Restriction Map of ACT1/YFL039C

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

ACT1/YFL039C on chromosome VI from coordinates 54696 to 53260.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.


EMBOSS_001 FokI |MaeI || Hin6I || |GlaI || |Eco47III || ||HhaI || |||HaeII Tsp4CI* || ||||Cac8I | BslFI TfiI || ||||| CviRI* BccI | | TspEI HinfI || ||||| | BseGI |MseI | | | CviRI* \ \\ \\\\\ \ \ \\ \ \ \ \ ATGGATTCTGGTATGTTCTAGCGCTTGCACCATCCCATTTAACTGTAAGAAGAATTGCAC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTAAGACCATACAAGATCGCGAACGTGGTAGGGTAAATTGACATTCTTCTTAACGTG / //// / // / / / / // / HinfI |||| | |BseGI | | Tsp4CI* | || Tsp4CI* TfiI |||| | CviRI* | MseI | || MboII |||| Cac8I BccI | |CviRI* |||Hin6I | TspEI ||Eco47III BslFI ||GlaI |HhaI |FokI HaeII MaeI M D S G M F * R L H H P I * L * E E L H W I L V C S S A C T I P F N C K K N C T G F W Y V L A L A P S H L T V R R I A R ----:----|----:----|----:----|----:----|----:----|----:----| X S E P I N * R K C W G M * S Y S S N C X P N Q Y T R A S A G D W K V T L L I A H I R T H E L A Q V M G N L Q L F F Q V AsuI* AvaII MboII AvaI Tsp4CI* XhoI |BmgT120I SmlI ||NlaIV |TaqI ||| MfeI |BmeT110I ||| TspEI ||Hpy178III* SetI \\\ \ \\\ \ GGTCCCAATTGCTCGAGAGATTTCTCTTTTACCTTTTTTTACTATTTTTCACTCTCCCAT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| CCAGGGTTAACGAGCTCTCTAAAGAGAAAATGGAAAAAAATGATAAAAAGTGAGAGGGTA // / // / |AvaII | |Hpy178III* SetI |AsuI* | |SmlI | | |XhoI | | |AvaI | | BmeT110I | | TaqI | TspEI | MfeI BmgT120I NlaIV G P N C S R D F S F T F F Y Y F S L S H V P I A R E I S L L P F F T I F H S P I S Q L L E R F L F Y L F L L F F T L P * ----:----|----:----|----:----|----:----|----:----|----:----| P G L Q E L S K E K V K K * * K E S E W R D W N S S L N R K * R K K S N K V R G T G I A R S I E R K G K K V I K * E G M MnlI | MboI | | DpnI SetI | | |BstKTI XcmI TsoI CviJI \ \ \ \\ \ \ \ AACCTCCTATATTGACTGATCTGTAATAACCACGATATTATTGGAATAAATAGGGGCTTG 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGAGGATATAACTGACTAGACATTATTGGTGCTATAATAACCTTATTTATCCCCGAAC / / // / / / / SetI MnlI || MboI XcmI TsoI CviJI |DpnI BstKTI N L L Y * L I C N N H D I I G I N R G L T S Y I D * S V I T T I L L E * I G A * P P I L T D L * * P R Y Y W N K * G L E ----:----|----:----|----:----|----:----|----:----|----:----| L R R Y Q S I Q L L W S I I P I F L P K Y G G I N V S R Y Y G R Y * Q F L Y P S V E * I S Q D T I V V I N N S Y I P A Q ApoI TspEI SspI Hpy178III* MboII \ \ \ \ AAATTTGGAAAAAAAAAAAAAACTGAAATATTTTCGTGATAAGTGATAGTGATATTCTTC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAACCTTTTTTTTTTTTTTGACTTTATAAAAGCACTATTCACTATCACTATAAGAAG / / / / TspEI SspI | MboII ApoI Hpy178III* K F G K K K K T E I F S * * V I V I F F N L E K K K K L K Y F R D K * * * Y S S I W K K K K N * N I F V I S D S D I L L ----:----|----:----|----:----|----:----|----:----|----:----| F N P F F F F V S I N E H Y T I T I N K S I Q F F F F F Q F I K T I L S L S I R F K S F F F F S F Y K R S L H Y H Y E E FatI |CviAII ||BsmAI |||TatI MaeIII ||||Csp6I TspDTI Tsp4CI* ||||NlaIII | TaqI | DdeI |||||RsaI | ClaI \ \ \\\\\\ \ \ TTTTATTTGCTACTGTTACTAAGTCTCATGTACTAACATCGATTGCTTCATTCTTTTTGT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| AAAATAAACGATGACAATGATTCAGAGTACATGATTGTAGCTAACGAAGTAAGAAAAACA / / / / ///// / / | | | | ||||| | ClaI | | | | ||||| | TaqI | | | | ||||| TspDTI | | | | ||||TatI | | | | |||BsmAI | | | | |||Csp6I | | | | ||RsaI | | | | |FatI | | | | CviAII | | | NlaIII | | DdeI | MaeIII Tsp4CI* F Y L L L L L S L M Y * H R L L H S F C F I C Y C Y * V S C T N I D C F I L F V L F A T V T K S H V L T S I A S F F L L ----:----|----:----|----:----|----:----|----:----|----:----| K * K S S N S L R M Y * C R N S * E K Q R K N A V T V L D * T S V D I A E N K K K I Q * Q * * T E H V L M S Q K M R K T TsoI |SetI || TseI BbvI || |BisI MnlI || ||BlsI Tsp4CI* \ \\ \\\ \ TGCTATATTATATGTTTAGAGGTTGCTGCTTTGGTTATTGATAACGGTTCTGGTATGTGT 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ACGATATAATATACAAATCTCCAACGACGAAACCAATAACTATTGCCAAGACCATACACA / / // /// / MnlI | |TsoI ||TseI Tsp4CI* | SetI |BisI BbvI BlsI C Y I I C L E V A A L V I D N G S G M C A I L Y V * R L L L W L L I T V L V C V L Y Y M F R G C C F G Y * * R F W Y V * ----:----|----:----|----:----|----:----|----:----|----:----| Q * I I H K S T A A K T I S L P E P I H N S Y * I N L P Q Q K P * Q Y R N Q Y T A I N Y T * L N S S Q N N I V T R T H T CviJI Cfr10I |HpaII Hpy99I || MwoI | HphI || | Cfr10I | |BsiI* BccI || | |HpaII | ||MboII | Hpy99I || | || MaeIII | ||BbvII* | | BaeI || | || Tsp45I | |||MwoI | | AccI || | || |BseRI | |||HgaI MnlI | | |Hpy166II \\ \ \\ \\ \ \\\\ \ \ \ \\ AAAGCCGGTTTTGCCGGTGACGACGCTCCTCGTGCTGTCTTCCCATCTATCGTCGGTAGA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCGGCCAAAACGGCCACTGCTGCGAGGAGCACGACAGAAGGGTAGATAGCAGCCATCT / // /// // /// // // / / // | |Cfr10I ||| || ||| || |MnlI | BccI |AccI | HpaII ||| || ||| || HgaI | BaeI Hpy166II | MwoI ||| || ||| |BbvII* Hpy99I CviJI ||| || ||| BsiI* ||| || ||MboII ||| || |MwoI ||| || HphI ||| |Tsp45I ||| |MaeIII ||| Hpy99I ||Cfr10I |HpaII BseRI K A G F A G D D A P R A V F P S I V G R K P V L P V T T L L V L S S H L S S V D S R F C R * R R S S C C L P I Y R R * T ----:----|----:----|----:----|----:----|----:----|----:----| L A P K A P S S A G R A T K G D I T P L Y L R N Q R H R R E E H Q R G M * R R Y F G T K G T V V S R T S D E W R D D T S HinfI | BdaI SetI | BdaI | FatI BaeI | | MaeII StyI | |CviAII | MlyI | | | SetI SecI* | || NlaIII | PleI | | | TaiI \ \ \\ \ \ \ \ \ \ \ CCAAGACACCAAGGTATCATGGTCGGTATGGGTCAAAAAGACTCCTACGTTGGTGATGAA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTCTGTGGTTCCATAGTACCAGCCATACCCAGTTTTTCTGAGGATGCAACCACTACTT / / / // / // / / / / / | | | || BaeI |PleI | | | MaeII SetI | | | |FatI MlyI | | TaiI | | | CviAII | | SetI | | NlaIII | HinfI | SecI* BdaI | StyI BdaI SetI P R H Q G I M V G M G Q K D S Y V G D E Q D T K V S W S V W V K K T P T L V M K K T P R Y H G R Y G S K R L L R W * * S ----:----|----:----|----:----|----:----|----:----|----:----| G L C W P I M T P I P * F S E * T P S S V L V G L Y * P R Y P D F L S R R Q H H W S V L T D H D T H T L F V G V N T I F AluI CviJI | SetI | |HphI | || MnlI | || | TspDTI | || | | BdaI | || | | BdaI | || | | |SetI | || | | || Hpy178III* | || | | || | MaeII HphI | || | | || | |MaeIII |Tsp4CI* | || | | || | || SetI MfeI || MaeIII | || | | || | || TaiI TspEI || Tsp45I \ \\ \ \ \\ \ \\ \ \ \\ \ GCTCAATCCAAGAGAGGTATCTTGACTTTACGTTACCCAATTGAACACGGTATTGTCACC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CGAGTTAGGTTCTCTCCATAGAACTGAAATGCAATGGGTTAACTTGTGCCATAACAGTGG / / / / // / / / / / // / | | | | |BdaI | | | | | |Tsp4CI* Tsp45I | | | | |BdaI | | | | | HphI MaeIII | | | | SetI | | | | TspEI | | | TspDTI | | | | MfeI | | MnlI | | | MaeIII | HphI | | MaeII CviJI | TaiI AluI | SetI Hpy178III* A Q S K R G I L T L R Y P I E H G I V T L N P R E V S * L Y V T Q L N T V L S P S I Q E R Y L D F T L P N * T R Y C H Q ----:----|----:----|----:----|----:----|----:----|----:----| A * D L L P I K V K R * G I S C P I T V L E I W S L Y R S K V N G L Q V R Y Q * S L G L S T D Q S * T V W N F V T N D G BslFI |MboI |BglII Hin4I BfiI |XhoII Hin4I Hin4I || DpnI SfaNI |Hin4II* BsrI Hin4I || |BstKTI |SetI ||TspEI \ \ \\ \\ \\ \\\ AACTGGGACGATATGGAAAAGATCTGGCATCATACCTTCTACAACGAATTGAGAGTTGCC 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TTGACCCTGCTATACCTTTTCTAGACCGTAGTATGGAAGATGTTGCTTAACTCTCAACGG / / / //// / // / / | | BfiI |||XhoII SetI || | TspEI | Hin4I |||BglII || Hin4II* | Hin4I |||MboI |SfaNI BsrI ||BslFI Hin4I |DpnI Hin4I BstKTI N W D D M E K I W H H T F Y N E L R V A T G T I W K R S G I I P S T T N * E L P L G R Y G K D L A S Y L L Q R I E S C P ----:----|----:----|----:----|----:----|----:----|----:----| L Q S S I S F I Q C * V K * L S N L T A W S P R Y P F S R A D Y R R C R I S L Q V P V I H F L D P M M G E V V F Q S N G BsaXI | Hin4I BsaXI AluI | Eco57I Hin4I CviJI | Eco57MI MlyI |MboII | SetI | | TspDTI PleI \\ \ \ \ \ \ \ CCAGAAGAACACCCTGTTCTTTTGACTGAAGCTCCAATGAACCCTAAATCAAACAGAGAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTTCTTGTGGGACAAGAAAACTGACTTCGAGGTTACTTGGGATTTAGTTTGTCTCTT / / / / / / / / / | | MboII | CviJI | | TspDTI MlyI | BsaXI | AluI | Eco57MI Hin4I SetI | Eco57I Hin4I BsaXI P E E H P V L L T E A P M N P K S N R E Q K N T L F F * L K L Q * T L N Q T E K R R T P C S F D * S S N E P * I K Q R K ----:----|----:----|----:----|----:----|----:----|----:----| G S S C G T R K V S A G I F G L D F L S G L L V G Q E K S Q L E L S G * I L C L W F F V R N K Q S F S W H V R F * V S F BceAI |MaeII AclI || SetI MaeII || TaiI HinfI | SetI FokI || |Hin4II* | TspEI | TaiI CviJI || || BseGI \ \ \ \ \ \\ \\ \ AAGATGACTCAAATTATGTTTGAAACTTTCAACGTTCCAGCCTTCTACGTTTCCATCCAA 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTACTGAGTTTAATACAAACTTTGAAAGTTGCAAGGTCGGAAGATGCAAAGGTAGGTT / / / / / / / / //// PleI HinfI TspEI | MaeII | | | |||BseGI | AclI | | | ||Hin4II* TaiI | | | |MaeII SetI | | | BceAI | | TaiI | | SetI | FokI CviJI K M T Q I M F E T F N V P A F Y V S I Q R * L K L C L K L S T F Q P S T F P S K D D S N Y V * N F Q R S S L L R F H P S ----:----|----:----|----:----|----:----|----:----|----:----| F I V * I I N S V K L T G A K * T E M W F S S E F * T Q F K * R E L R R R K W G L H S L N H K F S E V N W G E V N G D L TfiI MboII HinfI | TatI BetI* | BccI BccI | |Csp6I |HpaII | BetI* CviJI | ||RsaI ||Ksp632I* BsrI | |HpaII \ \ \\\ \\\ \ \ \\ GCCGTTTTGTCCTTGTACTCTTCCGGTAGAACTACTGGTATTGTTTTGGATTCCGGTGAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCAAAACAGGAACATGAGAAGGCCATCTTGATGACCATAACAAAACCTAAGGCCACTA // / /// /// / // // |BccI MboII ||TatI ||Ksp632I* BsrI || |BetI* CviJI |Csp6I |BetI* || HpaII RsaI HpaII |BccI HinfI TfiI A V L S L Y S S G R T T G I V L D S G D P F C P C T L P V E L L V L F W I P V M R F V L V L F R * N Y W Y C F G F R * W ----:----|----:----|----:----|----:----|----:----|----:----| A T K D K Y E E P L V V P I T K S E P S L R K T R T S K R Y F * Q Y Q K P N R H G N Q G Q V R G T S S S T N N Q I G T I MaeIII | HphI | | MaeII | | |BtrI | | || SetI | | || TaiI | | || | Hpy99I TfiI | | || | | TspEI SetI MnlI HinfI \ \ \\ \ \ \ \ \ \ GGTGTTACTCACGTCGTTCCAATTTACGCTGGTTTCTCTCTACCTCACGCCATTTTGAGA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CCACAATGAGTGCAGCAAGGTTAAATGCGACCAAAGAGAGATGGAGTGCGGTAAAACTCT / / //// / / / | | |||MaeII TspEI SetI MnlI | | ||BtrI | | |Hpy99I | | TaiI | | SetI | MaeIII HphI G V T H V V P I Y A G F S L P H A I L R V L L T S F Q F T L V S L Y L T P F * E C Y S R R S N L R W F L S T S R H F E N ----:----|----:----|----:----|----:----|----:----|----:----| P T V * T T G I * A P K E R G * A M K L H H * E R R E L K R Q N R E V E R W K S T N S V D N W N V S T E R * R V G N Q S BsaBI |MboI |BglII |XhoII || DpnI || |BstKTI || ||SmlI || ||Hpy178III* || ||| TsoI || ||| | EcoP15I || ||| | | MboII || ||| | | |BsaXI || ||| | | |TspDTI CfrI || ||| | | |Hpy166II | CviJI || ||| | | || MaeII | Cfr10I || ||| | | || | SetI TaqI | HaeIII || ||| | | || | TaiI ClaI | |HpaII || ||| | | || | |MaeIII \ \ \\ \\ \\\ \ \ \\ \ \\ ATCGATTTGGCCGGTAGAGATTTGACTGACTACTTGATGAAGATCTTGAGTGAACGTGGT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TAGCTAAACCGGCCATCTCTAAACTGACTGATGAACTACTTCTAGAACTCACTTGCACCA / / / /// / // / / ///// / | ClaI | ||Cfr10I | || | | ||||| MaeII | TaqI | |HpaII | || | | ||||TaiI HinfI | CfrI | || | | ||||SetI TfiI HaeIII | || | | |||Hpy166II CviJI | || | | ||EcoP15I | || | | |TspDTI | || | | |MboII | || | | BsaXI | || | | SmlI | || | Hpy178III* | || XhoII | || BglII | || MboI | || TsoI | |DpnI | BstKTI BsaBI I D L A G R D L T D Y L M K I L S E R G S I W P V E I * L T T * * R S * V N V V R F G R * R F D * L L D E D L E * T W L ----:----|----:----|----:----|----:----|----:----|----:----| I S K A P L S K V S * K I F I K L S R P F R N P R Y L N S Q S S S S S R S H V H D I Q G T S I Q S V V Q H L D Q T F T T BtsI | Hin4I | | TspRI | | |BsaXI | | || TspGWI MaeIII Bce83I* | | || | TspEI Tsp45I Hin4I MaeIII \ \ \ \\ \ \ \ \ \ TACTCTTTCTCCACCACTGCTGAAAGAGAAATTGTCCGTGACATCAAGGAAAAACTATGT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAGAAAGAGGTGGTGACGACTTTCTCTTTAACAGGCACTGTAGTTCCTTTTTGATACA // / / / / / / |Bce83I* TspRI | TspGWI TspEI | Hin4I MaeIII Hin4I BsaXI Tsp45I BtsI MaeIII Y S F S T T A E R E I V R D I K E K L C T L S P P L L K E K L S V T S R K N Y V L F L H H C * K R N C P * H Q G K T M L ----:----|----:----|----:----|----:----|----:----|----:----| * E K E V V A S L S I T R S M L S F S H N S K R W W Q Q F L F Q G H C * P F V I V R E G G S S F S F N D T V D L F F * T CviRI* | AciI MaeII | | TseI | SetI | | NspBII* | TaiI TaqI | | |BisI MfeI | | Hpy99I AsuII | | |MboII AlfI | | |StyI | AlfI | | ||BlsI AlfI | | |SecI* | AlfI BbvI | | ||| MboII TspEI \ \ \\ \ \ \ \ \ \\\ \ \ TACGTCGCCTTGGACTTCGAACAAGAAATGCAAACCGCTGCTCAATCTTCTTCAATTGAA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCAGCGGAACCTGAAGCTTGTTCTTTACGTTTGGCGACGAGTTAGAAGAAGTTAACTT //// / / / / / //// / / |||MaeII | | AsuII | CviRI* |||MboII AlfI TspEI ||MaeIII | | TaqI BbvI |||TseI AlfI MfeI |Hpy99I | AlfI ||BisI TaiI | AlfI |BlsI SetI SecI* NspBII* StyI MboII AciI Y V A L D F E Q E M Q T A A Q S S S I E T S P W T S N K K C K P L L N L L Q L K R R L G L R T R N A N R C S I F F N * K ----:----|----:----|----:----|----:----|----:----|----:----| * T A K S K S C S I C V A A * D E E I S N R R R P S R V L F A F R Q E I K K L Q V D G Q V E F L F H L G S S L R R * N F TfiI HinfI | Hpy188I | | CviJI BccI | | | SduI | Hpy178III* MaeIII | | | HgiJII* \ \ \ \ \ \ \ AAATCCTACGAACTTCCAGATGGTCAAGTCATCACTATTGGTAACGAAAGATTCAGAGCC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAGGATGCTTGAAGGTCTACCAGTTCAGTAGTGATAACCATTGCTTTCTAAGTCTCGG / / / // / / | Hpy178III* MaeIII || | CviJI BccI || HgiJII* || SduI |Hpy188I HinfI TfiI K S Y E L P D G Q V I T I G N E R F R A N P T N F Q M V K S S L L V T K D S E P I L R T S R W S S H H Y W * R K I Q S P ----:----|----:----|----:----|----:----|----:----|----:----| F D * S S G S P * T M V I P L S L N L A F I R R V E L H D L * * * Q Y R F I * L F G V F K W I T L D D S N T V F S E S G FokI | MwoI | |HindIII | || AluI | || CviJI TfiI Cfr10I | || | SetI BseGI BccI Hin4II* HinfI |HpaII \ \\ \ \ \ \ \ \ \\ CCAGAAGCTTTGTTCCATCCTTCTGTTTTGGGTTTGGAATCTGCCGGTATTGACCAAACT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| GGTCTTCGAAACAAGGTAGGAAGACAAAACCCAAACCTTAGACGGCCATAACTGGTTTGA / /// / / / / / // | ||| | BseGI | Hin4II* HinfI |Cfr10I | ||| HindIII BccI TfiI HpaII | ||CviJI | ||AluI | |FokI | SetI MwoI P E A L F H P S V L G L E S A G I D Q T Q K L C S I L L F W V W N L P V L T K L R S F V P S F C F G F G I C R Y * P N Y ----:----|----:----|----:----|----:----|----:----|----:----| G S A K N W G E T K P K S D A P I S W V G L L K T G D K Q K P N P I Q R Y Q G F W F S Q E M R R N Q T Q F R G T N V L S FatI BspHI |CviAII |Hpy178III* || TspGWI || NlaIII | TaqI MaeIII || |BccI | | TspDTI TspEI Tsp4CI* \\ \\ \ \ \ \ \ ACTTACAACTCCATCATGAAGTGTGATGTCGATGTCCGTAAGGAATTATACGGTAACATC 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TGAATGTTGAGGTAGTACTTCACACTACAGCTACAGGCATTCCTTAATATGCCATTGTAG / // / / / / / / / | || | | | TaqI | | MaeIII | || | | TspDTI | Tsp4CI* | || | TspGWI TspEI | || BccI | |BspHI | |FatI | Hpy178III* | CviAII NlaIII T Y N S I M K C D V D V R K E L Y G N I L T T P S * S V M S M S V R N Y T V T S L Q L H H E V * C R C P * G I I R * H R ----:----|----:----|----:----|----:----|----:----|----:----| V * L E M M F H S T S T R L S N Y P L M * K C S W * S T H H R H G Y P I I R Y C S V V G D H L T I D I D T L F * V T V D BetI* |HpaII || Acc65I || HgiCI* || |Csp6I || ||RsaI || ||NlaIV || ||| KpnI || ||| | FatI || ||| | |CviAII || ||| | || NlaIII || ||| | || | BssKI || ||| | || | SecI* || ||| | || | EcoRII || ||| | || | | ScrFI CviRI* || ||| | || | | BseBI | BsmI MslI || ||| | || | | | SetI | |HphI \ \\ \\\ \ \\ \ \ \ \ \ \\ GTTATGTCCGGTGGTACCACCATGTTCCCAGGTATTGCCGAAAGAATGCAAAAGGAAATC 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CAATACAGGCCACCATGGTGGTACAAGGGTCCATAACGGCTTTCTTACGTTTTCCTTTAG / // / /// / // //// / / MslI || | ||| | |FatI |||EcoRII | HphI || | ||| | | |||BssKI CviRI* || | ||| | | ||SecI* BsmI || | ||| | | |BseBI || | ||| | | |ScrFI || | ||| | | SetI || | ||| | CviAII || | ||| NlaIII || | ||HgiCI* || | ||Acc65I || | |Csp6I || | NlaIV || | RsaI || KpnI |BetI* HpaII V M S G G T T M F P G I A E R M Q K E I L C P V V P P C S Q V L P K E C K R K S Y V R W Y H H V P R Y C R K N A K G N H ----:----|----:----|----:----|----:----|----:----|----:----| T I D P P V V M N G P I A S L I C F S I R * T R H Y W W T G L Y Q R F F A F P F N H G T T G G H E W T N G F S H L L F D Hin4II* | FatI | |BccI | |CviAII | || Hin4I | || NlaIII | || | GsuI | || | SetI Hpy178III* | || | Eco57MI | TspGWI | || | |Hpy178III* | | MnlI | || | || MboI | | | TatI | || | || BseRI | | | Hin4I | || | || | DpnI | | | |Csp6I MboII | || | || | |BsrDI | | | ||RsaI | CviJI | || | || | |BstKTI | | | ||ScaI AciI | |NlaIV | || | || | || TspDTI | | | ||| AloI \ \ \\ \ \\ \ \\ \ \\ \ \ \ \ \\\ \ ACCGCTTTGGCTCCATCTTCCATGAAGGTCAAGATCATTGCTCCTCCAGAAAGAAAGTAC 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| TGGCGAAACCGAGGTAGAAGGTACTTCCAGTTCTAGTAACGAGGAGGTCTTTCTTTCATG / / // / // //// / / ///// // // / /// | | |NlaIV | || |||| | | ||||MboI || || | ||TatI | | CviJI | || |||| | | |||TspDTI || || | |Csp6I | MboII | || |||| | | ||DpnI || || | ScaI AciI | || |||| | | |BstKTI || || | RsaI | || |||| | | |BsrDI || || AloI | || |||| | | Hpy178III* || |MnlI | || |||| | BseRI || Hin4I | || |||| Eco57MI |TspGWI | || |||| GsuI Hpy178III* | || |||SetI | || ||FatI | || |CviAII | || BccI | |NlaIII | Hin4I Hin4II* T A L A P S S M K V K I I A P P E R K Y P L W L H L P * R S R S L L L Q K E S T R F G S I F H E G Q D H C S S R K K V L ----:----|----:----|----:----|----:----|----:----|----:----| V A K A G D E M F T L I M A G G S L F Y * R K P E M K W S P * S * Q E E L F F T G S Q S W R G H L D L D N S R W F S L V Hin4II* | MboI CviJI | XhoII | AloI | | DpnI Hpy178III* | | CspCI SetI | | |BstKTI \ \ \ \ \ \ \ \\ TCCGTCTGGATTGGTGGTTCTATCTTGGCTTCTTTGACTACCTTCCAACAAATGTGGATC 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCAGACCTAACCACCAAGATAGAACCGAAGAAACTGATGGAAGGTTGTTTACACCTAG / // / / / // / Hpy178III* || CspCI SetI | || XhoII |CviJI | || MboI AloI | |DpnI | BstKTI Hin4II* S V W I G G S I L A S L T T F Q Q M W I P S G L V V L S W L L * L P S N K C G S R L D W W F Y L G F F D Y L P T N V D L ----:----|----:----|----:----|----:----|----:----|----:----| E T Q I P P E I K A E K V V K W C I H I S R R S Q H N * R P K K S * R G V F T S G D P N T T R D Q S R Q S G E L L H P D Hpy99I | AsuI* BinI* | AvaII | MmeI | |BmgT120I BccI | CspCI | || HphI | Hpy166II \ \ \ \\ \ \ \ TCAAAACAAGAATACGACGAAAGTGGTCCATCTATCGTTCACCACAAGTGTTTCTAA 1390 1400 1410 1420 1430 ----:----|----:----|----:----|----:----|----:----|----:-- AGTTTTGTTCTTATGCTGCTTTCACCAGGTAGATAGCAAGTGGTGTTCACAAAGATT / / / // / / / | CspCI Hpy99I || HphI | Hpy166II | MmeI |AvaII BccI BinI* |AsuI* BmgT120I S K Q E Y D E S G P S I V H H K C F * Q N K N T T K V V H L S F T T S V S X K T R I R R K W S I Y R S P Q V F L X ----:----|----:----|----:----|----:----|----:----|----:-- E F C S Y S S L P G D I T * W L H K * R L V L I R R F H D M * R E G C T N R * F L F V V F T T W R D N V V L T E L # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 1 FblI,XmiI AciI 2 BspACI,SsiI AclI 1 Psp1406I AlfI 2 AloI 1 AluI 3 AluBI ApoI 1 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AsuII 1 Bpu14I,Bsp119I,BspT104I,BstBI,Csp45I,NspV,SfuI AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BaeI 1 BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 9 Bce83I* 1 BpuEI BceAI 1 BdaI 2 BetI* 3 BsaWI BfiI 1 BmrI,BmuI BglII 2 BinI* 1 AlwI,BspPI,AclWI BisI 2 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 2 BmeT110I 1 BmgT120I 2 BsaBI 1 Bse8I,BseJI BsaXI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseRI 2 BsiI* 1 BssSI,Bst2BI,BauI BslFI 2 BsmFI,FaqI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI BspHI 1 CciI,PagI,RcaI BsrDI 1 BseMI,Bse3DI BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 5 BtrI 1 BmgBI,AjiI BtsI 1 Cac8I 1 BstC8I Cfr10I 4 BsrFI,BssAI,Bse118I CfrI 1 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CspCI 1 CviAII 5 CviJI 11 CviKI-1 CviRI* 4 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 5 MalI Eco47III 1 Aor51HI,AfeI Eco57I 1 AcuI Eco57MI 2 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI FatI 5 FokI 3 GlaI 1 GsuI 1 BpmI HaeII 1 BstH2I HaeIII 1 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 5 HpyAV Hin6I 1 HinP1I,HspAI HindIII 1 HinfI 7 HpaII 7 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 3 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 1 Hpy99I 5 KpnI 1 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 7 HpyCH4IV MaeIII 10 MboI 5 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 9 MfeI 3 MunI MlyI 2 SchI MmeI 1 MnlI 6 MseI 1 Tru1I,Tru9I MslI 1 RseI,SmiMI MwoI 3 HpyF10VI,BstMWI NlaIII 5 Hin1II,Hsp92II,FaeI NlaIV 3 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PleI 2 PpsI RsaI 4 AfaI ScaI 1 BmcAI,AssI,ZrmI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 20 SfaNI 1 LweI SmlI 2 SmoI SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaiI 7 TaqI 5 TatI 3 TfiI 5 PfeI TseI 2 ApeKI TsoI 3 Tsp45I 3 NmuCI Tsp4CI* 6 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 10 TasI,Tsp509I,Sse9I TspGWI 3 TspRI 1 TscAI XcmI 1 XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XhoII 3 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AcyI AflII AflIII AgeI AhaIII* AjuI AlwNI ApaI ApaLI AscI AvrII BalI BamHI BarI BbvCI BcgI BciVI BclI BglI BmtI BplI Bpu10I BsaAI BseMII BsePI BseSI BseYI BsgI BsiYI* Bsp120I Bsp1407I BspCNI BspLU11I* BspMI BspMII* BspOI BsrBI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI CauII* Cfr9I DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FauI FnuDII* FseI FspAI GsaI HgiAI* HindII HpaI KasI MauBI McrI* MluI Mph1103I MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI SauI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaqII TauI TspMI TstI Tth111I VspI XbaI XmaCI XmaI XmaIII* XmnI ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769