Restriction Map of CCA1/YER168C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

CCA1/YER168C on chromosome V from coordinates 522669 to 521029.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.19309

EMBOSS_001 TseI |BisI BspCNI ||BlsI |BseMII Tsp4CI* ||| DdeI || ApoI | AccI ||| | TspDTI || TspEI | |Hpy166II BbvI ||| | |Hpy188I || EcoRI \ \\ \ \\\ \ \\ \\ \ ATGCTACGGTCTACTATATCTCTACTGATGAATAGTGCTGCTCAGAAAACGATGACGAAT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGATGCCAGATGATATAGAGATGACTACTTATCACGACGAGTCTTTTGCTACTGCTTA / // / //// // // | |AccI BbvI |||| |DdeI |BseMII | Hpy166II |||| Hpy188I BspCNI Tsp4CI* |||TspDTI ||TseI |BisI BlsI M L R S T I S L L M N S A A Q K T M T N C Y G L L Y L Y * * I V L L R K R * R I A T V Y Y I S T D E * C C S E N D D E F ----:----|----:----|----:----|----:----|----:----|----:----| X S R D V I D R S I F L A A * F V I V F X A V T * * I E V S S Y H Q E S F S S S H * P R S Y R * Q H I T S S L F R H R I MseI CviRI* SetI TspEI | HphI | TaqII TsoI MaeIII \ \ \ \ \ \ \ TCTAATTTTGTTCTAAATGCACCCAAAATCACCTTAACCAAAGTGGAACAGAACATCTGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AGATTAAAACAAGATTTACGTGGGTTTTAGTGGAATTGGTTTCACCTTGTCTTGTAGACA / / // / / / / EcoRI TspEI |HphI | | MseI TsoI TspEI CviRI* | TaqII ApoI SetI S N F V L N A P K I T L T K V E Q N I C L I L F * M H P K S P * P K W N R T S V * F C S K C T Q N H L N Q S G T E H L * ----:----|----:----|----:----|----:----|----:----|----:----| E L K T R F A G L I V K V L T S C F M Q N * N Q E L H V W F * R L W L P V S C R R I K N * I C G F D G * G F H F L V D T Csp6I |RsaI || BseMII || |BspCNI || || CviJI || || | DdeI || || | Bpu10I TatI || || | | MlyI Bsp1407I || || | | PleI |Csp6I || || | | CviJI ||RsaI || || | | |MboII \\\ \\ \\ \ \ \\ AACTTGCTGAACGATTATACAGACTTGTACAATCAAAAGTACCACAATAAGCCTGAGCCA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAACGACTTGCTAATATGTCTGAACATGTTAGTTTTCATGGTGTTATTCGGACTCGGT / /// //// / /// MaeIII ||Bsp1407I |||BspCNI | ||PleI ||TatI ||BseMII | |CviJI |Csp6I |Csp6I | |MboII RsaI RsaI | |MlyI | Bpu10I | DdeI CviJI N L L N D Y T D L Y N Q K Y H N K P E P T C * T I I Q T C T I K S T T I S L S H L A E R L Y R L V Q S K V P Q * A * A I ----:----|----:----|----:----|----:----|----:----|----:----| L K S F S * V S K Y L * F Y W L L G S G Y S A S R N Y L S T C D F T G C Y A Q A V Q Q V I I C V Q V I L L V V I L R L W BseGI MboI | MaeIII Hpy188I | Tsp45I Ksp632I* | | FokI | DpnI | | EciI | |BstKTI | | |MwoI | ||TaqII | | ||HindIII | ||| BccI | | ||| AluI SetI | ||| | BinI* | | ||| CviJI | Hpy178III* HinfI | ||| | |AciI | | ||| | SetI | |BslFI \ \ \\\ \ \\ \ \ \\\ \ \ \ \\ TTGACTCTTCGGATCACGGGCGGATGGGTGCGTGACAAGCTTCTGGGACAAGGTTCTCAC 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AACTGAGAAGCCTAGTGCCCGCCTACCCACGCACTGTTCGAAGACCCTGTTCCAAGAGTG / / //// / / / / / // / / / / | | |||| | | | BseGI | || | HindIII SetI Hpy178III* | | |||| | | AciI | || CviJI | | |||| | BinI* | || FokI | | |||| BccI | || AluI | | |||MboI | |SetI | | ||Ksp632I* | Tsp45I | | |TaqII | MaeIII | | |DpnI EciI | | BstKTI MwoI | Hpy188I HinfI L T L R I T G G W V R D K L L G Q G S H * L F G S R A D G C V T S F W D K V L T D S S D H G R M G A * Q A S G T R F S R ----:----|----:----|----:----|----:----|----:----|----:----| N V R R I V P P H T R S L S R P C P E * M S E E S * P R I P A H C A E P V L N E Q S K P D R A S P H T V L K Q S L T R V MslI SetI | BccI | TspEI HphI BsrI \ \ \ \ \ \ GACTTGGATATTGCCATCAATGTGATGTCAGGTGAGCAATTTGCTACTGGTTTGAACGAG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTGAACCTATAACGGTAGTTACACTACAGTCCACTCGTTAAACGATGACCAAACTTGCTC / / / / // / BslFI | BccI SetI |HphI BsrI MslI TspEI D L D I A I N V M S G E Q F A T G L N E T W I L P S M * C Q V S N L L L V * T S L G Y C H Q C D V R * A I C Y W F E R V ----:----|----:----|----:----|----:----|----:----|----:----| S K S I A M L T I D P S C N A V P K F S R S P Y Q W * H S T L H A I Q * Q N S R V Q I N G D I H H * T L L K S S T Q V L NlaIV |CviJI CviRI* || CviJI MnlI \ \\ \ \ TATTTGCAACAACATTACGCCAAATATGGAGCCAAGCCTCATAATATCCACAAGATTGAC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAACGTTGTTGTAATGCGGTTTATACCTCGGTTCGGAGTATTATAGGTGTTCTAACTG / // / / CviRI* || CviJI MnlI |CviJI NlaIV Y L Q Q H Y A K Y G A K P H N I H K I D I C N N I T P N M E P S L I I S T R L T F A T T L R Q I W S Q A S * Y P Q D * Q ----:----|----:----|----:----|----:----|----:----|----:----| Y K C C C * A L Y P A L G * L I W L I S T N A V V N R W I H L W A E Y Y G C S Q I Q L L M V G F I S G L R M I D V L N V TfiI HinfI DdeI | AvaI BstXI | AluI | Hpy178III* |Hpy178III* | CviJI | |BmeT110I || SfaNI | | SetI \ \\ \\ \ \ \ \ AAGAATCCCGAGAAATCCAAGCATCTGGAAACTGCCACTACTAAGCTCTTTGGCGTTGAA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTAGGGCTCTTTAGGTTCGTAGACCTTTGACGGTGATGATTCGAGAAACCGCAACTT / /// / / / /// | ||AvaI BstXI | SfaNI ||CviJI | |BmeT110I Hpy178III* ||AluI | Hpy178III* |DdeI HinfI SetI TfiI K N P E K S K H L E T A T T K L F G V E R I P R N P S I W K L P L L S S L A L K E S R E I Q A S G N C H Y * A L W R * S ----:----|----:----|----:----|----:----|----:----|----:----| L F G S F D L C R S V A V V L S K P T S C S D R S I W A D P F Q W * * A R Q R Q L I G L F G L M Q F S G S S L E K A N F TspEI | MseI | | MboI | | BglII | | XhoII | | | DpnI BciVI | | | |BstKTI | PfoI | | | || Hpy188I | BssKI | | | || | AccI | EcoRII | | | || | |BssNAI | | ScrFI | | | || | |Hpy166II | | BseBI SetI \ \ \ \\ \ \\ \ \ \ \ GTGGATTTTGTCAATTTAAGATCTGAAAAGTATACTGAACTTTCCAGGATACCTAAAGTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTAAAACAGTTAAATTCTAGACTTTTCATATGACTTGAAAGGTCCTATGGATTTCAC / / // / // / / / / | | || Hpy188I |AccI BciVI | | SetI | | || XhoII Hpy166II | EcoRII | | || BglII BssNAI | BssKI | | || MboI | PfoI | | |DpnI BseBI | | BstKTI ScrFI | MseI TspEI V D F V N L R S E K Y T E L S R I P K V W I L S I * D L K S I L N F P G Y L K C G F C Q F K I * K V Y * T F Q D T * S V ----:----|----:----|----:----|----:----|----:----|----:----| T S K T L K L D S F Y V S S E L I G L T L P N Q * N L I Q F T Y Q V K W S V * L H I K D I * S R F L I S F K G P Y R F H BarI | BbvII* | Hin4II* MnlI | |SfaNI | AvaI | ||MseI | |SecI* | ||| HgaI BarI | |BmeT110I | ||| MboII BseGI FokI | TspDTI \ \\ \ \\\ \ \ \ \ \ TGCTTTGGCACACCCGAGGAAGACGCTTTAAGAAGGGATGCTACATTGAACGCTCTTTTC 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| ACGAAACCGTGTGGGCTCCTTCTGCGAAATTCTTCCCTACGATGTAACTTGCGAGAAAAG / //// / // / / / / / MnlI |||BarI | || | BseGI | | TspDTI ||SecI* | || HgaI | FokI |AvaI | |SfaNI BarI BmeT110I | BbvII* | MboII | MseI Hin4II* C F G T P E E D A L R R D A T L N A L F A L A H P R K T L * E G M L H * T L F S L W H T R G R R F K K G C Y I E R S F L ----:----|----:----|----:----|----:----|----:----|----:----| H K P V G S S S A K L L S A V N F A R K T S Q C V R P L R K L F P H * M S R E K A K A C G L F V S * S P I S C Q V S K E SetI | CviRI* | | MboI | | BglII | | XhoII | | | DpnI MslI HphI MnlI | | | |BstKTI | SetI | HphI | MboII | | | ||BccI \ \ \ \ \ \ \ \ \ \\\ TATAACATTCATAAAGGTGAAGTGGAAGATTTCACCAAGAGAGGTCTGCAAGATCTAAAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| ATATTGTAAGTATTTCCACTTCACCTTCTAAAGTGGTTCTCTCCAGACGTTCTAGATTTT / / / / / / / // // / MslI | HphI | | SetI | || || TspGWI SetI HphI | MboII | || |BccI MnlI | || XhoII | || BglII | || MboI | |DpnI | BstKTI CviRI* Y N I H K G E V E D F T K R G L Q D L K I T F I K V K W K I S P R E V C K I * K * H S * R * S G R F H Q E R S A R S K R ----:----|----:----|----:----|----:----|----:----|----:----| * L M * L P S T S S K V L L P R C S R F R Y C E Y L H L P L N * W S L D A L D L I V N M F T F H F I E G L S T Q L I * F BinI* | MboI | | MnlI | | DpnI | | |BseGI | | |BstKTI Csp6I | | || SmlI |RsaI | | || | FokI TspGWI || AciI CviRI* | | || | |MnlI \ \\ \ \ \ \ \\ \ \\ GATGGCGTTCTCCGTACTCCGCTTCCTGCAAAACAAACATTTTTGGATGATCCCTTGAGG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| CTACCGCAAGAGGCATGAGGCGAAGGACGTTTTGTTTGTAAAAACCTACTAGGGAACTCC // / / / // / / || AciI CviRI* | || MboI SmlI |Csp6I | |DpnI MnlI RsaI | BstKTI | BseGI | MnlI BinI* D G V L R T P L P A K Q T F L D D P L R M A F S V L R F L Q N K H F W M I P * G W R S P Y S A S C K T N I F G * S L E G ----:----|----:----|----:----|----:----|----:----|----:----| S P T R R V G S G A F C V N K S S G K L L H R E G Y E A E Q L V F M K P H D R S I A N E T S R K R C F L C K Q I I G Q P BinI* | MboI | XhoII TspGWI | | DpnI | BinI* | | |BetI* | | SetI XbaI | | |BstKTI | | |MboI |MaeI | | |BspMII* | | || DpnI |Hpy178III* | | ||HpaII | | || |BstKTI || TfiI | | ||Hpy178III* | | || ||Bce83I* || HinfI | | ||| BccI \ \ \\ \\\ \\ \ \ \ \\\ \ GTTTTGAGGTTGATCCGTTTTGCTTCTAGATTCAACTTTACCATAGATCCGGAAGTGATG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CAAAACTCCAACTAGGCAAAACGAAGATCTAAGTTGAAATGGTATCTAGGCCTTCACTAC / // // / // / / // / // | || || MboI || HinfI | || | |BspMII* | || |Bce83I* || TfiI | || | |BetI* | || |DpnI |XbaI | || | |BccI | || BstKTI Hpy178III* | || | Hpy178III* | |BinI* MaeI | || | HpaII | SetI | || XhoII TspGWI | || MboI FokI | |DpnI | BstKTI BinI* V L R L I R F A S R F N F T I D P E V M F * G * S V L L L D S T L P * I R K * W F E V D P F C F * I Q L Y H R S G S D G ----:----|----:----|----:----|----:----|----:----|----:----| T K L N I R K A E L N L K V M S G S T I P K S T S G N Q K * I * S * W L D P L S N Q P Q D T K S R S E V K G Y I R F H H BinI* | MboI | | DpnI | | |BstKTI | | || DdeI | | || | Hpy188I | | || | | MseI | | || | | VspI | | || | | | MnlI | | || | | | | BspCNI ApoI | | || | | | | |BsmI TspEI | | || | | | | |CviRI* | XbaI | | || | | | | |BseMII | |MaeI CviJI | | || | | | | || TspEI | |Hpy178III* \ \ \ \\ \ \ \ \ \\ \ \ \\ GCTGAAATGGGCGATCCTCAGATTAATGTTGCATTCAATTCAAAAATTTCTAGAGAGCGA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTTTACCCGCTAGGAGTCTAATTACAACGTAAGTTAAGTTTTTAAAGATCTCTCGCT / / // / // / // / / / // CviJI | || | |DdeI | || CviRI* TspEI | |XbaI | || | | | |BseMII | Hpy178III* | || | | | |BsmI | MaeI | || | | | BspCNI TspEI | || | | MnlI ApoI | || | | VspI | || | | MseI | || | Hpy188I | || MboI | |DpnI | BstKTI BinI* A E M G D P Q I N V A F N S K I S R E R L K W A I L R L M L H S I Q K F L E S E * N G R S S D * C C I Q F K N F * R A S ----:----|----:----|----:----|----:----|----:----|----:----| A S I P S G * I L T A N L E F I E L S R P Q F P R D E S * H Q M * N L F K * L A S F H A I R L N I N C E I * F N R S L S BsiYI* | CviJI | | TseI | | CviRI* | | |BisI | | ||BlsI | | |||AluI | | |||CviJI | | |||PvuII | | |||NspBII* AsuI* | | |||| SetI AvaII | | |||| |TfiI BccI SspI |BmgT120I | | |||| |HinfI \ \ \\ \ \ \\\\ \\ GTTGGTGTGGAGATGGAGAAAATATTAGTAGGACCAACCCCTTTATTGGCTTTGCAGCTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| CAACCACACCTCTACCTCTTTTATAATCATCCTGGTTGGGGAAATAACCGAAACGTCGAC / / // / / //// BccI SspI |AvaII BsiYI* | |||NspBII* |AsuI* | |||PvuII BmgT120I | |||CviJI | |||TseI | |||AluI | ||BisI | |BlsI | |SetI | CviRI* CviJI V G V E M E K I L V G P T P L L A L Q L L V W R W R K Y * * D Q P L Y W L C S * W C G D G E N I S R T N P F I G F A A D ----:----|----:----|----:----|----:----|----:----|----:----| T P T S I S F I N T P G V G K N A K C S L Q H P S P S F I L L V L G K I P K A A N T H L H L F Y * Y S W G R * Q S Q L Q BbvI | CviJI | | SduI AluI | | HgiJII* CviJI | | | Hpy178III* TspGWI | SetI Hpy99I \ \ \ \ \ \ \ \ ATTCAAAGGGCTCATCTTGAAAATGTTATCTTTTTTTGGCATAATGATAGCTCCGTCGTA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TAAGTTTCCCGAGTAGAACTTTTACAATAGAAAAAAACCGTATTACTATCGAGGCAGCAT / / / / / / / / | | CviJI Hpy178III* TspGWI | | Hpy99I | | BbvI | CviJI | HgiJII* | AluI | SduI SetI HinfI TfiI I Q R A H L E N V I F F W H N D S S V V F K G L I L K M L S F F G I M I A P S * S K G S S * K C Y L F L A * * * L R R K ----:----|----:----|----:----|----:----|----:----|----:----| I * L A * R S F T I K K Q C L S L E T T S E F P E D Q F H * R K K A Y H Y S R R N L P S M K F I N D K K P M I I A G D Y TspEI | MseI | VspI | | FatI | | |CviAII | | || NlaIII ApoI | | || |AccI TspEI MboII | | || ||BssNAI | Ksp632I* TspEI Hpy178III* | | || ||Hpy166II \ \ \ \ \ \ \\ \\\ AAATTCAACGAAGAGAATTGTCAAGATATGGACAAAATTAATCATGTATACAATGATAAC 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TTTAAGTTGCTTCTCTTAACAGTTCTATACCTGTTTTAATTAGTACATATGTTACTATTG / / / / / // / // // | Ksp632I* | | Hpy178III* || | || |AccI TspEI | MboII || | || Hpy166II ApoI TspEI || | || BssNAI || | |FatI || | CviAII || NlaIII |VspI |MseI TspEI K F N E E N C Q D M D K I N H V Y N D N N S T K R I V K I W T K L I M Y T M I T I Q R R E L S R Y G Q N * S C I Q * * H ----:----|----:----|----:----|----:----|----:----|----:----| F N L S S F Q * S I S L I L * T Y L S L L I * R L S N D L Y P C F * D H I C H Y F E V F L I T L I H V F N I M Y V I I V HindIII | AluI | CviJI TspEI | | SetI \ \ \ \ ATACTAAACTCACACTTGAAAAGTTTTATTGAATTATATCCAATGTTTTTAGAGAAGCTT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| TATGATTTGAGTGTGAACTTTTCAAAATAACTTAATATAGGTTACAAAAATCTCTTCGAA / / / / TspEI | | HindIII | CviJI | AluI SetI I L N S H L K S F I E L Y P M F L E K L Y * T H T * K V L L N Y I Q C F * R S F T K L T L E K F Y * I I S N V F R E A S ----:----|----:----|----:----|----:----|----:----|----:----| M S F E C K F L K I S N Y G I N K S F S C V L S V S S F N * Q I I D L T K L S A Y * V * V Q F T K N F * I W H K * L L K BssKI SmlI EcoRII AflII | ScrFI ApoI BslFI |MseI TspEI | BseBI TspEI | BinI* \\ \ \ \ \ \ \ CCTATCTTAAGGGAAAAAATTGGTCGTTCGCCAGGATTTCAGCAAAATTTTATATTGAGT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GGATAGAATTCCCTTTTTTAACCAGCAAGCGGTCCTAAAGTCGTTTTAAAATATAACTCA // / / / / / |AflII TspEI | EcoRII TspEI BinI* |SmlI | BssKI ApoI BslFI MseI BseBI ScrFI P I L R E K I G R S P G F Q Q N F I L S L S * G K K L V V R Q D F S K I L Y * V Y L K G K N W S F A R I S A K F Y I E C ----:----|----:----|----:----|----:----|----:----|----:----| G I K L S F I P R E G P N * C F K I N L E * R L P F F Q D N A L I E A F N * I S R D * P F F N T T R W S K L L I K Y Q T FatI NcoI StyI SecI* DsaI* MboI |CviAII | DpnI || NlaIII TspEI | |BstKTI || |CviJI Hpy178III* | MseI | || TsoI || || TspEI | NlaIV | | MboII \ \\ \ \\ \\ \ \ \ \ \ \ GCGATCCTGTCCCCCATGGCTAATTTACAAATAATCGGGAACCCAAAGAAGAAAATTAAC 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CGCTAGGACAGGGGGTACCGATTAAATGTTTATTAGCCCTTGGGTTTCTTCTTTTAATTG //// / /// / / / /// |||MboI | ||CviJI TspEI | NlaIV ||MboII ||TsoI | |DsaI* Hpy178III* |MseI |DpnI | |SecI* TspEI BstKTI | |StyI | |NcoI | |FatI | CviAII NlaIII A I L S P M A N L Q I I G N P K K K I N R S C P P W L I Y K * S G T Q R R K L T D P V P H G * F T N N R E P K E E N * Q ----:----|----:----|----:----|----:----|----:----|----:----| A I R D G M A L K C I I P F G F F F I L H S G T G W P * N V F L R S G L S S F * R D Q G G H S I * L Y D P V W L L F N V BssKI SexAI EcoRII | ScrFI | BseBI AluI | |SetI CviJI | || BsiYI* HphI |DdeI | || | MaeIII Hin4II* BseMII ||SetI | || | Tsp45I | Hin4II* |BspCNI |||SfaNI \ \\ \ \ \ \ \\ \\\\ AACCTGGTTTCGGTGACAGAAAGCATTGTGAAGGAAGGATTGAAGCTGAGTAAAAATGAT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TTGGACCAAAGCCACTGTCTTTCGTAACACTTCCTTCCTAACTTCGACTCATTTTTACTA / /// / / / // / / / / | ||EcoRII | | Hin4II* |BspCNI | | | SfaNI | ||SexAI | Hin4II* BseMII | | DdeI | ||BssKI | HphI | CviJI | |BsiYI* Tsp45I | AluI | BseBI MaeIII SetI | ScrFI SetI N L V S V T E S I V K E G L K L S K N D T W F R * Q K A L * R K D * S * V K M M P G F G D R K H C E G R I E A E * K * C ----:----|----:----|----:----|----:----|----:----|----:----| L R T E T V S L M T F S P N F S L L F S C G P K P S L F C Q S P L I S A S Y F H V Q N R H C F A N H L F S Q L Q T F I I Tsp4CI* | TfiI | HinfI TseI | |TspDTI CviRI* MwoI | || EcoP15I |BisI BstAPI | || | MnlI ||BlsI | BbvI | || | | NdeI DdeI \\\ \ \ \ \\ \ \ \ \ GCAGCAGTTATTGCCAAGACCGTAGATTCAATATGTTCATATGAGGAAATACTTGCTAAG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCGTCAATAACGGTTCTGGCATCTAAGTTATACAAGTATACTCCTTTATGAACGATTC //// / / / / / // / // |||| BstAPI | | | HinfI |MnlI NdeI |DdeI |||| MwoI | | | TfiI EcoP15I MwoI |||TseI | | TspDTI ||BisI | Tsp4CI* |BlsI BbvI CviRI* A A V I A K T V D S I C S Y E E I L A K Q Q L L P R P * I Q Y V H M R K Y L L S S S Y C Q D R R F N M F I * G N T C * V ----:----|----:----|----:----|----:----|----:----|----:----| A A T I A L V T S E I H E Y S S I S A L H L L * Q W S R L N L I N M H P F V Q * C C N N G L G Y I * Y T * I L F Y K S L MwoI | CviRI* | | MboI | | | DpnI | | | |BstKTI | | | || BseYI | | | || | AluI | | | || | GsaI | | | || | CviJI | | | || | | SetI Hpy188I MseI \ \ \ \\ \ \ \ \ \ TTTGCAGATCGTTCCCAGCTAAAAAAATCCGAAATCGGTATATTTCTACGGAACTTTAAT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| AAACGTCTAGCAAGGGTCGATTTTTTTAGGCTTTAGCCATATAAAGATGCCTTGAAATTA / // / / / / / / | || | | | BseYI Hpy188I MseI | || | | | CviJI | || | | | AluI | || | | SetI | || | GsaI | || MboI | |DpnI | BstKTI CviRI* F A D R S Q L K K S E I G I F L R N F N L Q I V P S * K N P K S V Y F Y G T L M C R S F P A K K I R N R Y I S T E L * W ----:----|----:----|----:----|----:----|----:----|----:----| N A S R E W S F F D S I P I N R R F K L T Q L D N G A L F I R F R Y I E V S S * K C I T G L * F F G F D T Y K * P V K I SfaNI | Hpy188I | | CviRI* | | | EcoT22I MwoI | | | | MseI BstAPI | | | | |AhaIII* HindIII | CviRI* | | | | || TfiI | AluI TspGWI | | SfaNI | | | | || HinfI | CviJI \ \ \ \ \ \ \ \ \\ \ \ \ GGCGAATGGGAAACAGCACATTTTGCATCTCTATCAGATGCATTTTTAAAGATTCCCAAG 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| CCGCTTACCCTTTGTCGTGTAAAACGTAGAGATAGTCTACGTAAAAATTTCTAAGGGTTC / / / / / / / // / / / TspGWI | | | | | CviRI* |MseI | | CviJI | | | | EcoT22I | | | AluI | | | | SfaNI | | SetI | | | Hpy188I | HinfI | | SfaNI | TfiI | CviRI* AhaIII* BstAPI MwoI G E W E T A H F A S L S D A F L K I P K A N G K Q H I L H L Y Q M H F * R F P S R M G N S T F C I S I R C I F K D S Q A ----:----|----:----|----:----|----:----|----:----|----:----| P S H S V A C K A D R D S A N K F I G L H R I P F L V N Q M E I L H M K L S E W A F P F C C M K C R * * I C K * L N G L TspEI ApoI SetI | TspEI TspEI TspEI TspDTI \ \ \ \ \ \ CTTGAAACTAAAAAAATTGAATTACTTTTCCAAAATTACAATGAATTTTATTCTTACATA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| GAACTTTGATTTTTTTAACTTAATGAAAAGGTTTTAATGTTACTTAAAATAAGAATGTAT / / / / / / HindIII | TspEI TspEI TspEI TspDTI TspEI ApoI L E T K K I E L L F Q N Y N E F Y S Y I L K L K K L N Y F S K I T M N F I L T Y * N * K N * I T F P K L Q * I L F L H I ----:----|----:----|----:----|----:----|----:----|----:----| S S V L F I S N S K W F * L S N * E * M A Q F * F F Q I V K G F N C H I K N K C K F S F F N F * K E L I V I F K I R V Y FatI BspHI |CviAII |Hpy178III* TspDTI TspEI TspEI || NlaIII | Hpy166II \ \ \\ \ \ \ TTTGACAATAATTTGAATAATTGTCATGAACTAAAACCAATAGTGGACGGAAAACAAATG 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| AAACTGTTATTAAACTTATTAACAGTACTTGATTTTGGTTATCACCTGCCTTTTGTTTAC / / / // / / / TspEI | | |BspHI | Hpy166II TspGWI | | |FatI TspDTI | | Hpy178III* | | CviAII | NlaIII TspEI F D N N L N N C H E L K P I V D G K Q M L T I I * I I V M N * N Q * W T E N K W * Q * F E * L S * T K T N S G R K T N G ----:----|----:----|----:----|----:----|----:----|----:----| N S L L K F L Q * S S F G I T S P F C I I Q C Y N S Y N D H V L V L L P R F V F K V I I Q I I T M F * F W Y H V S F L H BssKI CviJI EcoRII | ScrFI | BseBI | | AsuI* | | AvaII | | |BmgT120I | | ||SetI | | |||FatI | | |||NcoI | | |||StyI | | |||SecI* | | |||DsaI* | | ||||BstXI | | ||||CviAII | | ||||| TspDTI | | ||||| |NlaIII | | ||||| ||BseYI | | ||||| ||CviJI | | ||||| |||BsiYI* | | ||||| |||| GsaI | | ||||| |||| | TspEI | | ||||| |||| | | MseI TspGWI | | ||||| |||| | | VspI \ \ \ \\\\\ \\\\ \ \ \ GCAAAACTACTTCAAATGAAGCCAGGTCCATGGCTGGGTAAAATTAATAACGAAGCGATT 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CGTTTTGATGAAGTTTACTTCGGTCCAGGTACCGACCCATTTTAATTATTGCTTCGCTAA / /////// /// / // / | ||||||| ||| BseYI |VspI SetI | ||||||| ||CviJI |MseI | ||||||| ||GsaI TspEI | ||||||| |DsaI* | ||||||| |SecI* | ||||||| |StyI | ||||||| |NcoI | ||||||| |FatI | ||||||| BsiYI* | ||||||| CviAII | ||||||TspDTI | |||||NlaIII | |||||AvaII | |||||AsuI* | ||||BmgT120I | |||EcoRII | |||BssKI | ||BstXI | |BseBI | |ScrFI | SetI CviJI A K L L Q M K P G P W L G K I N N E A I Q N Y F K * S Q V H G W V K L I T K R L K T T S N E A R S M A G * N * * R S D * ----:----|----:----|----:----|----:----|----:----|----:----| A F S S * I F G P G H S P L I L L S A I P L V V E F S A L D M A P Y F * Y R L S C F * K L H L W T W P Q T F N I V F R N AlwNI | MboI | BclI | | DpnI | | |BstKTI | | ||Hpy178III* | | ||| TspEI | | ||| | BslFI MseI | | ||| | |MseI |AhaIII* SetI SfeI* | | ||| | |VspI || CviJI \ \ \ \ \\\ \ \\ \\ \ AGGTGGCAGTTTGATAATCCTACAGGGACTGATCAAGAATTAATAACTCATTTAAAAGCC 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| TCCACCGTCAAACTATTAGGATGTCCCTGACTAGTTCTTAATTATTGAGTAAATTTTCGG // // / / /// // / |AlwNI || | | ||BslFI || CviJI SfeI* || | | |VspI |MseI || | | |MseI AhaIII* || | | TspEI || | Hpy178III* || BclI || MboI |DpnI BstKTI R W Q F D N P T G T D Q E L I T H L K A G G S L I I L Q G L I K N * * L I * K P V A V * * S Y R D * S R I N N S F K S H ----:----|----:----|----:----|----:----|----:----|----:----| L H C N S L G V P V S * S N I V * K F A * T A T Q Y D * L S Q D L I L L E N L L P P L K I I R C P S I L F * Y S M * F G SfeI* |SetI \\ ATACTACCAAAATACCTGTAG 1630 1640 ----:----|----:----|- TATGATGGTTTTATGGACATC / / SetI SfeI* I L P K Y L * Y Y Q N T C X T T K I P V X ----:----|----:----|- M S G F Y R Y W V V L I G T Y * W F V Q L # Enzymes that cut Frequency Isoschizomers AccI 3 FblI,XmiI AciI 2 BspACI,SsiI AflII 1 BfrI,BspTI,Bst98I,BstAFI,MspCI,Vha464I AhaIII* 2 DraI AluI 8 AluBI AlwNI 1 CaiI ApoI 5 AcsI,XapI AsuI* 2 Cfr13I,PspPI,Sau96I,AspS9I AvaI 2 Ama87I,BsiHKCI,BsoBI,Eco88I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BarI 1 BbvI 3 BseXI,BstV1I,Lsp1109I BbvII* 1 BpiI,BpuAI,BstV2I,BbsI BccI 5 Bce83I* 1 BpuEI BciVI 1 BfuI BclI 1 FbaI,Ksp22I BetI* 1 BsaWI BglII 2 BinI* 6 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BmeT110I 2 BmgT120I 2 Bpu10I 1 BseBI 4 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 4 BseYI 2 BsiYI* 3 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmI 1 BsaMI,Mva1269I,PctI Bsp1407I 1 BsrGI,BstAUI BspCNI 4 BspHI 1 CciI,PagI,RcaI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrI 1 BseNI,Bse1I,BsrSI BssKI 4 BstSCI,StyD4I BssNAI 2 Bst1107I,BstZ17I BstAPI 2 BstKTI 10 BstXI 2 Csp6I 3 CviQI,RsaNI CviAII 4 CviJI 19 CviKI-1 CviRI* 10 HpyCH4V DdeI 6 BstDEI,HpyF3I DpnI 10 MalI DsaI* 2 BtgI,BstDSI EciI 1 EcoP15I 1 EcoRI 1 EcoRII 4 AjnI,Psp6I,PspGI EcoT22I 1 Mph1103I,NsiI,Zsp2I FatI 4 FokI 3 GsaI 2 HgaI 1 CseI HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII Hin4II* 3 HpyAV HindIII 3 HinfI 6 HpaII 1 HapII,BsiSI,MspI HphI 5 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 11 Hpy188III Hpy188I 6 Hpy99I 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeI 2 FspBI,BfaI,XspI MaeIII 3 MboI 10 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MlyI 1 SchI MnlI 7 MseI 12 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NcoI 2 Bsp19I NdeI 1 FauNDI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 2 BspLI,BmiI,PspN4I NspBII* 1 MspA1I PfoI 1 PleI 1 PpsI PvuII 1 RsaI 3 AfaI ScrFI 4 BmrFI,MspR9I,Bme1390I SduI 1 MhlI,Bsp1286I SecI* 3 BseDI,BssECI,BsaJI SetI 19 SexAI 1 MabI SfaNI 5 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 2 SmoI SspI 1 StyI 2 Eco130I,EcoT14I,ErhI,BssT1I TaqII 2 TatI 1 TfiI 5 PfeI TseI 3 ApeKI TsoI 2 Tsp45I 2 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspDTI 6 TspEI 22 TasI,Tsp509I,Sse9I TspGWI 5 VspI 4 PshBI,AseI XbaI 2 XhoII 3 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AclI AcyI AflIII AgeI AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvrII BaeI BalI BamHI BbvCI BceAI BcgI BdaI BfiI BglI BmtI BplI BsaAI BsaBI BsaXI BsePI BseRI BseSI BsgI BsiI* BsmAI Bsp120I BspLU11I* BspMI BspOI BsrBI BsrDI BstEII BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI CspCI DinI DraII DraIII DrdI Eam1105I Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRV EgeI EheI Esp3I EspI* FalI FauI FnuDII* FseI FspAI GlaI GsuI HaeII HaeIII HgiAI* HgiCI* HhaI Hin4I Hin6I HindII HinP1I HpaI HspAI KasI KpnI MaeII MauBI McrI* MfeI MluI MmeI MroNI MstI* NaeI NarI NgoMIV NheI NmeAIII NotI NruI NspI OliI PacI PasI PflMI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI RsrII SacI SacII SalI SanDI SapI SauI* ScaI SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TaiI TaqI TauI TspMI TspRI TstI Tth111I XcmI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769