Restriction Map of HAC1/YFL031W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

HAC1/YFL031W on chromosome VI from coordinates 75179 to 76147.


SpeI |MaeI TsoI || TspEI | TaqI CviJI \\ \ \ \ \ ATGGAAATGACTGATTTTGAACTAACTAGTAATTCGCAATCGAACTTGGCTATCCCTACC 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCTTTACTGACTAAAACTTGATTGATCATTAAGCGTTAGCTTGAACCGATAGGGATGG // // / / / / |SpeI |TsoI TaqI CviJI | BsaXI MaeI TspEI Hin4I M E M T D F E L T S N S Q S N L A I P T W K * L I L N * L V I R N R T W L S L P G N D * F * T N * * F A I E L G Y P Y Q ----:----|----:----|----:----|----:----|----:----|----:----| X S I V S K S S V L L E C D F K A I G V X P F S Q N Q V L * Y N A I S S P * G * H F H S I K F * S T I R L R V Q S D R G BsaXI Hin4I | MlyI | PleI | | SalI | | |TaqI MnlI | | |AccI | BsaXI | | ||HindII | |CviJI | | ||Hpy166II StyI | ||Hin4I | | |||HinfI SecI* | ||| MnlI Hin4II* \ \ \\\\ \ \ \\\ \ \ AACTTCAAGTCGACTCTGCCTCCAAGGAAAAGAGCCAAGACAAAAGAGGAAAAGGAACAG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAAGTTCAGCTGAGACGGAGGTTCCTTTTCTCGGTTCTGTTTTCTCCTTTTCCTTGTC // /// / / / / / / / || ||| HinfI | | | | MnlI Hin4II* || ||SalI | | | CviJI || |AccI | | Hin4I || |TaqI | | BsaXI || Hpy166II | MnlI || HindII SecI* |PleI StyI MlyI N F K S T L P P R K R A K T K E E K E Q T S S R L C L Q G K E P R Q K R K R N S L Q V D S A S K E K S Q D K R G K G T A ----:----|----:----|----:----|----:----|----:----|----:----| L K L D V R G G L F L A L V F S S F S C W S * T S E A E L S F L W S L L P F P V V E L R S Q R W P F S G L C F L F L F L BbvI | SapI | Ksp632I* | | HphI | | | TseI MboI | | | AluI | DpnI | | | CviJI | |TaqI | | | |BisI | |BstKTI | | | ||BlsI | || BinI* | | | ||SetI MboII \ \\ \ \ \ \ \\\ \ CGAAGGATCGAGCGTATTTTGAGAAACAGAAGAGCTGCTCACCAGAGCAGAGAGAAAAAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GCTTCCTAGCTCGCATAAAACTCTTTGTCTTCTCGACGAGTGGTCTCGTCTCTCTTTTTT // // / / / / / //// / || || BinI* | | | | |||| MboII || |TaqI | | | | |||TseI || MboI | | | | ||BisI |DpnI | | | | |BlsI BstKTI | | | | CviJI | | | | AluI | | | SetI | | HphI | Ksp632I* | SapI BbvI R R I E R I L R N R R A A H Q S R E K K E G S S V F * E T E E L L T R A E R K K K D R A Y F E K Q K S C S P E Q R E K K ----:----|----:----|----:----|----:----|----:----|----:----| R L I S R I K L F L L A A * W L L S F F A F S R A Y K S F C F L Q E G S C L S F S P D L T N Q S V S S S S V L A S L F F SfeI* | CviRI* | | PstI | | |PpiI | | || AvaI | | || XhoI | | || SmlI BdaI | | || Hpy178III* BdaI | | || |TaqI | ApoI | | || |BmeT110I | TspEI | | || ||Hpy178III* | | PpiI | | || ||| XmnI | | |HgaI \ \ \\ \\\ \ \ \ \\ AGACTACATCTGCAGTATCTCGAGAGAAAATGTTCTCTTTTGGAAAATTTACTGAACAGC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGATGTAGACGTCATAGAGCTCTCTTTTACAAGAGAAAACCTTTTAAATGACTTGTCG / / / /// / / / / / | | SfeI* ||| XmnI | PpiI | HgaI | CviRI* ||Hpy178III* BdaI TspEI PstI ||SmlI BdaI ApoI PpiI ||XhoI ||AvaI |BmeT110I |TaqI Hpy178III* R L H L Q Y L E R K C S L L E N L L N S D Y I C S I S R E N V L F W K I Y * T A T T S A V S R E K M F S F G K F T E Q R ----:----|----:----|----:----|----:----|----:----|----:----| L S C R C Y R S L F H E R K S F K S F L F V V D A T D R S F I N E K P F N V S C S * M Q L I E L S F T R K Q F I * Q V A MluI AflIII | FnuDII* | |BbvII* | || HindII | || Hpy166II | || | HgaI | || | MboII | || | | TseI BdaI | || | | CviRI* HindII BdaI | || | | |BisI Hpy166II | CviJI | || | | ||BlsI Hpy99I | SetI | |BsrI | || | | |||CviJI |BbvI \ \ \ \\ \ \\ \ \ \\\\ \\ GTCAACCTTGAAAAACTGGCTGACCACGAAGACGCGTTGACTTGCAGCCACGACGCTTTT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CAGTTGGAACTTTTTGACCGACTGGTGCTTCTGCGCAACTGAACGTCGGTGCTGCGAAAA // / // / / // //// / / / |SetI | |CviJI | | || |||| Hpy99I | BbvI Hpy166II | BsrI | | || |||CviJI MwoI HindII BdaI | | || |||TseI BdaI | | || ||BisI | | || |HgaI | | || |BlsI | | || CviRI* | | |BbvII* | | |MboII | | Hpy166II | | HindII | AflIII | MluI FnuDII* V N L E K L A D H E D A L T C S H D A F S T L K N W L T T K T R * L A A T T L L Q P * K T G * P R R R V D L Q P R R F C ----:----|----:----|----:----|----:----|----:----|----:----| T L R S F S A S W S S A N V Q L W S A K R * G Q F V P Q G R L R T S K C G R R K D V K F F Q S V V F V R Q S A A V V S K Hpy178III* | MnlI | | BsiI* | | |SduI BsrI | | |HgiAI* TspRI | | || MwoI | BssKI Hpy178III* | | || | Hin6I | EcoRII | TatI | | || | |GlaI | |SecI* MwoI | |Csp6I | | || | ||HhaI | ||ScrFI HgaI | ||RsaI | | || | |||HaeII | ||BseBI \ \ \\\ \ \ \\ \ \\\\ \ \\\ GTTGCTTCTCTTGACGAGTACAGGGATTTCCAGAGCACGAGGGGCGCTTCACTGGACACC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CAACGAAGAGAACTGCTCATGTCCCTAAAGGTCTCGTGCTCCCCGCGAAGTGACCTGTGG / / /// /// / / ///// / HgaI | ||TatI ||| | | ||||TspRI BsrI | |Csp6I ||| | | |||Hin6I | RsaI ||| | | ||GlaI Hpy178III* ||| | | |HhaI ||| | | HaeII ||| | BsiI* ||| MwoI ||HgiAI* ||SduI |Hpy178III* MnlI V A S L D E Y R D F Q S T R G A S L D T L L L L T S T G I S R A R G A L H W T P C F S * R V Q G F P E H E G R F T G H Q ----:----|----:----|----:----|----:----|----:----|----:----| T A E R S S Y L S K W L V L P A E S S V Q Q K E Q R T C P N G S C S P R K V P C N S R K V L V P I E L A R P A S * Q V G SetI Hpy99I | Hpy188I | Hpy188I | Hin4II* | | MaeII | | TatI AsuI* | | | SetI | | Tsp4CI* |BmgT120I | | | TaiI | | Bsp1407I ||CviJI | | | |HphI | | |MnlI ||HaeIII | | | |Hpy166II | | |Csp6I |||BsrI | | | || SetI | | ||RsaI \\\\ \ \ \ \\ \ \ \ \\\ AGGGCCAGTTCGCACTCGTCGTCTGATACGTTCACACCTTCACCTCTGAACTGTACAATG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TCCCGGTCAAGCGTGAGCAGCAGACTATGCAAGTGTGGAAGTGGAGACTTGACATGTTAC / /// / / / /// / / / // /// | ||AsuI* Hpy99I | | ||| SetI SetI | || ||Bsp1407I | |BmgT120I | | ||Hpy166II | || ||TatI | |HaeIII | | |HphI | || |Csp6I | |CviJI | | MaeII | || RsaI | EcoRII | TaiI | |MnlI | BssKI | SetI | Tsp4CI* | SecI* Hpy188I Hin4II* | BsrI Hpy188I BseBI ScrFI R A S S H S S S D T F T P S P L N C T M G P V R T R R L I R S H L H L * T V Q W G Q F A L V V * Y V H T F T S E L Y N G ----:----|----:----|----:----|----:----|----:----|----:----| L A L E C E D D S V N V G E G R F Q V I W P W N A S T T Q Y T * V K V E S S Y L P G T R V R R R I R E C R * R Q V T C H MmeI | Hin4I | Hin4I | | HgaI | | |Hin6I | | ||GlaI | | |||HhaI | | |||FnuDII* | | |||| TfiI | | |||| HinfI | | |||| | AciI | | |||| | | FnuDII* | | |||| | | | AsuI* | | |||| | | | AvaII | | |||| | | | Hpy99I | | |||| | | | Hpy188I | | |||| | | | |BsmAI | | |||| | | | |BmgT120I | | |||| | | | ||TspDTI | | |||| | | | ||| BbvI | | |||| | | | ||| | Hin4I NlaIV | | |||| | | | ||| | Hin4I |CviJI | | |||| | | | ||| | |FatI || Cac8I Tth111I | | |||| | | | ||| | ||CviAII \\ \ \ \ \ \\\\ \ \ \ \\\ \ \\\ GAGCCTGCGACTTTGTCGCCCAAGAGTATGCGCGATTCCGCGTCGGACCAAGAGACTTCA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGGACGCTGAAACAGCGGGTTCTCATACGCGCTAAGGCGCAGCCTGGTTCTCTGAAGT // / / // /// / / / // // / / // || Cac8I | |MmeI ||| | | | || || | | |NlaIII |CviJI | Hin4I ||| | | | || || | | BbvI NlaIV | Hin4I ||| | | | || || | Hin4I Tth111I ||| | | | || || | Hin4I ||| | | | || || BsmAI ||| | | | || |AvaII ||| | | | || |AsuI* ||| | | | || BmgT120I ||| | | | |TspDTI ||| | | | Hpy188I ||| | | FnuDII* ||| | | Hpy99I ||| | | AciI ||| | HinfI ||| | TfiI ||| HgaI ||FnuDII* ||Hin6I |GlaI HhaI E P A T L S P K S M R D S A S D Q E T S S L R L C R P R V C A I P R R T K R L H A C D F V A Q E Y A R F R V G P R D F M ----:----|----:----|----:----|----:----|----:----|----:----| S G A V K D G L L I R S E A D S W S V E P A Q S K T A W S Y A R N R T P G L S K L R R S Q R G L T H A I G R R V L L S * HinfI TspGWI | SalI | |TaqI NlaIII | |AccI | TseI | |BceAI | AluI | ||HindII | CviJI | ||Hpy166II | |BisI | ||| PleI | |SfeI* | ||| Hpy99I | ||BlsI | ||| |MlyI | ||SetI | ||| || Hpy99I AccI | |||CviRI* Csp6I | ||| || | SetI |BspMI | |||| PstI MseI |RsaI | ||| || | HgaI |Hpy166II \ \\\\ \ \ \\ \ \\\ \\ \ \ \\ TGGGAGCTGCAGATGTTTAAGACGGAAAATGTACCAGAGTCGACGACGCTACCTGCCGTA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ACCCTCGACGTCTACAAATTCTGCCTTTTACATGGTCTCAGCTGCTGCGATGGACGGCAT // / //// / / // / //// / / // || | |||| SfeI* MseI || | |||| | SetI |Hpy166II || | |||CviRI* || | |||| PleI HgaI || | |||TseI || | |||| MlyI || | ||BisI || | |||Hpy99I || | |BlsI || | |||SalI || | |PstI || | ||BceAI || | CviJI || | ||AccI || | AluI || | ||TaqI || SetI || | |Hpy166II |FatI || | |HindII CviAII || | Hpy99I || | HinfI || TspGWI |Csp6I RsaI W E L Q M F K T E N V P E S T T L P A V G S C R C L R R K M Y Q S R R R Y L P * G A A D V * D G K C T R V D D A T C R R ----:----|----:----|----:----|----:----|----:----|----:----| H S S C I N L V S F T G S D V V S G A T M P A A S T * S P F H V L T S S A V Q R P L Q L H K L R F I Y W L R R R * R G Y SfaNI BceAI CviJI FauI TspEI | AciI HaeIII MnlI |Hpy99I \ \ \ \ \ \\ GACAACAACAATTTGTTTGATGCGGTGGCCTCGCCGTTGGCAGACCCACTCTGCGACGAT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| CTGTTGTTGTTAAACAAACTACGCCACCGGAGCGGCAACCGTCTGGGTGAGACGCTGCTA / / / / / / / / / | BspMI TspEI | | HaeIII MnlI | FauI AccI SfaNI | | CviJI Hpy99I | AciI BceAI D N N N L F D A V A S P L A D P L C D D T T T I C L M R W P R R W Q T H S A T I Q Q Q F V * C G G L A V G R P T L R R Y ----:----|----:----|----:----|----:----|----:----|----:----| S L L L K N S A T A E G N A S G S Q S S L C C C N T Q H P P R A T P L G V R R R V V V I Q K I R H G R R Q C V W E A V I TspEI | MfeI | TspEI | | MboI | | | DpnI | | | |BstKTI | | | ||Hpy178III* Tsp4CI* | | | ||| MfeI | AccI | | | ||| TspEI AciI | |Hpy166II | | | ||| |BceAI \ \ \\ \ \ \ \\\ \\ ATAGCGGGAAACAGTCTACCCTTTGACAATTCAATTGATCTTGACAATTGGCGTAATCCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TATCGCCCTTTGTCAGATGGGAAACTGTTAAGTTAACTAGAACTGTTAACCGCATTAGGT / / // / /// / / // AciI | |AccI | ||| | | |TspEI | Hpy166II | ||| | | |MfeI Tsp4CI* | ||| | | BceAI | ||| | Hpy178III* | ||| MboI | ||DpnI | |BstKTI | TspEI | MfeI TspEI I A G N S L P F D N S I D L D N W R N P * R E T V Y P L T I Q L I L T I G V I Q S G K Q S T L * Q F N * S * Q L A * S S ----:----|----:----|----:----|----:----|----:----|----:----| I A P F L R G K S L E I S R S L Q R L G Y L P F C D V R Q C N L Q D Q C N A Y D Y R S V T * G K V I * N I K V I P T I W MaeI | CviJI | | BseYI BssKI SfeI* | | | AluI EcoRII | Tsp4CI* | | | GsaI | ScrFI | | Hpy166II | | | CviJI CviJI | BseBI | | | TspRI | | | | SetI \ \ \ \ \ \ \ \ \ \ \ \ GCCGTGATTACGATGACCAGGAAACTACAGTGAACAAGAACACTAGCCCCAGCTTTTGCT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CGGCACTAATGCTACTGGTCCTTTGATGTCACTTGTTCTTGTGATCGGGGTCGAAAACGA / / / / // / // / / / CviJI | | | || Hpy166II || | | BseYI | | | |SfeI* || | | CviJI | | | Tsp4CI* || | | AluI | | TspRI || | SetI | EcoRII || GsaI | BssKI |CviJI BseBI MaeI ScrFI A V I T M T R K L Q * T R T L A P A F A P * L R * P G N Y S E Q E H * P Q L L L R D Y D D Q E T T V N K N T S P S F C F ----:----|----:----|----:----|----:----|----:----|----:----| A T I V I V L F S C H V L V S A G A K A L R S * S S W S V V T F L F V L G L K Q G H N R H G P F * L S C S C * G W S K S NlaIV |CviJI Hpy188I |Cfr10I BccI |MnlI ||HpaII \ \\ \\\ TTCTGCTTTTTTTCTTTTTTTTTTTTTTTAGTCGTGGTTCTCTGATGGGGGAGGAGCCGG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| AAGACGAAAAAAAGAAAAAAAAAAAAAAATCAGCACCAAGAGACTACCCCCTCCTCGGCC / // // // | |MnlI || |Cfr10I | Hpy188I || HpaII BccI |CviJI NlaIV F C F F S F F F F L V V V L * W G R S R S A F F L F F F F * S W F S D G G G A G L L F F F F F F F S R G S L M G E E P V ----:----|----:----|----:----|----:----|----:----|----:----| K Q K K E K K K K K T T T R Q H P L L R K R S K K K K K K K L R P E R I P S S G E A K K R K K K K * D H N E S P P P A P Csp6I HindIII BseRI Hin4II* | AluI |RsaI | CviRI* | CviJI MseI || SetI | | BsmI | | SetI \ \\ \ \ \ \ \ \ \ TTAAAGTACCTTCAAAAGCAGAATGCAGGGTTATTGGAAGCTTTCTTTTTTTCTTTTATG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| AATTTCATGGAAGTTTTCGTCTTACGTCCCAATAACCTTCGAAAGAAAAAAAGAAAATAC // // / / / / / || |Csp6I | CviRI* | | HindIII || RsaI | BsmI | CviJI || SetI Hin4II* | AluI |BseRI SetI MseI L K Y L Q K Q N A G L L E A F F F S F M * S T F K S R M Q G Y W K L S F F L L C K V P S K A E C R V I G S F L F F F Y A ----:----|----:----|----:----|----:----|----:----|----:----| N F Y R * F C F A P N N S A K K K E K I T L T G E F A S H L T I P L K R K K K * * L V K L L L I C P * Q F S E K K R K H CviJI MaeI Hpy178III* CviJI DdeI | Cac8I \ \ \ \ \ \ CTAGTTTTTCCTGAACAAATAGAGCCATTCTTTTCTTATTACTAAGAAATGGACGGCTTG 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GATCAAAAAGGACTTGTTTATCTCGGTAAGAAAAGAATAATGATTCTTTACCTGCCGAAC / / / / / / MaeI Hpy178III* CviJI DdeI | Cac8I CviJI L V F P E Q I E P F F S Y Y * E M D G L * F F L N K * S H S F L I T K K W T A C S F S * T N R A I L F L L L R N G R L A ----:----|----:----|----:----|----:----|----:----|----:----| S T K G S C I S G N K E * * * S I S P K A L K E Q V F L A M R K K N S L F P R S * N K R F L Y L W E K R I V L F H V A Q TatI |Csp6I ||RsaI ||| Tsp4CI* ||| |BceAI TspDTI TspEI ||| || Hpy188I | SetI | MboII ||| || | Hin6I | | ApoI | TspDTI ||| || | |GlaI | | TspEI | | XmnI ||| || | ||HhaI | | EcoRI | | | TspDTI \\\ \\ \ \\\ \ \ \ \ \ \ \ CTTGTACTGTCCGAAGCGCAGTCAGGTTTGAATTCATTTGAATTGAATGATTTCTTCATC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| GAACATGACAGGCTTCGCGTCAGTCCAAACTTAAGTAAACTTAACTTACTAAAGAAGTAG /// / /// / / / // / / ||| | ||| | SetI EcoRI || | TspDTI ||| | ||| TspDTI TspEI || XmnI ||| | ||Hin6I ApoI |TspEI ||| | |GlaI |MboII ||| | HhaI TspDTI ||| Hpy188I ||| BceAI ||Tsp4CI* ||TatI |Csp6I RsaI L V L S E A Q S G L N S F E L N D F F I L Y C P K R S Q V * I H L N * M I S S S C T V R S A V R F E F I * I E * F L H H ----:----|----:----|----:----|----:----|----:----|----:----| S T S D S A C D P K F E N S N F S K K M A Q V T R L A T L N S N M Q I S H N R * K Y Q G F R L * T Q I * K F Q I I E E D FatI BspHI |CviAII |Hpy178III* || NlaIII \\ \ ACTTCATGA ----:---- TGAAGTACT / // | |BspHI | |FatI | Hpy178III* | CviAII NlaIII T S * L H X F M X ----:---- V E H * K M S * S # Enzymes that cut Frequency Isoschizomers AccI 4 FblI,XmiI AciI 3 BspACI,SsiI AflIII 1 AluI 4 AluBI ApoI 2 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaI 1 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 1 Bme18I,Eco47I,SinI,VpaK11BI BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 1 BceAI 4 BdaI 2 BinI* 1 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 1 BmgT120I 2 BsaXI 1 BseBI 2 Bst2UI,BstNI,BstOI,MvaI BseRI 1 BseYI 1 BsiI* 1 BssSI,Bst2BI,BauI BsmAI 1 Alw26I,BstMAI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BsrI 3 BseNI,Bse1I,BsrSI BssKI 2 BstSCI,StyD4I BstKTI 2 Cac8I 2 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I Csp6I 5 CviQI,RsaNI CviAII 2 CviJI 16 CviKI-1 CviRI* 4 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI EcoRI 1 EcoRII 2 AjnI,Psp6I,PspGI FatI 2 FauI 1 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII GlaI 3 GsaI 1 HaeII 1 BstH2I HaeIII 2 BsnI,BsuRI,BshFI,PhoI HgaI 5 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HhaI 3 BstHHI,CfoI,AspLEI Hin4I 3 Hin4II* 3 HpyAV Hin6I 3 HinP1I,HspAI HindII 4 HincII HindIII 1 HinfI 3 HpaII 1 HapII,BsiSI,MspI HphI 2 AsuHPI Hpy166II 8 Hpy8I Hpy178III* 7 Hpy188III Hpy188I 5 Hpy99I 6 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 3 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 3 MfeI 2 MunI MluI 1 MlyI 2 SchI MmeI 1 MnlI 6 MseI 2 Tru1I,Tru9I MwoI 2 HpyF10VI,BstMWI NlaIII 2 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I PleI 2 PpsI PpiI 1 PstI 2 RsaI 5 AfaI SalI 2 SapI 1 LguI,PciSI,BspQI ScrFI 2 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 2 BseDI,BssECI,BsaJI SetI 11 SfaNI 1 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 1 SmoI SpeI 1 BcuI,AhlI StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 1 TaqI 5 TatI 3 TfiI 1 PfeI TseI 3 ApeKI TsoI 1 Tsp4CI* 4 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 8 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI Tth111I 1 PflFI,PsyI,AspI XhoI 1 Sfr274I,SlaI,StrI,TliI,PaeR7I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuII AvrII BaeI BalI BamHI BarI BbvCI Bce83I* BcgI BciVI BclI BetI* BfiI BglI BglII BmtI BplI Bpu10I BsaAI BsaBI BseGI BseMII BsePI BseSI BsgI BsiYI* BslFI BsmFI Bsp120I BspCNI BspLU11I* BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstF5I BstXI BstZ17I BtgZI BtrI BtsCI BtsI CauII* Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I EciI Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FokI FseI FspAI GsuI HgiCI* HgiJII* HpaI KasI KpnI MaeIII MauBI McrI* Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpuMI PshAI PsiI PspOMI PspXI PsrI PvuI PvuII RsrII SacI SacII SanDI SauI* ScaI SexAI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SphI SplI* SrfI Sse232I* Sse8387I SspI StuI SwaI TaqII TauI Tsp45I TspMI TstI VspI XbaI XcmI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769