Restriction Map of SWP82/YFL049W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SWP82/YFL049W on chromosome VI from coordinates 36803 to 38674.


MboII | Tsp4CI* | | TspDTI Hin4II* Hin4II* | | | Hpy178III* MmeI |MnlI \ \ \ \ \ \ \\ ATGCTTGGCGAAGATGAAGGGAATACCGTTCTTGAAAAGGGAAATAATCCTTCTGTAAAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGAACCGCTTCTACTTCCCTTATGGCAAGAACTTTTCCCTTTATTAGGAAGACATTTT / / // / / // Hin4II* | || Hpy178III* MmeI |MnlI | |TspDTI Hin4II* | Tsp4CI* MboII M L G E D E G N T V L E K G N N P S V K C L A K M K G I P F L K R E I I L L * N A W R R * R E Y R S * K G K * S F C K T ----:----|----:----|----:----|----:----|----:----|----:----| X S P S S S P F V T R S F P F L G E T F X A Q R L H L S Y R E Q F P F Y D K Q L H K A F I F P I G N K F L S I I R R Y F Hpy188I AluI | FatI CviJI Csp6I | |CviAII SetI | SetI |RsaI | || NlaIII \ \ \ \\ \ \\ \ CAAGGAGAGGTTGGAGCTGTATTTATAGTACCCAAAATACTTATCAGAGAACATGAAAGA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCTCTCCAACCTCGACATAAATATCATGGGTTTTATGAATAGTCTCTTGTACTTTCT / / / // / / // SetI | CviJI |Csp6I | | |FatI | AluI RsaI | | CviAII SetI | NlaIII Hpy188I Q G E V G A V F I V P K I L I R E H E R K E R L E L Y L * Y P K Y L S E N M K E R R G W S C I Y S T Q N T Y Q R T * K S ----:----|----:----|----:----|----:----|----:----|----:----| C P S T P A T N I T G L I S I L S C S L V L L P Q L Q I * L V W F V * * L V H F L S L N S S Y K Y Y G F Y K D S F M F S SmlI AflII |MseI |TspDTI || ApoI || TspEI || | MwoI || | BstAPI || | | CviRI* || | | | PfoI || | | | BssKI || | | | EcoRII || | | | | BdaI || | | | | BdaI || | | | | ScrFI || | | | | BseBI || | | | | | MboI || | | | | | | DpnI || | | | | | | |BstKTI || | | | | | | ||Hpy178III* || | | | | | | ||| BinI* TspDTI || | | | | | | ||| | TspEI |SetI || | | | | | | ||| | | XmnI || DdeI \\ \ \ \ \ \ \ \\\ \ \ \ \\ \ GTGATACTTAAGCAAATTCTGCAAATCCTGGATCAAGATGAATTGGTTCAACCTCCCTTA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| CACTATGAATTCGTTTAAGACGTTTAGGACCTAGTTCTACTTAACCAAGTTGGAGGGAAT / // / / / / / // / / / / // / | || | | | | | || | | | TspEI |TspDTI BdaI | || | | | | | || | | | XmnI SetI BdaI | || | | | | | || | | BinI* DdeI | || | | | | | || | Hpy178III* | || | | | | | || MboI | || | | | | | |DpnI | || | | | | | EcoRII | || | | | | | BstKTI | || | | | | | BssKI | || | | | | | PfoI | || | | | | BseBI | || | | | | ScrFI | || | | | BdaI | || | | | BdaI | || | | CviRI* | || | TspEI | || | ApoI | || BstAPI | || MwoI | |AflII | |SmlI | MseI TspDTI V I L K Q I L Q I L D Q D E L V Q P P L * Y L S K F C K S W I K M N W F N L P * D T * A N S A N P G S R * I G S T S L R ----:----|----:----|----:----|----:----|----:----|----:----| T I S L C I R C I R S * S S N T * G G K L S V * A F E A F G P D L H I P E V E R H Y K L L N Q L D Q I L I F Q N L R G * MnlI SmlI BdaI AflII BdaI |MseI | ApoI || Esp3I TspDTI | TspEI TspEI TspEI || BsmAI |FokI \ \ \ \ \\ \ \\ GACAAATTTCCCTACAAAAAATTAGAATTACCGAAATATATAGATGAACTTAAGACGAGA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTTAAAGGGATGTTTTTTAATCTTAATGGCTTTATATATCTACTTGAATTCTGCTCT / / / / // / MnlI TspEI TspEI TspEI || TspDTI ApoI || BsmAI || Esp3I |AflII |SmlI MseI D K F P Y K K L E L P K Y I D E L K T R T N F P T K N * N Y R N I * M N L R R E Q I S L Q K I R I T E I Y R * T * D E R ----:----|----:----|----:----|----:----|----:----|----:----| S L N G * L F N S N G F Y I S S S L V L L C I E R C F I L I V S I Y L H V * S S V F K G V F F * F * R F I Y I F K L R S SfaNI HgaI | MfeI | BseGI | TspEI BseGI FokI HphI \ \ \ \ \ \ \ GACGCTACTAATACATCCTACAAGATGATACAATTGGATGCTTATGGTGAGAAAAAAGTG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCGATGATTATGTAGGATGTTCTACTATGTTAACCTACGAATACCACTCTTTTTTCAC / / / / / / / / FokI | HgaI | | BseGI | HphI BseGI | TspEI FokI | MfeI SfaNI D A T N T S Y K M I Q L D A Y G E K K V T L L I H P T R * Y N W M L M V R K K W R Y * Y I L Q D D T I G C L W * E K S G ----:----|----:----|----:----|----:----|----:----|----:----| S A V L V D * L I I C N S A * P S F F T L R * * Y M R C S S V I P H K H H S F L V S S I C G V L H Y L Q I S I T L F F H HphI |AciI TaqI Tsp4CI* || AccI Hin4II* AsuII | TspEI || |Hpy166II SetI |TaqII \ \ \ \\ \\ \ \\ GGTTCGAACGGTGAATTATTTGGCGGTAGACATTATTTGTTCAACACCTTCACATTCACG 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAGCTTGCCACTTAATAAACCGCCATCTGTAATAAACAAGTTGTGGAAGTGTAAGTGC / / / / / // / / | Tsp4CI* | | | |AccI SetI Hin4II* AsuII | | | Hpy166II TaqII TaqI | | AciI | HphI TspEI G S N G E L F G G R H Y L F N T F T F T V R T V N Y L A V D I I C S T P S H S R F E R * I I W R * T L F V Q H L H I H G ----:----|----:----|----:----|----:----|----:----|----:----| P E F P S N N P P L C * K N L V K V N V P N S R H I I Q R Y V N N T * C R * M * T R V T F * K A T S M I Q E V G E C E R CviJI | NdeI | | MboII Csp6I MseI | | |MslI BceAI |RsaI | MslI \ \ \\ \ \\ \ \ GCTCATATGGGTGTTCTTCTGGTACTTTTACAAGATGTCATTAAAGTGTTATACCAAAGC 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGTATACCCACAAGAAGACCATGAAAATGTTCTACAGTAATTTCACAATATGGTTTCG / /// / // / | ||MslI BceAI |Csp6I MslI | |NdeI RsaI MseI | MboII CviJI A H M G V L L V L L Q D V I K V L Y Q S L I W V F F W Y F Y K M S L K C Y T K A S Y G C S S G T F T R C H * S V I P K Q ----:----|----:----|----:----|----:----|----:----|----:----| A * I P T R R T S K C S T M L T N Y W L P E Y P H E E P V K V L H * * L T I G F S M H T N K Q Y K * L I D N F H * V L A FatI |CviAII || MboI || BclI || |NlaIII MnlI || ||DpnI FatI || |||BstKTI BseMII |CviAII || |||| ApoI |BspCNI || NlaIII || |||| TspEI || MnlI \\ \ \\ \\\\ \ \\ \ AACGCAACGCATGACGAGGACGAGTTTATTGTCCAGCATGATCAAATTCTGGTAATGGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCGTTGCGTACTGCTCCTGCTCAAATAACAGGTCGTACTAGTTTAAGACCATTACCTT // // / /// / / // / || |FatI | ||| BclI TspEI || MnlI || CviAII | ||| MboI ApoI |BspCNI |NlaIII | ||DpnI BseMII MnlI | |BstKTI | |FatI | CviAII NlaIII N A T H D E D E F I V Q H D Q I L V M E T Q R M T R T S L L S S M I K F W * W K R N A * R G R V Y C P A * S N S G N G N ----:----|----:----|----:----|----:----|----:----|----:----| L A V C S S S S N I T W C S * I R T I S C R L A H R P R T * Q G A H D F E P L P V C R M V L V L K N D L M I L N Q Y H F CfrI | BalI Hpy178III* DdeI ApoI | CviJI | TfiI |Hpy188I TspEI | HaeIII | HinfI \\ \ \ \ \ \ ACTTCTGAGGAACAAACAAAATTTTTGGCCAAAAATGGTGTCATTCCTGAAGAATCCAAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAGACTCCTTGTTTGTTTTAAAAACCGGTTTTTACCACAGTAAGGACTTCTTAGGTTT / / / / / / / / | DdeI | | CfrI | | MboII Hpy188I | HaeIII | HinfI | CviJI | TfiI | BalI Hpy178III* TspEI ApoI T S E E Q T K F L A K N G V I P E E S K L L R N K Q N F W P K M V S F L K N P K F * G T N K I F G Q K W C H S * R I Q R ----:----|----:----|----:----|----:----|----:----|----:----| V E S S C V F N K A L F P T M G S S D L F K Q P V F L I K P W F H H * E Q L I W S R L F L C F K Q G F I T D N R F F G F MboI XhoII MboII BssKI | DpnI EcoRII | |BstKTI | ScrFI | || MseI | BseBI | || Eco57I | | SetI ApoI | || Eco57MI | | MwoI TspEI | || |BinI* | | | CviJI EcoRI \ \\ \\ \ \ \ \ \ GGATCTTTTAAGTATATAACTGCCAGGTCAGCCTTTGTTGAATTCGGTGCTTCTGTTATT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CCTAGAAAATTCATATATTGACGGTCCAGTCGGAAACAACTTAAGCCACGAAGACAATAA // // / // / / / || || BinI* || | CviJI EcoRI || || MseI || EcoRII TspEI || |Eco57MI || BssKI ApoI || |Eco57I |BseBI || XhoII |ScrFI || MboI |MwoI |DpnI SetI BstKTI G S F K Y I T A R S A F V E F G A S V I D L L S I * L P G Q P L L N S V L L L L I F * V Y N C Q V S L C * I R C F C Y C ----:----|----:----|----:----|----:----|----:----|----:----| P D K L Y I V A L D A K T S N P A E T I L I K * T Y L Q W T L R Q Q I R H K Q * S R K L I Y S G P * G K N F E T S R N N AluI ApoI Cfr10I HindII TfiI CviJI TspEI |HpaII Hpy166II SfaNI HinfI | SetI | HphI \\ \ \ \ \ \ \ \ GCCGGTGGTCAACGCATCGTTGATGATTATTGGGAATCTTTAGCTAAAAAGCAAAATTTG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCCACCAGTTGCGTAGCAACTACTAATAACCCTTAGAAATCGATTTTTCGTTTTAAAC // / / / / / // || Hpy166II SfaNI | | CviJI |TspEI || HindII | | AluI |ApoI |Cfr10I | SetI HphI HpaII HinfI TfiI A G G Q R I V D D Y W E S L A K K Q N L P V V N A S L M I I G N L * L K S K I C R W S T H R * * L L G I F S * K A K F V ----:----|----:----|----:----|----:----|----:----|----:----| A P P * R M T S S * Q S D K A L F C F K Q R H D V C R Q H N N P I K L * F A F N G T T L A D N I I I P F R * S F L L I Q ApoI TspEI BsmAI | MseI Esp3I TspEI | |TspEI \ \ \ \\ TCGTCTCACCAAAGGGTTTTCAAATTATCAACAAATTTAATTTCTAAAATCTCACTTTTA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| AGCAGAGTGGTTTCCCAAAAGTTTAATAGTTGTTTAAATTAAAGATTTTAGAGTGAAAAT / / / / / Esp3I TspEI | | TspEI BsmAI | MseI TspEI ApoI S S H Q R V F K L S T N L I S K I S L L R L T K G F S N Y Q Q I * F L K S H F Y V S P K G F Q I I N K F N F * N L T F T ----:----|----:----|----:----|----:----|----:----|----:----| D D * W L T K L N D V F K I E L I E S K T T E G F P K * I I L L N L K * F R V K R R V L P N E F * * C I * N R F D * K * MnlI BsrDI | Hin4II* | TspEI TspDTI \ \ \ \ \ CGCCCCTCCTTCCAAAATAACAGGATTAGCAATGCCAATGAAATTAGTGCGAACACTAAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| GCGGGGAGGAAGGTTTTATTGTCCTAATCGTTACGGTTACTTTAATCACGCTTGTGATTA / / / / / | Hin4II* BsrDI TspEI TspDTI MnlI R P S F Q N N R I S N A N E I S A N T N A P P S K I T G L A M P M K L V R T L I P L L P K * Q D * Q C Q * N * C E H * * ----:----|----:----|----:----|----:----|----:----|----:----| R G E K W F L L I L L A L S I L A F V L V G R R G F Y C S * C H W H F * H S C * A G G E L I V P N A I G I F N T R V S I ApoI TspEI | TaqI SetI | AsuII MaeIII |Csp6I | | TfiI Tsp45I ||RsaI | | HinfI Tsp4CI* | BciVI \\\ \ \ \ \ \ \ AATACCTGTACGATTTCTACTTCAAAATTCGAATCACAGTATCCAATAGTCACGGAACAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGGACATGCTAAAGATGAAGTTTTAAGCTTAGTGTCATAGGTTATCAGTGCCTTGTT / // / / / / / / SetI |Csp6I | | | Tsp4CI* | Tsp45I RsaI | | HinfI | MaeIII | | TfiI BciVI | AsuII | TaqI TspEI ApoI N T C T I S T S K F E S Q Y P I V T E Q I P V R F L L Q N S N H S I Q * S R N N Y L Y D F Y F K I R I T V S N S H G T T ----:----|----:----|----:----|----:----|----:----|----:----| L V Q V I E V E F N S D C Y G I T V S C Y Y R Y S K * K L I R I V T D L L * P V I G T R N R S * F E F * L I W Y D R F L Tsp4CI* | AciI SduI | TspGWI HgiAI* | NspBII* CviJI SetI | HphI \ \ \ \ \ \ CCGTCAGCGGAGATTAGAGAAGCCTATATTGAAAACTTTGCCAAAGGTGAGCACATTTCG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGCAGTCGCCTCTAATCTCTTCGGATATAACTTTTGAAACGGTTTCCACTCGTGTAAAGC / / / / / / / / | | | AciI CviJI SetI HgiAI* HphI | | NspBII* SduI | TspGWI Tsp4CI* P S A E I R E A Y I E N F A K G E H I S R Q R R L E K P I L K T L P K V S T F R V S G D * R S L Y * K L C Q R * A H F G ----:----|----:----|----:----|----:----|----:----|----:----| G D A S I L S A * I S F K A L P S C M E V T L P S * L L R Y Q F S Q W L H A C K R * R L N S F G I N F V K G F T L V N R DdeI | ApaLI | | CviRI* | | Hpy166II | | | SduI | | | BseSI | | | TspRI | | | HgiAI* | | | |TspEI BssKI | | | || BspCNI EcoRII | | | || |BseMII MfeI | ScrFI | | | || || Csp6I TspEI | BseBI | | | || || |RsaI \ \ \ \ \ \ \\ \\ \\ GCAATTGTTCCTGGTCAAAGCATTAGTGGAACATTGGAACTCAGTGCACAATTTAGAGTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTAACAAGGACCAGTTTCGTAATCACCTTGTAACCTTGAGTCACGTGTTAAATCTCAT / / / / // / / /// // TspEI | EcoRII | || | | ||TspEI |Csp6I MfeI | BssKI | || | | |BseMII RsaI BseBI | || | | BspCNI ScrFI | || | ApaLI | || Hpy166II | || CviRI* | |HgiAI* | |BseSI | |SduI | DdeI TspRI A I V P G Q S I S G T L E L S A Q F R V Q L F L V K A L V E H W N S V H N L E Y N C S W S K H * W N I G T Q C T I * S T ----:----|----:----|----:----|----:----|----:----|----:----| A I T G P * L M L P V N S S L A C N L T P L Q E Q D F C * H F M P V * H V I * L C N N R T L A N T S C Q F E T C L K S Y AluI CviJI | SetI AciI | | CviRI* BsrDI | FnuDII* | | Hin4II* | TspDTI \ \ \ \ \ \ \ CCGCGTTATCACAGCAAAAACTCATTTCAACAAGCTCTGCAAATGAAGGCAATGGACATA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| GGCGCAATAGTGTCGTTTTTGAGTAAAGTTGTTCGAGACGTTTACTTCCGTTACCTGTAT / / / // / / FnuDII* | | |CviRI* | TspDTI AciI | | Hin4II* BsrDI | CviJI | AluI SetI P R Y H S K N S F Q Q A L Q M K A M D I R V I T A K T H F N K L C K * R Q W T Y A L S Q Q K L I S T S S A N E G N G H T ----:----|----:----|----:----|----:----|----:----|----:----| G R * * L L F E N * C A R C I F A I S M V A N D C C F S M E V L E A F S P L P C R T I V A F V * K L L S Q L H L C H V Y Hpy188I |FalI |FalI BccI || FatI Hin6I AluI || |CviAII MboII CviJI || || BbvII* |GlaI | SetI || || |NlaIII |MstI* | |Hpy178III* || || || TspEI |TspDTI FalI | || NlaIV || || || |MboII ||HhaI FalI | ||TspDTI | AciI \\ \\ \\ \\ \\\ \ \ \\\ \ \ CCAATCGGAAGACATGAAGAATTACTTGCGCAATATGAAAGTCAAGCTCCTGATGGTTCC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTAGCCTTCTGTACTTCTTAATGAACGCGTTATACTTTCAGTTCGAGGACTACCAAGG / / / // / / //// / / /// / / | | | || | | |||| FalI | ||| | NlaIV | | | || | | |||| FalI | ||| Hpy178III* | | | || | | |||Hin6I | ||TspDTI | | | || | | ||MstI* | |BccI | | | || | | ||GlaI | CviJI | | | || | | |HhaI | AluI | | | || | | TspDTI SetI | | | || | | MboII | | | || | TspEI | | | || BbvII* | | | || MboII | | | |FatI | | | CviAII | | NlaIII | Hpy188I FalI FalI P I G R H E E L L A Q Y E S Q A P D G S Q S E D M K N Y L R N M K V K L L M V P N R K T * R I T C A I * K S S S * W F R ----:----|----:----|----:----|----:----|----:----|----:----| G I P L C S S N S A C Y S L * A G S P E V L R F V H L I V Q A I H F D L E Q H N W D S S M F F * K R L I F T L S R I T G TsoI TspEI | BccI MaeI \ \ \ \ GCTTCAATTTCACTTCCTAACCATATTCCATCTGTCAATCCTAGCAATAAACCAATCAAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CGAAGTTAAAGTGAAGGATTGGTATAAGGTAGACAGTTAGGATCGTTATTTGGTTAGTTT / / / / / AciI TspEI TsoI BccI MaeI A S I S L P N H I P S V N P S N K P I K L Q F H F L T I F H L S I L A I N Q S N F N F T S * P Y S I C Q S * Q * T N Q T ----:----|----:----|----:----|----:----|----:----|----:----| A E I E S G L W I G D T L G L L L G I L R K L K V E * G Y E M Q * D * C Y V L * S * N * K R V M N W R D I R A I F W D F Hpy178III* | MseI | | AclI MnlI | | MaeII | BseMII DdeI | | | SetI | |BspCNI DdeI |BsmI BsmI | | | TaiI | || MnlI |Hpy188I \\ \ \ \ \ \ \ \\ \ \\ CGAATGCTAAGTAGCATTCTTGATATTAACGTTTCCTCATCAAAAAACAAGAAGTCTGAG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GCTTACGATTCATCGTAAGAACTATAATTGCAAAGGAGTAGTTTTTTGTTCTTCAGACTC / / / / / / /// / / / | | BsmI | | MaeII ||| MnlI | DdeI | DdeI | | AclI ||BspCNI Hpy188I BsmI | MseI |BseMII | TaiI MnlI | SetI Hpy178III* R M L S S I L D I N V S S S K N K K S E E C * V A F L I L T F P H Q K T R S L R N A K * H S * Y * R F L I K K Q E V * G ----:----|----:----|----:----|----:----|----:----|----:----| R I S L L M R S I L T E E D F F L F D S V F A L Y C E Q Y * R K R M L F C S T Q S H * T A N K I N V N G * * F V L L R L FatI |CviAII || NlaIII || | AsuI* || | |BmgT120I || | ||CviJI || | ||HaeIII BseRI || | ||| TspDTI MseI \ \\ \ \\\ \ \ GAGAACGAAATGATAAAACCCATGAACAAGGGCCAACACAAAAATAATACATCGTTAAAC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTTGCTTTACTATTTTGGGTACTTGTTCCCGGTTGTGTTTTTATTATGTAGCAATTTG / / // // / / BseRI | |FatI || TspDTI MseI | CviAII |AsuI* NlaIII BmgT120I HaeIII CviJI E N E M I K P M N K G Q H K N N T S L N R T K * * N P * T R A N T K I I H R * T E R N D K T H E Q G P T Q K * Y I V K H ----:----|----:----|----:----|----:----|----:----|----:----| S F S I I F G M F L P W C L F L V D N F P S R F S L V W S C P G V C F Y Y M T L L V F H Y F G H V L A L V F I I C R * V CviJI TfiI ApoI | ApoI HinfI EciI TspEI SetI | TspEI | BceAI | MseI AciI EcoRI |Hpy166II \ \ \ \ \ \ \ \ \\ ATAAACGGCTGGAAATTTGAATCTTTGCCATTAAAATCCGCCGAGAATTCAGGTAAACAG 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TATTTGCCGACCTTTAAACTTAGAAACGGTAATTTTAGGCGGCTCTTAAGTCCATTTGTC / / // / / / // / CviJI | || EciI MseI AciI |SetI Hpy166II | |BceAI EcoRI | HinfI TspEI | TfiI ApoI TspEI ApoI I N G W K F E S L P L K S A E N S G K Q * T A G N L N L C H * N P P R I Q V N S K R L E I * I F A I K I R R E F R * T A ----:----|----:----|----:----|----:----|----:----|----:----| M F P Q F N S D K G N F D A S F E P L C C L R S S I Q I K A M L I R R S N L Y V Y V A P F K F R Q W * F G G L I * T F L TseI BceAI |BisI AluI |MnlI ||BlsI CviJI |SspI ||TspDTI PvuII || NmeAIII BbvI ||| MaeI SetI NspBII* \\ \ \ \\\ \ \ \ CAATATTATAGAGGATTGCCGTTATATGAAAAAAACACGCTGCTAGAAAGGTTGAAACAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| GTTATAATATCTCCTAACGGCAATATACTTTTTTTGTGCGACGATCTTTCCAACTTTGTC /// / //// / / / / ||BceAI BbvI |||| | SetI | NspBII* |NmeAIII |||| MaeI | PvuII |SspI |||TseI | CviJI MnlI ||BisI | AluI |BlsI SetI TspDTI Q Y Y R G L P L Y E K N T L L E R L K Q N I I E D C R Y M K K T R C * K G * N S I L * R I A V I * K K H A A R K V E T A ----:----|----:----|----:----|----:----|----:----|----:----| C Y * L P N G N Y S F F V S S S L N F C A I N Y L I A T I H F F C A A L F T S V L I I S S Q R * I F F V R Q * F P Q F L AgeI MaeI BetI* TspEI | BceAI Cfr10I SetI | MseI | | SfaNI MseI |HpaII \ \ \ \ \ \ \ \\ CTGACACCGAACGAAATTAAAGAACTAGAGCATTTACACGATGCCGTTTTTGTTAATACC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GACTGTGGCTTGCTTTAATTTCTTGATCTCGTAAATGTGCTACGGCAAAAACAATTATGG // / / / / |MseI | | SfaNI MseI TspEI | BceAI MaeI L T P N E I K E L E H L H D A V F V N T * H R T K L K N * S I Y T M P F L L I P D T E R N * R T R A F T R C R F C * Y R ----:----|----:----|----:----|----:----|----:----|----:----| S V G F S I L S S S C K C S A T K T L V A S V S R F * L V L A N V R H R K Q * Y Q C R V F N F F * L M * V I G N K N I G CviRI* BsrI | AclI TatI BspMI | MaeII |Csp6I |TatI | | SetI ||RsaI ||Csp6I | | TaiI ||ScaI |||RsaI \ \ \ \\\ \\\\ GGTTTGCAGAACGTTAGAAAAGTTAGGACAAAAAAATGGAAAAAGTACTGGCAGTACAAG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| CCAAACGTCTTGCAATCTTTTCAATCCTGTTTTTTTACCTTTTTCATGACCGTCATGTTC // / / / /// / /// || | | MaeII ||| BsrI ||TatI || | | AclI ||TatI |Csp6I || | TaiI |Csp6I |BspMI || | SetI ScaI RsaI || CviRI* RsaI |Cfr10I |BetI* |AgeI HpaII G L Q N V R K V R T K K W K K Y W Q Y K V C R T L E K L G Q K N G K S T G S T R F A E R * K S * D K K M E K V L A V Q G ----:----|----:----|----:----|----:----|----:----|----:----| P K C F T L F T L V F F H F F Y Q C Y L R N A S R * F L * S L F I S F T S A T C T Q L V N S F N P C F F P F L V P L V L Tsp4CI* | MfeI ApoI FokI | TspEI TspEI | AjuI | |BsmAI EcoRI | |TspDTI SetI | |Eco31I | BseGI | || SspI \ \ \\ \ \ \ \\ \ GCAGGTATTCCTATCGGTTTGAAACGGTCTCAATTGGATGAATTCAAAAATAAATATTTG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCCATAAGGATAGCCAAACTTTGCCAGAGTTAACCTACTTAAGTTTTTATTTATAAAC / / // / / / / / / SetI Tsp4CI* || | | | | | SspI || | | | | FokI || | | | TspDTI || | | AjuI || | EcoRI || | TspEI || | ApoI || BseGI |Eco31I |BsmAI TspEI MfeI A G I P I G L K R S Q L D E F K N K Y L Q V F L S V * N G L N W M N S K I N I * R Y S Y R F E T V S I G * I Q K * I F E ----:----|----:----|----:----|----:----|----:----|----:----| A P I G I P K F R D * N S S N L F L Y K P L Y E * R N S V T E I P H I * F Y I N C T N R D T Q F P R L Q I F E F I F I Q Hin6I ApoI |GlaI AjuI TspEI ||HhaI MaeIII | MseI \\\ \ \ \ AAAGATGTGTTGGCGCAAACGAGTGTTACTACAAATTTTAACGAAATAACGAATACGGAT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTACACAACCGCGTTTGCTCACAATGATGTTTAAAATTGCTTTATTGCTTATGCCTA /// / / / / ||| AjuI MaeIII | MseI ||Hin6I TspEI |GlaI ApoI HhaI K D V L A Q T S V T T N F N E I T N T D K M C W R K R V L L Q I L T K * R I R M R C V G A N E C Y Y K F * R N N E Y G * ----:----|----:----|----:----|----:----|----:----|----:----| F S T N A C V L T V V F K L S I V F V S S L H T P A F S H * * L N * R F L S Y P F I H Q R L R T N S C I K V F Y R I R I Acc65I HgiCI* FokI |Csp6I StyI TspGWI ||RsaI AvrII |MnlI ||NlaIV SecI* TspEI BseGI || TspDTI ||| KpnI |MaeI | MaeIII MseI \ \\ \ \\\ \ \\ \ \ \ GAAACAATAACAACAAAGAGGGTACCGAACCCAAACTTCCTAGGAAATTGTAACATTAAG 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGTTATTGTTGTTTCTCCCATGGCTTGGGTTTGAAGGATCCTTTAACATTGTAATTC / / / / / / /// // / / / BseGI | | | FokI | ||HgiCI* |SecI* | | MseI | | TspDTI | ||Acc65I |AvrII | MaeIII | MnlI | |Csp6I |StyI TspEI TspGWI | NlaIV MaeI | RsaI KpnI E T I T T K R V P N P N F L G N C N I K K Q * Q Q R G Y R T Q T S * E I V T L R N N N N K E G T E P K L P R K L * H * G ----:----|----:----|----:----|----:----|----:----|----:----| S V I V V F L T G F G F K R P F Q L M L H F L L L L S P V S G L S G L F N Y C * F C Y C C L P Y R V W V E * S I T V N L FatI |CviAII || NlaIII MseI || | Hpy166II |AhaIII* || | | Csp6I BseYI || SetI MnlI || | | |RsaI | GsaI \\ \ \ \\ \ \ \\ \ \ GATTTTAAACCTCCATACATTTATTCTCATGTGAACAAAGTACCACAAAATGTCGCTGGG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| CTAAAATTTGGAGGTATGTAAATAAGAGTACACTTGTTTCATGGTGTTTTACAGCGACCC /// / / // / // / / ||SetI MnlI | || | |Csp6I | BseYI |MseI | || | RsaI GsaI AhaIII* | || Hpy166II | |FatI | CviAII NlaIII D F K P P Y I Y S H V N K V P Q N V A G I L N L H T F I L M * T K Y H K M S L G F * T S I H L F S C E Q S T T K C R W G ----:----|----:----|----:----|----:----|----:----|----:----| S K L G G Y M * E * T F L T G C F T A P P N * V E M C K N E H S C L V V F H R Q I K F R W V N I R M H V F Y W L I D S P CviJI | MseI | | AluI | | CviJI Eco57I | | | SetI Eco57MI | | | | BceAI TspRI | BsrI TspRI \ \ \ \ \ \ \ \ \ GATAAAACGGCTGTTAAGCTGGACACTGAAGTAAAGAACACAAATGCTAATCCAGTGGTG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CTATTTTGCCGACAATTCGACCTGTGACTTCATTTCTTGTGTTTACGATTAGGTCACCAC / / / / / / / CviJI | | | BceAI | TspRI | | TspRI | BsrI | CviJI Eco57MI | AluI Eco57I MseI SetI D K T A V K L D T E V K N T N A N P V V I K R L L S W T L K * R T Q M L I Q W W * N G C * A G H * S K E H K C * S S G G ----:----|----:----|----:----|----:----|----:----|----:----| S L V A T L S S V S T F F V F A L G T T P Y F P Q * A P C Q L L S C L H * D L P I F R S N L Q V S F Y L V C I S I W H H BinI* | MboI | BamHI | XhoII | Hpy99I | | DpnI | | NlaIV | | |BetI* | | |BstKTI | | ||HpaII | | ||| McrI* | | ||| BinI* | | ||| | AciI | | ||| | BisI | | ||| | |BlsI | | ||| | ||TauI | | ||| | ||TspGWI | | ||| | ||| BetI* | | ||| | ||| |TsoI | | ||| | ||| |HpaII | | ||| | ||| || Eco57I | | ||| | ||| || Eco57MI | | ||| | ||| || | BssKI | | ||| | ||| || | EcoRII | | ||| | ||| || | | ScrFI | | ||| | ||| || | | BseBI AluI | | ||| | ||| || | | |SetI CviJI | | ||| | ||| || | | || CviJI | SetI \ \ \\\ \ \\\ \\ \ \ \\ \ \ \ GCGACGGATCCGGTCGCCGCTAAACCGGACAACCTGGCTAACTTCAGCAACGAAGTAGCT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| CGCTGCCTAGGCCAGCGGCGATTTGGCCTGTTGGACCGATTGAAGTCGTTGCTTCATCGA // // / // ///// / / // / / / / / || || | || ||||| | | || | | EcoRII | CviJI || || | || ||||| | | || | | BssKI | AluI || || | || ||||| | | || | | CviJI SetI || || | || ||||| | | || | BseBI || || | || ||||| | | || | ScrFI || || | || ||||| | | || SetI || || | || ||||| | | |BetI* || || | || ||||| | | HpaII || || | || ||||| | Eco57MI || || | || ||||| | Eco57I || || | || ||||| TsoI || || | || ||||AciI || || | || |||BisI || || | || ||TspGWI || || | || ||BlsI || || | || |TauI || || | || BinI* || || | |BetI* || || | HpaII || || | McrI* || || XhoII || || BamHI || || MboI || |NlaIV || |DpnI || BstKTI |BinI* Hpy99I A T D P V A A K P D N L A N F S N E V A R R I R S P L N R T T W L T S A T K * L D G S G R R * T G Q P G * L Q Q R S S Y ----:----|----:----|----:----|----:----|----:----|----:----| A V S G T A A L G S L R A L K L L S T A P S P D P R R * V P C G P * S * C R L L R R I R D G S F R V V Q S V E A V F Y S TspEI \ ATGAATAATTGA 1870 ----:----|-- TACTTATTAACT / TspEI M N N * * I I X E * L X ----:----|-- I F L Q * S Y N H I I S # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 6 BspACI,SsiI AclI 2 Psp1406I AflII 2 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 1 DraI AjuI 1 AluI 7 AluBI ApaLI 1 Alw44I,VneI ApoI 12 AcsI,XapI AsuI* 1 Cfr13I,PspPI,Sau96I,AspS9I AsuII 2 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvrII 1 AspA2I,BlnI,XmaJI BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 1 BbvI 1 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 2 BceAI 5 BciVI 1 BfuI BclI 1 FbaI,Ksp22I BdaI 2 BetI* 3 BsaWI BinI* 4 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmgT120I 1 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 4 BstF5I,BtsCI BseMII 3 BseRI 1 BseSI 1 BaeGI,BstSLI BseYI 1 BsmAI 3 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 3 BspMI 1 BfuAI,Acc36I,BveI BsrDI 2 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BstAPI 1 BstKTI 4 Cfr10I 2 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI Csp6I 8 CviQI,RsaNI CviAII 6 CviJI 15 CviKI-1 CviRI* 4 HpyCH4V DdeI 5 BstDEI,HpyF3I DpnI 4 MalI EciI 1 Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 3 AcuI Eco57MI 3 EcoRI 3 EcoRII 4 AjnI,Psp6I,PspGI Esp3I 2 BsmBI FalI 2 FatI 6 FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 4 GlaI 2 GsaI 1 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HhaI 2 BstHHI,CfoI,AspLEI Hin4II* 5 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HinfI 4 HpaII 4 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 5 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 4 Hpy99I 1 KpnI 1 MaeI 4 FspBI,BfaI,XspI MaeII 2 HpyCH4IV MaeIII 3 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 3 MunI MmeI 1 MnlI 10 MseI 14 Tru1I,Tru9I MslI 2 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 2 HpyF10VI,BstMWI NdeI 1 FauNDI NlaIII 6 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NmeAIII 1 NspBII* 2 MspA1I PfoI 1 PvuII 1 RsaI 8 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 20 SfaNI 3 LweI SmlI 2 SmoI SspI 2 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 2 TaqI 2 TaqII 1 TatI 2 TauI 1 TfiI 4 PfeI TseI 1 ApeKI TsoI 2 Tsp45I 1 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 12 TspEI 28 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 3 TscAI XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AcyI AflIII AlfI AloI AlwNI ApaI AscI AvaI AvaII BaeI BarI BbvCI Bce83I* BcgI BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BsePI BsgI BsiI* BsiYI* BslFI BsmFI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BssNAI Bst1107I BstEII BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr9I ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I Ecl136II Eco47III EcoICRI EcoNI EcoP15I EcoRV EcoT22I EgeI EheI EspI* FaqI FauI FseI FspAI GsuI HaeII HgiJII* Hin4I HindIII HpaI KasI Ksp632I* MauBI MluI MlyI Mph1103I MroNI NaeI NarI NcoI NgoMIV NheI NotI NruI NsiI NspI OliI PacI PasI PflMI PleI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* SchI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TspMI TstI Tth111I VspI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769