q S L V G V Q T V * A T K F R I S Y D A K H S C E * R H S K H L K S A V I T R R T L A S R G T H S I C N Q L T BinI* | BseGI | | MboI | | | DpnI | | | |BstKTI | | | ||FokI MaeII | | | ||| AciI |MaeIII | | | ||| | AsuI* |Tsp45I | | | ||| | AvaII ||TspDTI | | | ||| | |BmgT120I |||SetI BccI | | | ||| | || SetI MnlI |||TaiI TspRI \ \ \ \ \\\ \ \\ \ \ \\\\ \ GATGAGGATGGATATGATCCTTGCGGACCTCTTTATGAAACTAAAAAACGTGACACTGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTCCTACCTATACTAGGAACGCCTGGAGAAATACTTTGATTTTTTGCACTGTGACTT / // // / / //// / // // / BccI || || | | |||AvaII MnlI || || Tsp45I || || | | |||AsuI* || || MaeIII || || | | ||BmgT120I || |TspRI || || | | |SetI || MaeII || || | | AciI |TspDTI || || | FokI TaiI || || MboI SetI || |DpnI || BstKTI |BinI* BseGI D E D G Y D P C G P L Y E T K K R D T E M R M D M I L A D L F M K L K N V T L N * G W I * S L R T S L * N * K T * H * I ----:----|----:----|----:----|----:----|----:----|----:----| S S S P Y S G Q P G R * S V L F R S V S H H P H I H D K R V E K H F * F V H C Q I L I S I I R A S R K I F S F F T V S F MboI MaeIII Hpy188I Tsp45I | DpnI Tsp4CI* Hin4I | |BstKTI Hin4I \ \ \ \\ \ TACTGTGACCCAAATACTGCCTATTGGAGTTCTGATCTTTTTGGTTTCTATACTACTCCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| ATGACACTGGGTTTATGACGGATAACCTCAAGACTAGAAAAACCAAAGATATGATGAGGT / / / / // / / | | Hin4I | || MboI Hin4I | Tsp45I | |DpnI | MaeIII | BstKTI Tsp4CI* Hpy188I Y C D P N T A Y W S S D L F G F Y T T P T V T Q I L P I G V L I F L V S I L L Q L * P K Y C L L E F * S F W F L Y Y S N ----:----|----:----|----:----|----:----|----:----|----:----| Y Q S G F V A * Q L E S R K P K * V V G I S H G L Y Q R N S N Q D K Q N R Y * E V T V W I S G I P T R I K K T E I S S W Csp6I MwoI MaeIII |RsaI |AcyI | Tsp4CI* MmeI || MseI BceAI || Hpy99I \ \ \ \\ \ \ \\ \ ACTAATGTAACTGTGGAAATGACAGGGTACTTAATATGGAGTATGGGCAACCGACGCCGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TGATTACATTGACACCTTTACTGTCCCATGAATTATACCTCATACCCGTTGGCTGCGGCA / / // / / // / Tsp4CI* MmeI || MseI BceAI || AcyI MaeIII |Csp6I |Hpy99I RsaI MwoI T N V T V E M T G Y L I W S M G N R R R L M * L W K * Q G T * Y G V W A T D A V * C N C G N D R V L N M E Y G Q P T P L ----:----|----:----|----:----|----:----|----:----|----:----| V L T V T S I V P Y K I H L I P L R R R L * H L Q P F S L T S L I S Y P C G V G S I Y S H F H C P V * Y P T H A V S A T TGA --- ACT * X X --- Q N S # Enzymes that cut Frequency Isoschizomers AciI 3 BspACI,SsiI AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AluI 2 AluBI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 2 BceAI 1 BinI* 1 AlwI,BspPI,AclWI BmgT120I 1 BmtI 1 BspOI Bpu10I 1 BseGI 1 BstF5I,BtsCI BsrI 1 BseNI,Bse1I,BsrSI BstKTI 2 BstXI 1 Cac8I 2 BstC8I Csp6I 3 CviQI,RsaNI CviJI 5 CviKI-1 CviRI* 1 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI EciI 1 FokI 1 GlaI 1 HaeII 1 BstH2I HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 1 Hin6I 1 HinP1I,HspAI HindIII 1 Hpy166II 1 Hpy8I Hpy188I 1 Hpy99I 1 MaeI 1 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 4 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MmeI 1 MnlI 2 MseI 2 Tru1I,Tru9I MwoI 1 HpyF10VI,BstMWI NheI 1 AsuNHI NlaIV 2 BspLI,BmiI,PspN4I RsaI 3 AfaI SduI 1 MhlI,Bsp1286I SetI 7 SfeI* 1 BstSFI,SfcI,BfmI SspI 1 TaiI 1 TatI 2 TsoI 1 Tsp45I 3 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 3 TspEI 1 TasI,Tsp509I,Sse9I TspGWI 2 TspRI 1 TscAI VspI 1 PshBI,AseI # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI ApoI AscI Asp718I AsuII AvaI AvrII BaeI BalI BamHI BbvCI BbvI Bce83I* BcgI BciVI BclI BdaI BetI* BfiI BglI BglII BisI BlsI BmeT110I BplI BsaAI BsaBI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmAI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstZ17I BtgZI BtrI BtsI CauII* Cfr10I Cfr9I CfrI ClaI CspCI CviAII DinI DraII DraIII DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FauI Fnu4HI FnuDII* FseI FspAI GsaI GsuI HaeIII HgaI HgiCI* HgiJII* Hin4II* HindII HinfI HpaI HpaII HphI Hpy178III* KasI KpnI Ksp632I* MauBI McrI* MfeI MluI MlyI Mph1103I MroNI MslI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NlaIII NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* ScaI SchI ScrFI SecI* SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I StyI SwaI TaqI TaqII TauI TfiI TseI TspMI TstI Tth111I XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769