Restriction Map of UBP3/YER151C



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

UBP3/YER151C on chromosome V from coordinates 472424 to 469686.

The sequence you have requested is oriented with respect to the Crick (bottom) strand. Thus, the chromosomal coordinate of the beginning of the gene or sequence is larger than that of the end. The sequence shown here is the 5'-3' direction of the Crick strand and is the reverse complement of the Watson (top) strand.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.2.7830

EMBOSS_001 TspDTI | BplI | BplI | |Ksp632I* | || HinfI | || | Csp6I | || | |RsaI | || | || PleI | || | || |TaqI | || | || |MlyI | || | || |MboII | || | || || BsaXI | || | || || Csp6I FatI | || | || || |RsaI |CviAII | || | || || || MboII || NspI | || | || || || | BplI || CviRI* | || | || || || | BplI || NlaIII | || HgaI | || || || | | SetI Ksp632I* \\ \ \ \\ \ \ \\ \\ \\ \ \ \ \ ATGAACATGCAAGACGCTAACAAAGAAGAGTCGTACTCGATGTACCCGAAAACCTCTTCT 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTTGTACGTTCTGCGATTGTTTCTTCTCAGCATGAGCTACATGGGCTTTTGGAGAAGA / // / / / / //// / // / / | || TspDTI | | | |||| | || | SetI | || BplI | | | |||| | || MboII | || BplI | | | |||| | || BplI | |CviRI* | | | |||| | || BplI | |FatI | | | |||| | |Csp6I | CviAII | | | |||| | RsaI NlaIII | | | |||| BsaXI NspI | | | |||| TaqI | | | |||PleI | | | |||MlyI | | | ||MboII | | | |Csp6I | | | RsaI | | HinfI | HgaI Ksp632I* M N M Q D A N K E E S Y S M Y P K T S S * T C K T L T K K S R T R C T R K P L L E H A R R * Q R R V V L D V P E N L F S ----:----|----:----|----:----|----:----|----:----|----:----| X F M C S A L L S S D Y E I Y G F V E E X S C A L R * C L L T T S S T G S F R K H V H L V S V F F L R V R H V R F G R R Hin6I |GlaI ||HhaI CviRI* |||HaeII SetI | TfiI |||| CviRI* MnlI BsaXI | HinfI |||| | Csp6I \ \ \ \ \\\\ \ \ CCACCACCACCTACGCCAACCAATATGCAGATTCCTATTTATCAAGCGCCTTTGCAGATG 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGGTGGTGGATGCGGTTGGTTATACGTCTAAGGATAAATAGTTCGCGGAAACGTCTAC // // / / //// / || |BsaXI | HinfI |||Hin6I CviRI* || SetI | TfiI ||GlaI |Ksp632I* CviRI* |HhaI MnlI HaeII P P P P T P T N M Q I P I Y Q A P L Q M H H H L R Q P I C R F L F I K R L C R C T T T Y A N Q Y A D S Y L S S A F A D V ----:----|----:----|----:----|----:----|----:----|----:----| G G G G V G V L I C I G I * * A G K C I E V V V * A L W Y A S E * K D L A K A S W W W R R W G I H L N R N I L R R Q L H DdeI | AsuI* | DraII | |CviJI | |HaeIII | |BmgT120I RsaI | ||NlaIV BspCNI BspMI | CviJI | |||BceAI |BseMII SetI | MseI \ \ \ \\\\ \\ \ \ \ TACGGCTACACTCAGGCCCCATATCTATACCCCACACAAATACCTGCCTATTCGTTTAAT 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCCGATGTGAGTCCGGGGTATAGATATGGGGTGTGTTTATGGACGGATAAGCAAATTA // / / /// / // / / / || CviJI | ||| | |BseMII SetI | MseI |Csp6I | ||| | BspCNI BspMI RsaI | ||| BceAI | ||DraII | ||AsuI* | |BmgT120I | |NlaIV | HaeIII | CviJI DdeI Y G Y T Q A P Y L Y P T Q I P A Y S F N T A T L R P H I Y T P H K Y L P I R L I R L H S G P I S I P H T N T C L F V * Y ----:----|----:----|----:----|----:----|----:----|----:----| Y P * V * A G Y R Y G V C I G A * E N L T R S C E P G M D I G W V F V Q R N T * V A V S L G W I * V G C L Y R G I R K I MslI CspCI | BstXI | |BccI | || TseI | || |BisI HindII | || ||BlsI Hpy166II CviJI | || |||CviJI BbvI AciI \ \ \ \\ \\\\ \ \ ATGGTCAACCAAAACCAGCCAATCTACCATCAAAGTGGCAGCCCACATCACTTGCCTCCG 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAGTTGGTTTTGGTCGGTTAGATGGTAGTTTCACCGTCGGGTGTAGTGAACGGAGGC / / / / / /// / / Hpy166II CviJI | | | ||CviJI BbvI AciI HindII | | | ||TseI | | | |BisI | | | BlsI | | BccI | MslI BstXI CspCI M V N Q N Q P I Y H Q S G S P H H L P P W S T K T S Q S T I K V A A H I T C L R G Q P K P A N L P S K W Q P T S L A S A ----:----|----:----|----:----|----:----|----:----|----:----| I T L W F W G I * W * L P L G C * K G G Y P * G F G A L R G D F H C G V D S A E H D V L V L W D V M L T A A W M V Q R R MnlI | CspCI | | SspI BceAI | | | MseI AciI | EciI MseI \ \ \ \ \ \ \ \ CAAAACAATATTAACGGCGGAAGCACTACCAATAACAACAACATTAACAAGAAGAAGTGG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTGTTATAATTGCCGCCTTCGTGATGGTTATTGTTGTTGTAATTGTTCTTCTTCACC // / / / / / / || | MseI AciI | BceAI MseI || SspI EciI |CspCI MnlI Q N N I N G G S T T N N N N I N K K K W K T I L T A E A L P I T T T L T R R S G K Q Y * R R K H Y Q * Q Q H * Q E E V A ----:----|----:----|----:----|----:----|----:----|----:----| C F L I L P P L V V L L L L M L L F F H A F C Y * R R F C * W Y C C C * C S S T L V I N V A S A S G I V V V N V L L L P BbvI | KasI | HgiCI* | |AcyI | |NarI | |Hin6I TseI | ||GlaI |BisI | ||DinI ||BlsI | ||NlaIV MboII |||AciI | |||HhaI MaeI | MslI |||NspBII* | ||||HaeII | AciI \ \ \\\\ \ \\\\\ \ \ CACTCTAATGGCATTACCAATAACAATGGAAGCAGCGGTAATCAAGGCGCCAACTCTAGC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTGAGATTACCGTAATGGTTATTGTTACCTTCGTCGCCATTAGTTCCGCGGTTGAGATCG / / /// / ///// / | MslI ||| AciI ||||HgiCI* MaeI MboII ||NspBII* ||||KasI ||TseI |||Hin6I |BisI |||NarI BlsI |||AcyI ||NlaIV ||BbvI ||DinI ||GlaI |HhaI HaeII H S N G I T N N N G S S G N Q G A N S S T L M A L P I T M E A A V I K A P T L A L * W H Y Q * Q W K Q R * S R R Q L * R ----:----|----:----|----:----|----:----|----:----|----:----| C E L P M V L L L P L L P L * P A L E L A S * H C * W Y C H F C R Y D L R W S * V R I A N G I V I S A A T I L A G V R A AciI MwoI |BisI ||BlsI |||FatI |||TauI ||||CviAII ||||| MwoI ||||| |NlaIII ||||| || AluI ||||| || CviJI TspEI ||||| || | SetI SetI | BccI Hin4I \\\\\ \\ \ \ \ \ \ \ GGTAGCGGCATGAGCTACAACAAATCCCACACCTACCATCACAATTACTCTAACAATCAT 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| CCATCGCCGTACTCGATGTTGTTTAGGGTGTGGATGGTAGTGTTAATGAGATTGTTAGTA // //// // / / // / || |||| || CviJI SetI |TspEI Hin4I || |||| || AluI BccI || |||| |FatI || |||| |SetI || |||| CviAII || |||NlaIII || |||MwoI || ||BisI || ||AciI || |BlsI || TauI |MwoI AciI G S G M S Y N K S H T Y H H N Y S N N H V A A * A T T N P T P T I T I T L T I I * R H E L Q Q I P H L P S Q L L * Q S Y ----:----|----:----|----:----|----:----|----:----|----:----| P L P M L * L L D W V * W * L * E L L * R Y R C S S C C I G C R G D C N S * C D T A A H A V V F G V G V M V I V R V I M MnlI |PflMI |BsiYI* |Tsp4CI* || TseI || |FauI || |BisI || |TspRI || ||BlsI || |||Hin4I || |||| AciI BccI || |||| |MwoI | FatI || |||| ||Cac8I | |CviAII || |||| ||BsrDI | || NlaIII || |||| ||| FatI | || BsiYI* || |||| ||| BbvI | || | CviJI || |||| ||| |CviAII MboII | || | HaeIII || |||| ||| || NlaIII | TspDTI \ \\ \ \ \\ \\\\ \\\ \\ \ \ \ ATCCCCATGATGGCCTCTCCAAACAGTGGCAGCAATGCGGGCATGAAAAAACAGACCAAC 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TAGGGGTACTACCGGAGAGGTTTGTCACCGTCGTTACGCCCGTACTTTTTTGTCTGGTTG /// // / //// / /// / / / / // / / ||| || HaeIII |||| | ||| | | | | |BbvI | TspDTI ||| || CviJI |||| | ||| | | | | |FatI MboII ||| |FatI |||| | ||| | | | | CviAII ||| CviAII |||| | ||| | | | NlaIII ||BsiYI* |||| | ||| | | Cac8I |NlaIII |||| | ||| | | AciI BccI |||| | ||| | BsrDI |||| | ||| MwoI |||| | ||TseI |||| | ||FauI |||| | |BisI |||| | BlsI |||| Hin4I |||Tsp4CI* ||MnlI |BsiYI* |PflMI TspRI I P M M A S P N S G S N A G M K K Q T N S P * W P L Q T V A A M R A * K N R P T P H D G L S K Q W Q Q C G H E K T D Q L ----:----|----:----|----:----|----:----|----:----|----:----| I G M I A E G F L P L L A P M F F C V L Y G W S P R E L C H C C H P C S F V S W D G H H G R W V T A A I R A H F F L G V Ksp632I* | MboII | | Tsp4CI* | | | HphI MboII | | | |BceAI | Csp6I MboII | | | ||CviJI | |RsaI |Ksp632I* | | | ||| MmeI | || BccI || MboII Ksp632I* \ \ \ \\\ \ \ \\ \ \\ \ \ TCTTCCAACGGCAACGGTTCTTCGGCTACTTCACCATCGTACTCTTCCTACAACTCTTCT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGAAGGTTGCCGTTGCCAAGAAGCCGATGAAGTGGTAGCATGAGAAGGATGTTGAGAAGA // / / /// / // / / / / || | | ||MmeI MboII || | | | Ksp632I* || | | |BceAI || | | MboII || | | CviJI || | MboII || | HphI || BccI || Tsp4CI* |Csp6I |MboII RsaI Ksp632I* S S N G N G S S A T S P S Y S S Y N S S L P T A T V L R L L H H R T L P T T L L F Q R Q R F F G Y F T I V L F L Q L F F ----:----|----:----|----:----|----:----|----:----|----:----| E E L P L P E E A V E G D Y E E * L E E S K W R C R N K P * K V M T S K R C S K R G V A V T R R S S * W R V R G V V R R MaeIII Tsp45I TfiI | Bce83I* HinfI | | TspEI | SmlI ApoI Tsp4CI* | | | MseI | |TspDTI TspEI \ \ \ \ \ \ \\ \ TCACAGTATGATTTATACAAGTTTGATGTCACTAAATTAAAGAATCTCAAGGAAAATTCA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGTCATACTAAATATGTTCAAACTACAGTGATTTAATTTCTTAGAGTTCCTTTTAAGT // / / // / / / |Tsp4CI* | | |MseI | SmlI TspEI Ksp632I* | | TspEI TspDTI ApoI | Tsp45I HinfI | MaeIII TfiI Bce83I* S Q Y D L Y K F D V T K L K N L K E N S H S M I Y T S L M S L N * R I S R K I H T V * F I Q V * C H * I K E S Q G K F I ----:----|----:----|----:----|----:----|----:----|----:----| E C Y S K Y L N S T V L N F F R L S F E K V T H N I C T Q H * * I L S D * P F N * L I I * V L K I D S F * L I E L F I * ApoI TspEI | MwoI | BstAPI | | TseI | | TspGWI | | |BisI TfiI | | ||BlsI HinfI | | |||AciI | MfeI | | ||||BisI | TspEI Tsp4CI* | | |||||BlsI | | TspDTI | TspRI BbvI | | ||||||TauI \ \ \ \ \ \ \ \ \\\\\\\ TCAAACTTGATTCAATTGCCACTGTTCATAAACACTACGGAAGCAGAATTTGCTGCGGCA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTTGAACTAAGTTAACGGTGACAAGTATTTGTGATGCCTTCGTCTTAAACGACGCCGT // / / / / / ///// || | Tsp4CI* | | | ||||BisI || TspEI | | | ||||AciI || TspRI | | | |||BlsI || MfeI | | | ||TseI |TspDTI | | | ||TauI HinfI | | | |BisI TfiI | | | BlsI | | TspGWI | | TspEI | | ApoI | BstAPI | MwoI BbvI S N L I Q L P L F I N T T E A E F A A A Q T * F N C H C S * T L R K Q N L L R Q K L D S I A T V H K H Y G S R I C C G K ----:----|----:----|----:----|----:----|----:----|----:----| D F K I * N G S N M F V V S A S N A A A M L S S E I A V T * L C * P L L I Q Q P * V Q N L Q W Q E Y V S R F C F K S R C Csp6I |RsaI |SetI || TspEI || | MseI Hpy188I || | | Hin4II* |Hin4I || | | | FatI || HindIII || | | | |CviAII || | AluI || | | | || NlaIII || | CviJI || | | | || |PpiI TspDTI || | |DdeI || | | | || || CviJI |SetI || | ||SetI PpiI \\ \ \ \ \\ \\ \ \\ \\ \ \\\ \ AGTGTCCAAAGGTACGAATTAAACATGAAGGCTTTGAACCTAAACTCTGAAAGCTTAGAG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| TCACAGGTTTCCATGCTTAATTTGTACTTCCGAAACTTGGATTTGAGACTTTCGAATCTC / // // / // / // / / / / / / | |Csp6I || | || CviJI || | | | | | DdeI | RsaI || | |FatI || | | | | HindIII SetI || | CviAII || | | | | PpiI || NlaIII || | | | CviJI || PpiI || | | | AluI |MseI || | | SetI Hin4II* || | Hpy188I TspEI || Hin4I |TspDTI SetI S V Q R Y E L N M K A L N L N S E S L E V S K G T N * T * R L * T * T L K A * R C P K V R I K H E G F E P K L * K L R E ----:----|----:----|----:----|----:----|----:----|----:----| L T W L Y S N F M F A K F R F E S L K S L H G F T R I L C S P K S G L S Q F S L T D L P V F * V H L S Q V * V R F A * L AluI CviJI Ecl136II |Hin4I ||SetI ||SduI AccI ||SacI |BssNAI ||HgiAI* |Hpy166II SfeI* ||HgiJII* BccI CviJI || MnlI \ \\\ \ \ \\ \ AACTCATCTGTAGAAAAGAGCTCTGCCCATCATCACACAAAAAGCCATAGTATACCAAAG 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAGTAGACATCTTTTCTCGAGACGGGTAGTAGTGTGTTTTTCGGTATCATATGGTTTC / / / / / / // / | | | Ecl136II BccI CviJI |AccI MnlI | | | CviJI Hpy166II | | | AluI BssNAI | | HgiJII* | | HgiAI* | | SacI | | SduI | | SetI | Hin4I SfeI* N S S V E K S S A H H H T K S H S I P K T H L * K R A L P I I T Q K A I V Y Q S L I C R K E L C P S S H K K P * Y T K A ----:----|----:----|----:----|----:----|----:----|----:----| F E D T S F L E A W * * V F L W L I G F S S M Q L F S S Q G D D C L F G Y Y V L V * R Y F L A R G M M V C F A M T Y W L MboII | FatI | BspHI | |MboII FatI | |CviAII |CviAII | |Hpy178III* || NlaIII | || MboII || | SfaNI | || NlaIII \\ \ \ \ \\ \ CATAATGAGGAAGTAAAGACAGAAACACATGGGGAAGAAGAAGATGCTCATGATAAAAAA 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GTATTACTCCTTCATTTCTGTCTTTGTGTACCCCTTCTTCTTCTACGAGTACTATTTTTT / // / / / // | |FatI SfaNI | | |BspHI | CviAII | | |FatI NlaIII | | Hpy178III* | | CviAII | | MboII | NlaIII | MboII MboII H N E E V K T E T H G E E E D A H D K K I M R K * R Q K H M G K K K M L M I K N * * G S K D R N T W G R R R C S * * K T ----:----|----:----|----:----|----:----|----:----|----:----| C L S S T F V S V C P S S S S A * S L F A Y H P L L S L F V H P L L L H E H Y F M I L F Y L C F C M P F F F I S M I F F Hin6I |GlaI |MstI* |FspAI FatI ||HhaI |CviAII |||BsiI* || SfaNI |||| AluI || |NspI |||| CviJI || |NlaIII |||| | MseI MnlI || || Cac8I |||| | SetI SfaNI \\ \\ \ \\\\ \ \ \ CCACATGCGAGCAAAGATGCGCACGAGCTTAAAAAGAAAACTGAAGTAAAGAAAGAGGAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| GGTGTACGCTCGTTTCTACGCGTGCTCGAATTTTTCTTTTGACTTCATTTCTTTCTCCTA / // // /// /// / / / / | || |SfaNI ||| ||| MseI MnlI SfaNI Eco57MI | || Cac8I ||| ||CviJI Eco57I | |FatI ||| ||AluI | CviAII ||| |BsiI* NlaIII ||| SetI NspI ||Hin6I |FspAI |MstI* |GlaI HhaI P H A S K D A H E L K K K T E V K K E D H M R A K M R T S L K R K L K * R K R M T C E Q R C A R A * K E N * S K E R G C ----:----|----:----|----:----|----:----|----:----|----:----| G C A L L S A C S S L F F V S T F F S S V V H S C L H A R A * F S F Q L L S L P W M R A F I R V L K F L F S F Y L F L I NlaIV | SmlI | |SetI DdeI | || AluI EspI* | || CviJI Eco57I FokI | || | SetI Eco57MI | MaeIII | || | | MnlI SfeI* |BseGI | Tsp4CI* Bce83I* | || | | |Tsp4CI* |SetI \\ \ \ \ \ \\ \ \ \\ \\ GCTAAGCAAGACCGTAACGAAAAAGTTATACAGGAACCTCAAGCTACTGTTTTACCTGTA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CGATTCGTTCTGGCATTGCTTTTTCAATATGTCCTTGGAGTTCGATGACAAAATGGACAT / / / / / / / /// // / / | EspI* | | | Bce83I* NlaIV ||| || SetI SfeI* | DdeI | | MaeIII SetI ||| |Tsp4CI* BseGI | FokI ||| MnlI Tsp4CI* ||CviJI ||AluI |SmlI SetI A K Q D R N E K V I Q E P Q A T V L P V L S K T V T K K L Y R N L K L L F Y L * * A R P * R K S Y T G T S S Y C F T C S ----:----|----:----|----:----|----:----|----:----|----:----| A L C S R L S F T I C S G * A V T K G T H * A L G Y R F L * V P V E L * Q K V Q S L L V T V F F N Y L F R L S S N * R Y HphI | GsuI MboII | Eco57MI MnlI TfiI |MboII | | BseRI Hin4II* | NlaIV HinfI || HphI | | |SetI \ \ \ \ \\ \ \ \ \\ GTGGATAAGAAGGAACCAGAGGAATCTGTTGAAGAAAATACTTCCAAGACATCTTCACCT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CACCTATTCTTCCTTGGTCTCCTTAGACAACTTCTTTTATGAAGGTTCTGTAGAAGTGGA / / / / // / / / // Hin4II* | NlaIV HinfI || HphI | | |BseRI MnlI TfiI |MboII | | SetI MboII | Eco57MI | GsuI HphI V D K K E P E E S V E E N T S K T S S P W I R R N Q R N L L K K I L P R H L H L G * E G T R G I C * R K Y F Q D I F T F ----:----|----:----|----:----|----:----|----:----|----:----| T S L F S G S S D T S S F V E L V D E G L P Y S P V L P I Q Q L F Y K W S M K V H I L L F W L F R N F F I S G L C R * R Hin4II* | BccI | | TseI | | |BisI | | ||BlsI | | ||| MnlI | | ||| |EciI | | ||| || BssKI | | ||| || EcoRII | | ||| || | ScrFI | | ||| || | BseBI | | ||| || | |BbvI EcoP15I | | ||| || | ||AsuI* |Hpy188I | | ||| || | ||AvaII ||MwoI | | ||| || | |||BmgT120I ||BstAPI | | ||| || | |||| AciI ||| SfaNI | | ||| || | |||| | SfaNI ||| | MseI AccI \ \ \\\ \\ \ \\\\ \ \ \\\ \ \ \ TCACCATCTCCTCCAGCAGCAAAATCCTGGTCCGCCATAGCATCAGATGCGATTAAAAGT 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AGTGGTAGAGGAGGTCGTCGTTTTAGGACCAGGCGGTATCGTAGTCTACGCTAATTTTCA / / /// / /// / / // / / / | | ||MnlI | ||| AciI | || | | MseI | | ||TseI | ||AvaII | || | SfaNI | | ||EciI | ||AsuI* | || EcoP15I | | |BisI | ||BbvI | |Hpy188I | | BlsI | |BmgT120I | BstAPI | BccI | EcoRII | MwoI Hin4II* | BssKI SfaNI BseBI ScrFI S P S P P A A K S W S A I A S D A I K S H H L L Q Q Q N P G P P * H Q M R L K V T I S S S S K I L V R H S I R C D * K * ----:----|----:----|----:----|----:----|----:----|----:----| E G D G G A A F D Q D A M A D S A I L L K V M E E L L L I R T R W L M L H S * F * W R R W C C F G P G G Y C * I R N F T Hin4I Hin4I |Tsp4CI* || BetI* || BspMII* || |HpaII || |Hpy178III* || ||BccI || ||BsmAI || |||MboI || |||| DpnI TspEI Hpy166II || |||| |TaqI | Hin4I | AluI || |||| |ClaI | Hin4I | CviJI || |||| |BstKTI | | PflMI | |MaeI || |||| || BinI* | | BsiYI* | ||SetI || |||| || MaeIII | | | Csp6I | |||MaeIII || |||| || Tsp45I | | | |RsaI \ \\\\ \\ \\\\ \\ \ \ \ \ \\ AGACAAGCTAGTAACAAAACAGTCTCCGGATCGATGGTCACTAAAACACCAATTTCTGGT 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TCTGTTCGATCATTGTTTTGTCAGAGGCCTAGCTACCAGTGATTTTGTGGTTAAAGACCA // / / / / / ////// / / / / / / || | | MaeI | Tsp4CI* |||||| | | | | TspEI RsaI || | CviJI MaeIII |||||| | | | BsiYI* || | AluI Hin4I |||||| | | | PflMI || SetI Hin4I |||||| | | Hin4I |AccI |||||| | | Hin4I Hpy166II |||||| | Tsp45I |||||| | MaeIII |||||| BinI* |||||ClaI |||||TaqI ||||MboI |||BsmAI ||DpnI |BspMII* |BstKTI |BetI* Hpy178III* HpaII BccI R Q A S N K T V S G S M V T K T P I S G D K L V T K Q S P D R W S L K H Q F L V T S * * Q N S L R I D G H * N T N F W Y ----:----|----:----|----:----|----:----|----:----|----:----| L C A L L L V T E P D I T V L V G I E P Y V L * Y C F L R R I S P * * F V L K Q S L S T V F C D G S R H D S F C W N R T FatI |CviAII || NlaIII || |TseI || |CviJI || ||BisI || |||BlsI || ||||AciI AciI || |||||BisI McrI* || ||||||BlsI AluI TspDTI || |||||||TauI CviJI | Cac8I BbvI || |||||||| SfeI* SetI | SetI \ \ \ \\ \\\\\\\\ \ \ \ \ ACGACCGCAGGCGTTTCATCAACAAACATGGCTGCGGCGACTATAGGTAAATCCAGCTCT 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| TGCTGGCGTCCGCAAAGTAGTTGTTTGTACCGACGCCGCTGATATCCATTTAGGTCGAGA / / / / / / //////// // / / | | | Cac8I | | |||||||BisI |SfeI* | CviJI | | AciI | | |||||||AciI SetI | AluI | TspDTI | | ||||||BlsI SetI | McrI* | | |||||TseI Csp6I | | |||||TauI | | ||||BisI | | |||BlsI | | ||CviJI | | |FatI | | CviAII | NlaIII BbvI T T A G V S S T N M A A A T I G K S S S R P Q A F H Q Q T W L R R L * V N P A L D R R R F I N K H G C G D Y R * I Q L S ----:----|----:----|----:----|----:----|----:----|----:----| V V A P T E D V F M A A A V I P L D L E Y S R L R K M L L C P Q P S * L Y I W S R G C A N * * C V H S R R S Y T F G A R TseI |BisI ||BlsI |||CviJI |||| DdeI |||| | Hpy188I |||| | | BbvI |||| | | | MnlI MaeII |||| | | | | BspCNI | SetI |||| | | | | |BseMII | TaiI SetI Hin4II* \\\\ \ \ \ \ \\ \ \ \ \ CCCCTGTTGTCCAAGCAGCCTCAGAAAAAGGATAAAAAATACGTTCCACCTTCTACAAAG 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| GGGGACAACAGGTTCGTCGGAGTCTTTTTCCTATTTTTTATGCAAGGTGGAAGATGTTTC /// // / // / / / / ||| |DdeI | |BseMII | | SetI Hin4II* ||| | | BspCNI | MaeII ||| | | BbvI TaiI ||| | MnlI SetI ||| Hpy188I ||CviJI ||TseI |BisI BlsI P L L S K Q P Q K K D K K Y V P P S T K P C C P S S L R K R I K N T F H L L Q R P V V Q A A S E K G * K I R S T F Y K G ----:----|----:----|----:----|----:----|----:----|----:----| G R N D L C G * F F S L F Y T G G E V F E G T T W A A E S F P Y F I R E V K * L G Q Q G L L R L F L I F F V N W R R C L BinI* | MboI BsrI | TspDTI TspRI | | DpnI | TaqI | | |BstKTI CviJI | | BfiI MseI | | ||Hpy178III* MaeIII \ \ \ \ \ \ \ \\\ \ GGTATTGAGCCACTGGGTTCGATTGCGTTAAGAATGTGTTTTGATCCCGATTTCATTAGT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| CCATAACTCGGTGACCCAAGCTAACGCAATTCTTACACAAAACTAGGGCTAAAGTAATCA // / / / / / // / / |CviJI BsrI BfiI MseI | | || | Hpy178III* TspRI TaqI | | || MboI | | |DpnI | | BstKTI | TspDTI BinI* G I E P L G S I A L R M C F D P D F I S V L S H W V R L R * E C V L I P I S L V Y * A T G F D C V K N V F * S R F H * L ----:----|----:----|----:----|----:----|----:----|----:----| P I S G S P E I A N L I H K S G S K M L P Y Q A V P N S Q T L F T N Q D R N * * T N L W Q T R N R * S H T K I G I E N T MaeII | SetI | TaiI TspGWI BsrI MnlI \ \ \ \ \ TACGTTTTACGGAATAAAGATGTTGAAAACAAAATACCAGTCCATTCCATTATTCCAAGA 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ATGCAAAATGCCTTATTTCTACAACTTTTGTTTTATGGTCAGGTAAGGTAATAAGGTTCT / // / / / | |MaeII TspGWI BsrI MnlI | MaeIII TaiI SetI Y V L R N K D V E N K I P V H S I I P R T F Y G I K M L K T K Y Q S I P L F Q E R F T E * R C * K Q N T S P F H Y S K R ----:----|----:----|----:----|----:----|----:----|----:----| * T K R F L S T S F L I G T W E M I G L N R K V S Y L H Q F C F V L G N W * E L V N * P I F I N F V F Y W D M G N N W S TspEI | MseI CviJI MaeIII MaeIII \ \ \ \ \ GGCATAATTAACAGAGCCAACATTTGTTTTATGAGTTCTGTGTTACAAGTGTTACTCTAC 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTATTAATTGTCTCGGTTGTAAACAAAATACTCAAGACACAATGTTCACAATGAGATG // / / / / |MseI CviJI MaeIII | Tsp4CI* TspEI MaeIII G I I N R A N I C F M S S V L Q V L L Y A * L T E P T F V L * V L C Y K C Y S T H N * Q S Q H L F Y E F C V T S V T L L ----:----|----:----|----:----|----:----|----:----|----:----| P M I L L A L M Q K I L E T N C T N S * L C L * C L W C K N * S N Q T V L T V R A Y N V S G V N T K H T R H * L H * E V TspEI | MseI | | AclI | | MaeII | | | SetI | | | TaiI | | | | DdeI | | | | | TatI | | | | | |Csp6I | | | | | ||RsaI | | | | | |||Hpy166II | | | | | |||| PsrI | | | | | |||| |BspCNI | | | | | |||| ||BseMII | | | | | |||| ||| TspEI | | | | | |||| ||| | Hpy178III* Tsp4CI* | | | | | |||| ||| | |FokI | CviJI | | | | | |||| ||| | |TspGWI | | PsrI | | | | | |||| ||| | || HinfI \ \ \ \ \ \ \ \ \\\\ \\\ \ \\ \ TGTAAGCCATTTATTGATGTAATTAACGTTCTCAGTACACGGAATACCAATTCAAGAGTC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| ACATTCGGTAAATAACTACATTAATTGCAAGAGTCATGTGCCTTATGGTTAAGTTCTCAG / // / / /// // / / // CviJI || MaeII | ||| |BseMII | | |HinfI PsrI || AclI | ||| BspCNI | | FokI |MseI | ||PsrI | Hpy178III* |TaiI | ||TatI TspGWI |SetI | |Hpy166II TspEI TspEI | |Csp6I | RsaI DdeI C K P F I D V I N V L S T R N T N S R V V S H L L M * L T F S V H G I P I Q E S * A I Y * C N * R S Q Y T E Y Q F K S R ----:----|----:----|----:----|----:----|----:----|----:----| Q L G N I S T I L T R L V R F V L E L T S Y A M * Q H L * R E * Y V S Y W N L L T L W K N I Y N V N E T C P I G I * S D PleI |MlyI SfaNI TspEI || BseGI |TspEI | TaqI \\ \ \\ \ \ GGCACATCATCCTGTAAATTATTAGATGCTTGTTTGACTATGTATAAGCAATTCGATAAG 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| CCGTGTAGTAGGACATTTAATAATCTACGAACAAACTGATACATATTCGTTAAGCTATTC / // / / BseGI |TspEI | TaqI PleI SfaNI TspEI MlyI G T S S C K L L D A C L T M Y K Q F D K A H H P V N Y * M L V * L C I S N S I R H I I L * I I R C L F D Y V * A I R * G ----:----|----:----|----:----|----:----|----:----|----:----| P V D D Q L N N S A Q K V I Y L C N S L R C M M R Y I I L H K N S * T Y A I R Y A C * G T F * * I S T Q S H I L L E I L ApoI SecI* XmnI BsmI DsaI* SetI TspEI MaeI SfaNI | MwoI |SfaNI \ \ \ \ \ \ \\ GAAACCTATGAGAAAAAATTCCTAGAGAATGCTGATGATGCTGAAAAAACCACGGAAAGT 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGGATACTCTTTTTTAAGGATCTCTTACGACTACTACGACTTTTTTGGTGCCTTTCA / / / / / / // SetI | | MaeI | MwoI |SfaNI | TspEI SfaNI DsaI* | ApoI BsmI SecI* XmnI E T Y E K K F L E N A D D A E K T T E S K P M R K N S * R M L M M L K K P R K V N L * E K I P R E C * * C * K N H G K * ----:----|----:----|----:----|----:----|----:----|----:----| S V * S F F N R S F A S S A S F V V S L P F R H S F I G L S H Q H H Q F F W P F F G I L F F E * L I S I I S F F G R F T Hin6I |GlaI |SfaNI ||HhaI CviRI* ||TspRI | TspGWI BtsI |||BtsI TspRI MmeI \ \ \ \\\\ \ \ GATGCAAAAAAATCATCAAAATCCAAGAGTTTCCAACACTGCGCCACTGCCGATGCTGTC 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| CTACGTTTTTTTAGTAGTTTTAGGTTCTCAAAGGTTGTGACGCGGTGACGGCTACGACAG // / /// / / |TspGWI TspRI ||| SfaNI MmeI CviRI* BtsI ||Hin6I |TspRI |GlaI |BtsI HhaI D A K K S S K S K S F Q H C A T A D A V M Q K N H Q N P R V S N T A P L P M L S C K K I I K I Q E F P T L R H C R C C Q ----:----|----:----|----:----|----:----|----:----|----:----| S A F F D D F D L L K W C Q A V A S A T H H L F I M L I W S N G V S R W Q R H Q I C F F * * F G L T E L V A G S G I S D SetI | ApoI AccI CviRI* | TspEI |Hpy166II | AsuI* \ \ \\ \ \ AAACCTGACGAATTTTACAAAACTTTGTCTACTATACCGAAGTTCAAAGACTTGCAATGG 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGGACTGCTTAAAATGTTTTGAAACAGATGATATGGCTTCAAGTTTCTGAACGTTACC / / // / / SetI TspEI |AccI | BsrDI ApoI Hpy166II CviRI* K P D E F Y K T L S T I P K F K D L Q W N L T N F T K L C L L Y R S S K T C N G T * R I L Q N F V Y Y T E V Q R L A M G ----:----|----:----|----:----|----:----|----:----|----:----| L G S S N * L V K D V I G F N L S K C H * V Q R I K C F K T * * V S T * L S A I F R V F K V F S Q R S Y R L E F V Q L P NlaIV BsrDI BmgT120I |CviJI PflMI |HaeIII BsiYI* || Hpy178III* | AsuI* || | BbvII* | AvaII || | | ApoI | |BmgT120I || | | HgaI | || TspEI || | | TspEI | || | MnlI || | BccI | MboII MboII | || | | BsiI* TspEI \\ \ \ \ \ \ \ \\ \ \ \ \ GGCCATCAGGAAGACGCAGAAGAATTTTTGACCCACTTATTGGACCAATTACACGAGGAA 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| CCGGTAGTCCTTCTGCGTCTTCTTAAAAACTGGGTGAATAACCTGGTTAATGTGCTCCTT /// / / / // / / // / / / ||AsuI* | BccI | || MboII BsiYI* || | TspEI BsiI* || Hpy178III* | |HgaI PflMI || MnlI |BmgT120I | TspEI |AvaII |HaeIII | ApoI |AsuI* |CviJI BbvII* BmgT120I NlaIV MboII G H Q E D A E E F L T H L L D Q L H E E A I R K T Q K N F * P T Y W T N Y T R N P S G R R R R I F D P L I G P I T R G I ----:----|----:----|----:----|----:----|----:----|----:----| P W * S S A S S N K V W K N S W N C S S P G D P L R L L I K S G S I P G I V R P A M L F V C F F K Q G V * Q V L * V L F TspDTI BccI |TseI MseI CviRI* BbvI ||BisI VspI |MfeI CviJI ApoI |||BlsI MseI |TspEI |TspEI | MseI TspEI ||||CviRI* VspI \\ \\ \ \ \ \\\\\ \ TTAATTTCTGCAATTGATGGCTTAACCGATAATGAAATTCAAAATATGCTGCAAAGTATT 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| AATTAAAGACGTTAACTACCGAATTGGCTATTACTTTAAGTTTTATACGACGTTTCATAA // / // / / / / / /// || | || | | MseI TspEI | ||CviRI* || | || | CviJI ApoI | ||TseI || | || TspEI BbvI | |BisI || | || MfeI | BlsI || | |BccI TspDTI || | CviRI* || TspEI |VspI |MseI TspEI L I S A I D G L T D N E I Q N M L Q S I * F L Q L M A * P I M K F K I C C K V L N F C N * W L N R * * N S K Y A A K Y * ----:----|----:----|----:----|----:----|----:----|----:----| N I E A I S P K V S L S I * F I S C L I I L K Q L Q H S L R Y H F E F Y A A F Y * N R C N I A * G I I F N L I H Q L T N ApoI TspEI | MaeIII | Tsp45I | | MaeII MfeI XmnI | | | SetI TspEI |TspDTI | | | TaiI \ \\ \ \ \ \ AATGATGAACAATTGAAAGTTTTCTTTATTAGAAATTTGTCACGTTATGGAAAAGCAGAG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTACTTGTTAACTTTCAAAAGAAATAATCTTTAAACAGTGCAATACCTTTTCGTCTC / / // / / // VspI | |XmnI | | |MaeII MseI | TspDTI | | Tsp45I TspEI | | MaeIII MfeI | TaiI | SetI TspEI ApoI N D E Q L K V F F I R N L S R Y G K A E M M N N * K F S L L E I C H V M E K Q S * * T I E S F L Y * K F V T L W K S R V ----:----|----:----|----:----|----:----|----:----|----:----| L S S C N F T K K I L F K D R * P F A S * H H V I S L K R * * F N T V N H F L L I I F L Q F N E K N S I Q * T I S F C L Eco57I Eco57MI | MboI | BclI | | DpnI | | |BstKTI MaeI | | || MlyI MaeI |Hin4II* | | || PleI \ \\ \ \ \\ \ TTTATCAAAAATGCTAGTCCTAGACTGAAGGAGTTGATAGAAAAATATGGCGTGATCAAT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| AAATAGTTTTTACGATCAGGATCTGACTTCCTCAACTATCTTTTTATACCGCACTAGTTA / / / / // /// | | MaeI Eco57MI || ||PleI | Hin4II* Eco57I || |MlyI MaeI || BclI || MboI |DpnI BstKTI F I K N A S P R L K E L I E K Y G V I N L S K M L V L D * R S * * K N M A * S M Y Q K C * S * T E G V D R K I W R D Q * ----:----|----:----|----:----|----:----|----:----|----:----| N I L F A L G L S F S N I S F Y P T I L T * * F H * D * V S P T S L F I H R S * K D F I S T R S Q L L Q Y F F I A H D I AciI BsrBI | MboI | XhoII | | DpnI | | |BstKTI | | ||MaeI | | ||MwoI MboII | | ||TspDTI | FatI | | ||| MnlI | |CviAII | | ||| | BinI* HinfI | || NlaIII | | ||| | | MwoI BbvI \ \ \\ \ \ \ \\\ \ \ \ \ GATGACTCTACCGAAGAAAATGGTTGGCATGAAGTGAGCGGATCTAGCAAAAGAGGCAAG 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTGAGATGGCTTCTTTTACCAACCGTACTTCACTCGCCTAGATCGTTTTCTCCGTTC / / / // / /// /// // HinfI | | |FatI | ||| ||| |MwoI | | CviAII | ||| ||| BinI* | NlaIII | ||| ||MaeI MboII | ||| |MnlI | ||| XhoII | ||| MboI | ||TspDTI | ||DpnI | |BstKTI | |MwoI | AciI BsrBI D D S T E E N G W H E V S G S S K R G K M T L P K K M V G M K * A D L A K E A R * L Y R R K W L A * S E R I * Q K R Q E ----:----|----:----|----:----|----:----|----:----|----:----| S S E V S S F P Q C S T L P D L L L P L H H S * R L F H N A H L S R I * C F L C I V R G F F I T P M F H A S R A F S A L AciI | TseI | NspBII* Tsp4CI* | |MnlI | TaqI | |BisI | |Hpy178III* DdeI | ||BlsI | || HphI BccI \ \ \\\ \ \\ \ \ AAAACTAAGACCGCTGCCAAGAGGACTGTCGAGATTGTTCCATCACCAATCTCCAAACTT 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTGATTCTGGCGACGGTTCTCCTGACAGCTCTAACAAGGTAGTGGTTAGAGGTTTGAA / / //// / // / / | DdeI |||TseI | || HphI BccI BbvI ||BisI | |Hpy178III* |BlsI | TaqI NspBII* Tsp4CI* AciI MnlI K T K T A A K R T V E I V P S P I S K L K L R P L P R G L S R L F H H Q S P N F N * D R C Q E D C R D C S I T N L Q T F ----:----|----:----|----:----|----:----|----:----|----:----| F V L V A A L L V T S I T G D G I E L S S F * S R Q W S S Q R S Q E M V L R W V F S L G S G L P S D L N N W * W D G F K MboI CfrI BglII | BalI XhoII | CviJI Hpy188I TaqI | HaeIII | DpnI TfiI ClaI | |BsrI | |BstKTI HinfI | TspGWI \ \\ \ \\ \ \ \ TTCGGTGGCCAGTTCAGATCTGTGTTAGATATACCGAACAATAAGGAATCTCAATCGATT 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| AAGCCACCGGTCAAGTCTAGACACAATCTATATGGCTTGTTATTCCTTAGAGTTAGCTAA // / / // / / / || CfrI | || XhoII HinfI TspGWI |HaeIII | || BglII TfiI ClaI |CviJI | || MboI TaqI |BalI | |DpnI BsrI | BstKTI Hpy188I F G G Q F R S V L D I P N N K E S Q S I S V A S S D L C * I Y R T I R N L N R L R W P V Q I C V R Y T E Q * G I S I D Y ----:----|----:----|----:----|----:----|----:----|----:----| K P P W N L D T N S I G F L L S D * D I K R H G T * I Q T L Y V S C Y P I E I S E T A L E S R H * I Y R V I L F R L R N MboI BinI* | DpnI | TaqI TspEI | |XbaI | |MboI | MfeI | |BstKTI | || DpnI | TspEI Hpy188I | ||MaeI | || |BstKTI | | SfaNI | AlwNI | ||Hpy178III* \ \\ \\ \ \ \ \ \ \ \\\ ACACTCGATCCGTTCCAAACAATTCAATTGGACATTTCAGATGCTGGTGTGAATGATCTA 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| TGTGAGCTAGGCAAGGTTTGTTAAGTTAACCTGTAAAGTCTACGACCACACTTACTAGAT / // / / / / / / // / / | || MboI | | | | AlwNI || | Hpy178III* | |DpnI | | | Hpy188I || | MaeI | BstKTI | | SfaNI || MboI | TaqI | TspEI |DpnI BinI* | MfeI BstKTI TspEI T L D P F Q T I Q L D I S D A G V N D L H S I R S K Q F N W T F Q M L V * M I * T R S V P N N S I G H F R C W C E * S R ----:----|----:----|----:----|----:----|----:----|----:----| V S S G N W V I * N S M E S A P T F S R * V R D T G F L E I P C K L H Q H S H D C E I R E L C N L Q V N * I S T H I I * BsmI ApoI BsiYI* CviRI* TspEI TspEI MseI | MnlI \ \ \ \ \ \ GAAACTGCATTCAAAAAATTTAGTGAATACGAATTGCTACCCTTTAAGTCCTCGTCAGGG 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| CTTTGACGTAAGTTTTTTAAATCACTTATGCTTAACGATGGGAAATTCAGGAGCAGTCCC / / / / / / / / | | CviRI* TspEI TspEI MseI | MnlI | BsmI ApoI BsiYI* XbaI E T A F K K F S E Y E L L P F K S S S G K L H S K N L V N T N C Y P L S P R Q G N C I Q K I * * I R I A T L * V L V R E ----:----|----:----|----:----|----:----|----:----|----:----| S V A N L F N L S Y S N S G K L D E D P L F Q M * F I * H I R I A V R * T R T L F S C E F F K T F V F Q * G K L G R * P AciI BisI CviJI |BlsI MnlI TaqI HaeIII TspEI ||TauI MseI \ \ \ \ \\\ \ AATGATGTCGAGGCCAAGAAGCAGACTTTTATTGATAAATTGCCGCAAGTTCTTTTAATC 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTACAGCTCCGGTTCTTCGTCTGAAAATAACTATTTAACGGCGTTCAAGAAAATTAG / / / ///// / MnlI | HaeIII ||||AciI MseI | CviJI |||BisI TaqI ||BlsI |TauI TspEI N D V E A K K Q T F I D K L P Q V L L I M M S R P R S R L L L I N C R K F F * S * C R G Q E A D F Y * * I A A S S F N P ----:----|----:----|----:----|----:----|----:----|----:----| F S T S A L F C V K I S L N G C T R K I S H H R P W S A S K * Q Y I A A L E K L I I D L G L L L S K N I F Q R L N K * D TspDTI | TfiI TspEI | HinfI Hpy166II BsrDI \ \ \ \ \ CAATTCAAAAGATTCTCATTCATAAATAATGTGAACAAAGACAACGCAATGACGAACTAT 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| GTTAAGTTTTCTAAGAGTAAGTATTTATTACACTTGTTTCTGTTGCGTTACTGCTTGATA / / / / / | TspDTI HinfI Hpy166II BsrDI TspEI TfiI Q F K R F S F I N N V N K D N A M T N Y N S K D S H S * I M * T K T T Q * R T I I Q K I L I H K * C E Q R Q R N D E L * ----:----|----:----|----:----|----:----|----:----|----:----| W N L L N E N M F L T F L S L A I V F * G I * F I R M * L Y H S C L C R L S S S L E F S E * E Y I I H V F V V C H R V I MboI | DpnI MluI | |BstKTI MaeIII AflIII | ||Hpy178III* Tsp45I | FnuDII* MaeII | ||| MboII | BsiI* | | Csp6I | SetI | ||| | TspEI | Hpy178III* | | |RsaI | TaiI | ||| | | MseI | | MseI \ \ \\ \ \ \ \\\ \ \ \ \ \ \ AACGCGTACAATGGACGTATTGAGAAGATCAGGAAAAAAATTAAATATGGTCACGAGTTA 2410 2420 2430 2440 2450 2460 ----:----|----:----|----:----|----:----|----:----|----:----| TTGCGCATGTTACCTGCATAACTCTTCTAGTCCTTTTTTTAATTTATACCAGTGCTCAAT / /// / / // / / / // / / / | ||Csp6I | MaeII || | | MboII |MseI | | MseI | |RsaI TaiI || | | TspEI | BsiI* | AflIII SetI || | Hpy178III* Hpy178III* | MluI || MboI Tsp45I FnuDII* |DpnI MaeIII BstKTI N A Y N G R I E K I R K K I K Y G H E L T R T M D V L R R S G K K L N M V T S * R V Q W T Y * E D Q E K N * I W S R V N ----:----|----:----|----:----|----:----|----:----|----:----| L A Y L P R I S F I L F F I L Y P * S N Y R T C H V Y Q S S * S F F * I H D R T V R V I S T N L L D P F F N F I T V L * SetI | TfiI | HinfI DdeI | |MboII Eco57I SauI* | |BbvII* MboII Eco57MI |SetI MnlI \ \\ \ \ \\ \ ATCATACCTGAAGAATCAATGTCTTCCATAACATTGAAAAACAACACCTCAGGGATTGAT 2470 2480 2490 2500 2510 2520 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTATGGACTTCTTAGTTACAGAAGGTATTGTAACTTTTTGTTGTGGAGTCCCTAACTA / / / / / / / / / // SetI | | | MboII Eco57MI SetI | | |BseMII | | BbvII* Eco57I | | BspCNI | HinfI | MnlI | TfiI SauI* MboII DdeI I I P E E S M S S I T L K N N T S G I D S Y L K N Q C L P * H * K T T P Q G L M H T * R I N V F H N I E K Q H L R D * * ----:----|----:----|----:----|----:----|----:----|----:----| I M G S S D I D E M V N F F L V E P I S L * V Q L I L T K W L M S F C C R L S Q D Y R F F * H R G Y C Q F V V G * P N I AluI CviJI FatI | SetI |CviAII | MboII || BsiYI* BspCNI | | BetI* || |NlaIII Hpy188I |BseMII | | |HpaII || ||BccI BccI | AciI \\ \ \ \\ \\ \\\ \ \ \ GATAGAAGATATAAGCTAACCGGAGTTATATACCATCATGGGGTAAGTTCCGATGGCGGT 2530 2540 2550 2560 2570 2580 ----:----|----:----|----:----|----:----|----:----|----:----| CTATCTTCTATATTCGATTGGCCTCAATATATGGTAGTACCCCATTCAAGGCTACCGCCA / // // / // / / / / | |MboII |BetI* | || BccI | Hpy188I AciI | CviJI HpaII | |FatI BccI | AluI | CviAII SetI BsiYI* NlaIII D R R Y K L T G V I Y H H G V S S D G G I E D I S * P E L Y T I M G * V P M A V * K I * A N R S Y I P S W G K F R W R S ----:----|----:----|----:----|----:----|----:----|----:----| S L L Y L S V P T I Y W * P T L E S P P H Y F I Y A L R L * I G D H P L N R H R I S S I L * G S N Y V M M P Y T G I A T AciI FokI NspBII* | Cac8I | BsaBI | | SduI | |BseGI | | HgiAI* \ \\ \ \ \ CATTACACAGCGGATGTTTATCATAGCGAGCACAACAAATGGTATAGAATAGATGATGTA 2590 2600 2610 2620 2630 2640 ----:----|----:----|----:----|----:----|----:----|----:----| GTAATGTGTCGCCTACAAATAGTATCGCTCGTGTTGTTTACCATATCTTATCTACTACAT / / // // | | |BsaBI |FokI | | BseGI HgiAI* | AciI Cac8I NspBII* SduI H Y T A D V Y H S E H N K W Y R I D D V I T Q R M F I I A S T T N G I E * M M * L H S G C L S * R A Q Q M V * N R * C K ----:----|----:----|----:----|----:----|----:----|----:----| * * V A S T * * L S C L L H Y L I S S T D N C L P H K D Y R A C C I T Y F L H H M V C R I N I M A L V V F P I S Y I I Y HindIII | AluI | CviJI | | SetI | | | MnlI | | | |Hpy188I | | | ||TfiI MaeII | | | ||HinfI MnlI | SetI | | | ||MboII SspI | MaeI | TaiI SetI | | | ||| TaqI \ \ \ \ \ \ \ \ \ \\\ \ AATATTACCGAACTAGAGGACGATGACGTTTTGAAAGGTGGCGAAGAAGCTTCTGATTCG 2650 2660 2670 2680 2690 2700 ----:----|----:----|----:----|----:----|----:----|----:----| TTATAATGGCTTGATCTCCTGCTACTGCAAAACTTTCCACCGCTTCTTCGAAGACTAAGC / / / / / / / / //// / / SspI MnlI MaeI | MaeII SetI | | |||| | TaqI TaiI | | |||| HinfI SetI | | |||| TfiI | | |||MboII | | ||Hpy188I | | |MnlI | | HindIII | CviJI | AluI SetI N I T E L E D D D V L K G G E E A S D S I L P N * R T M T F * K V A K K L L I R Y Y R T R G R * R F E R W R R S F * F E ----:----|----:----|----:----|----:----|----:----|----:----| F I V S S S S S S T K F P P S S A E S E L Y * R V L P R H R K S L H R L L K Q N I N G F * L V I V N Q F T A F F S R I R TspEI MseI | MseI \ \ \ AGGACTGCCTATATTTTAATGTATCAAAAGAGAAATTAA 2710 2720 2730 ----:----|----:----|----:----|----:---- TCCTGACGGATATAAAATTACATAGTTTTCTCTTTAATT / // MseI |MseI TspEI R T A Y I L M Y Q K R N * G L P I F * C I K R E I X D C L Y F N V S K E K L X ----:----|----:----|----:----|----:---- L V A * I K I Y * F L F * S S Q R Y K L T D F S F N P S G I N * H I L L S I L # Enzymes that cut Frequency Isoschizomers AccI 3 FblI,XmiI AciI 15 BspACI,SsiI AclI 1 Psp1406I AcyI 1 BsaHI,BssNI,BstACI,Hin1I,Hsp92I AflIII 1 AluI 9 AluBI AlwNI 1 CaiI ApoI 8 AcsI,XapI AsuI* 4 Cfr13I,PspPI,Sau96I,AspS9I AvaII 2 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 9 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 12 Bce83I* 2 BpuEI BceAI 3 BclI 1 FbaI,Ksp22I BetI* 2 BsaWI BfiI 1 BmrI,BmuI BglII 1 BinI* 4 AlwI,BspPI,AclWI BisI 13 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 13 BmgT120I 4 BplI 2 BsaBI 1 Bse8I,BseJI BsaXI 1 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 3 BstF5I,BtsCI BseMII 4 BseRI 1 BsiI* 3 BssSI,Bst2BI,BauI BsiYI* 6 Bsc4I,BseLI,BslI,AfiI BsmAI 1 Alw26I,BstMAI BsmI 2 BsaMI,Mva1269I,PctI BspCNI 4 BspHI 1 CciI,PagI,RcaI BspMI 1 BfuAI,Acc36I,BveI BspMII* 1 Aor13HI,BseAI,Bsp13I,BspEI,Kpn2I,MroI,AccIII BsrBI 1 AccBSI,MbiI BsrDI 3 BseMI,Bse3DI BsrI 3 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 2 BstKTI 8 BstXI 1 BtsI 2 Cac8I 4 BstC8I CfrI 1 AcoI,EaeI ClaI 2 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 8 CviQI,RsaNI CspCI 1 CviAII 11 CviJI 26 CviKI-1 CviRI* 8 HpyCH4V DdeI 7 BstDEI,HpyF3I DinI 1 EgeI,EheI,SfoI DpnI 8 MalI DraII 1 EcoO109I DsaI* 1 BtgI,BstDSI EciI 2 Ecl136II 1 EcoICRI Eco57I 3 AcuI Eco57MI 4 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 11 FauI 1 SmuI FnuDII* 1 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 3 FspAI 1 GlaI 4 GsuI 1 BpmI HaeII 2 BstH2I HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 2 CseI HgiAI* 2 Bbv12I,BsiHKAI,Alw21I HgiCI* 1 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 4 BstHHI,CfoI,AspLEI Hin4I 4 Hin4II* 5 HpyAV Hin6I 4 HinP1I,HspAI HindII 1 HincII HindIII 2 HinfI 11 HpaII 2 HapII,BsiSI,MspI HphI 4 AsuHPI Hpy166II 6 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 7 KasI 1 Ksp632I* 5 Eam1104I,EarI,Bst6I MaeI 8 FspBI,BfaI,XspI MaeII 6 HpyCH4IV MaeIII 9 MboI 8 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 21 McrI* 1 BsiEI,BstMCI,Bsh1285I MfeI 4 MunI MluI 1 MlyI 3 SchI MmeI 2 MnlI 18 MseI 19 Tru1I,Tru9I MslI 2 RseI,SmiMI MstI* 1 AviII,FspI,NsbI,Acc16I MwoI 8 HpyF10VI,BstMWI NarI 1 Mly113I NlaIII 11 Hin1II,Hsp92II,FaeI NlaIV 5 BspLI,BmiI,PspN4I NspBII* 3 MspA1I NspI 2 BstNSI,XceI PflMI 3 BasI,AccB7I,Van91I PleI 3 PpsI PpiI 1 PsrI 1 RsaI 8 AfaI SacI 1 Psp124BI,SstI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 1 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 1 BseDI,BssECI,BsaJI SetI 31 SfaNI 10 LweI SfeI* 3 BstSFI,SfcI,BfmI SmlI 2 SmoI SspI 2 TaiI 6 TaqI 9 TatI 1 TauI 4 TfiI 8 PfeI TseI 9 ApeKI Tsp45I 4 NmuCI Tsp4CI* 9 HpyCH4III,TaaI,Bst4CI TspDTI 11 TspEI 30 TasI,Tsp509I,Sse9I TspGWI 5 TspRI 5 TscAI VspI 2 PshBI,AseI XbaI 1 XhoII 2 BstYI,MflI,PsuI,BstX2I XmnI 2 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AflII AgeI AhaIII* AjuI AlfI AloI ApaI ApaLI AscI Asp718I AsuII AvaI AvrII BaeI BamHI BarI BbvCI BcgI BciVI BdaI BglI BmeT110I BmtI Bpu10I BsaAI BsePI BseSI BseYI BsgI BslFI BsmFI Bsp120I Bsp1407I BspLU11I* BspOI BstEII BtgZI BtrI CauII* Cfr10I Cfr9I DraIII DrdI Eam1105I Eco31I Eco47III EcoNI EcoRI EcoRV EcoT22I Esp3I FalI FaqI FseI GsaI HpaI Hpy99I KpnI MauBI Mph1103I MroNI NaeI NcoI NdeI NgoMIV NheI NmeAIII NotI NruI NsiI OliI PacI PasI PfoI PmaCI PmeI PpuMI PshAI PsiI PspOMI PspXI PstI PvuI PvuII RsrII SacII SalI SanDI SapI ScaI SexAI SfiI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TsoI TspMI TstI Tth111I XcmI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769