Restriction Map of SPT15/YER148W

Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence

The currently selected gene/sequence is :

SPT15/YER148W on chromosome V from coordinates 465303 to 466025.


AclI MaeII | SetI | TaiI | |MseI CfrI | ||AhaIII* BinI* |MnlI | ||| MnlI | MboI ||CviJI | ||| | MseI | | DpnI ||HaeIII | ||| | |AhaIII* | | |BstKTI \\\ \ \\\ \ \\ \ \ \\ ATGGCCGATGAGGAACGTTTAAAGGAGTTTAAAGAGGCAAACAAGATAGTGTTTGATCCA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACCGGCTACTCCTTGCAAATTTCCTCAAATTTCTCCGTTTGTTCTATCACAAACTAGGT / / / / / // / // / // / | | CfrI | | |MseI | |MseI | || MboI | HaeIII | | | | AhaIII* | |DpnI | CviJI | | | MnlI | BstKTI MnlI | | AhaIII* BinI* | MaeII | AclI TaiI SetI M A D E E R L K E F K E A N K I V F D P W P M R N V * R S L K R Q T R * C L I Q G R * G T F K G V * R G K Q D S V * S K ----:----|----:----|----:----|----:----|----:----|----:----| X A S S S R K F S N L S A F L I T N S G X P R H P V N L P T * L P L C S L T Q D H G I L F T * L L K F L C V L Y H K I W TfiI HinfI |BccI || TaqI || |XcmI || |Hpy178III* || || Csp6I || || |RsaI Hpy178III* \\ \\ \\ \ AATACCAGACAAGTATGGGAAAACCAGAATCGAGATGGTACAAAACCAGCAACTACTTTC 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| TTATGGTCTGTTCATACCCTTTTGGTCTTAGCTCTACCATGTTTTGGTCGTTGATGAAAG // // // || || |Csp6I || || RsaI || |Hpy178III* || TaqI |HinfI |XcmI |TfiI BccI N T R Q V W E N Q N R D G T K P A T T F I P D K Y G K T R I E M V Q N Q Q L L S Y Q T S M G K P E S R W Y K T S N Y F P ----:----|----:----|----:----|----:----|----:----|----:----| F V L C T H S F W F R S P V F G A V V K L Y W V L I P F G S D L H Y L V L L * K I G S L Y P F V L I S I T C F W C S S E TseI AluI TfiI CviJI HinfI |BisI | AlwNI Ksp632I* ||BlsI | | Hpy188I SetI |MnlI BbvI MboII ||SetI | | | EciI |AciI MnlI \\ \ \ \\\ \ \ \ \ \\ \ CAGAGTGAAGAGGACATAAAAAGAGCTGCCCCAGAATCTGAAAAAGACACCTCCGCCACA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GTCTCACTTCTCCTGTATTTTTCTCGACGGGGTCTTAGACTTTTTCTGTGGAGGCGGTGT / / / / / //// / // / / / / | Ksp632I* | | | |||TseI | || EciI SetI | MnlI Hpy178III* | | | ||BisI | |Hpy188I AciI MnlI | | | |BlsI | HinfI | | | CviJI | TfiI | | | AluI AlwNI | | SetI | MboII BbvI Q S E E D I K R A A P E S E K D T S A T R V K R T * K E L P Q N L K K T P P P H E * R G H K K S C P R I * K R H L R H I ----:----|----:----|----:----|----:----|----:----|----:----| W L S S S M F L A A G S D S F S V E A V G S H L P C L F L Q G L I Q F L C R R W L T F L V Y F S S G W F R F F V G G G C MmeI CviRI* | MaeIII | SetI | Tsp45I | | MboI | Tsp4CI* | | BglII SetI | | BspMI | | XhoII \ \ \ \ \ \ \ TCAGGTATTGTTCCAACACTACAAAACATTGTGGCAACTGTGACTTTGGGGTGCAGGTTA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| AGTCCATAACAAGGTTGTGATGTTTTGTAACACCGTTGACACTGAAACCCCACGTCCAAT / / / / / // SetI | | | | |SetI | | | | CviRI* | | | BspMI | | Tsp45I | | MaeIII | Tsp4CI* MmeI S G I V P T L Q N I V A T V T L G C R L Q V L F Q H Y K T L W Q L * L W G A G * R Y C S N T T K H C G N C D F G V Q V R ----:----|----:----|----:----|----:----|----:----|----:----| D P I T G V S C F M T A V T V K P H L N M L Y Q E L V V F C Q P L Q S K P T C T * T N N W C * L V N H C S H S Q P A P * DpnI |BstKTI || Hpy188I || | BsgI || | Tsp4CI* || | | Hin6I || | | |GlaI || | | ||HhaI || | | ||| FatI || | | ||| |MwoI || | | ||| |CviAII || | | ||| || NspI || | | ||| || NlaIII || | | ||| || | MwoI TseI || | | ||| || | EcoP15I |BisI || | | ||| || | | CviRI* BbvI ||BlsI \\ \ \ \\\ \\ \ \ \ \ \\\ GATCTGAAAACAGTTGCGCTACATGCCCGTAATGCAGAATATAACCCCAAGCGTTTTGCT 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGACTTTTGTCAACGCGATGTACGGGCATTACGTCTTATATTGGGGTTCGCAAAACGA // / // //// / // / // / // || | || |||| | || MwoI |CviRI* BbvI |BisI || | || |||| | |FatI EcoP15I BlsI || | || |||| | CviAII || | || |||| NlaIII || | || |||| NspI || | || |||MwoI || | || ||Hin6I || | || |GlaI || | || HhaI || | |Tsp4CI* || | BsgI || Hpy188I || XhoII || BglII || MboI |DpnI BstKTI D L K T V A L H A R N A E Y N P K R F A I * K Q L R Y M P V M Q N I T P S V L L S E N S C A T C P * C R I * P Q A F C C ----:----|----:----|----:----|----:----|----:----|----:----| S R F V T A S C A R L A S Y L G L R K A L D S F L Q A V H G Y H L I Y G W A N Q I Q F C N R * M G T I C F I V G L T K S SfeI* | AluI | CviJI FatI | | SetI |CviAII | | |MseI DdeI || NlaIII CviJI | | ||TspEI SauI* MnlI \\ \ \ \ \ \\\ \ \ GCTGTCATCATGCGTATTAGAGAGCCAAAAACTACAGCTTTAATTTTTGCCTCAGGGAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CGACAGTAGTACGCATAATCTCTCGGTTTTTGATGTCGAAATTAAAAACGGAGTCCCTTT / / // / /// / / / / TseI | |FatI CviJI ||| | TspEI | MnlI | CviAII ||| MseI SauI* NlaIII ||CviJI DdeI ||AluI |SfeI* SetI A V I M R I R E P K T T A L I F A S G K L S S C V L E S Q K L Q L * F L P Q G K C H H A Y * R A K N Y S F N F C L R E N ----:----|----:----|----:----|----:----|----:----|----:----| A T M M R I L S G F V V A K I K A E P F Q Q * * A Y * L A L F * L K L K Q R L S S D D H T N S L W F S C S * N K G * P F AluI BspCNI CviJI |BseMII |FokI ||MaeIII ||CfrI ||| AgeI ||SetI ||| BetI* ||Cac8I ||| Cfr10I ||| BalI ||| |HpaII ||| CviJI ||| || BplI ||| HaeIII ||| || BplI ||| |BsrI ||| || CviRI* MlyI HinfI ||| || BplI ||| || | MnlI PleI | BseGI ||| || BplI CviRI* \\\ \\ \ \ \ \ \ \\\ \\ \ \ ATGGTTGTTACCGGTGCAAAAAGTGAGGATGACTCAAAGCTGGCCAGTAGAAAATATGCA 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TACCAACAATGGCCACGTTTTTCACTCCTACTGAGTTTCGACCGGTCATCTTTTATACGT // / // // // / / / / ///// / |BseMII | || |MnlI |PleI | | | | ||||CfrI CviRI* BspCNI | || CviRI* MlyI | | | | |||FokI | |Cfr10I | | | | ||HaeIII | |BetI* | | | | ||CviJI | |AgeI | | | | ||BplI | HpaII | | | | ||BplI MaeIII | | | | ||BalI BplI | | | | |BsrI BplI | | | | Cac8I | | | CviJI | | | AluI | | SetI | HinfI BseGI M V V T G A K S E D D S K L A S R K Y A W L L P V Q K V R M T Q S W P V E N M Q G C Y R C K K * G * L K A G Q * K I C K ----:----|----:----|----:----|----:----|----:----|----:----| I T T V P A F L S S S E F S A L L F Y A F P Q * R H L F H P H S L A P W Y F I H H N N G T C F T L I V * L Q G T S F I C TseI |BisI ||BlsI ||| ApoI TspEI BbvI ||| TspEI SspI \ \ \\\ \ \ AGAATTATCCAAAAAATCGGGTTTGCTGCTAAATTCACAGACTTCAAAATACAAAATATT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTAATAGGTTTTTTAGCCCAAACGACGATTTAAGTGTCTGAAGTTTTATGTTTTATAA / / /// / / TspEI BbvI ||TseI TspEI SspI |BisI ApoI BlsI R I I Q K I G F A A K F T D F K I Q N I E L S K K S G L L L N S Q T S K Y K I L N Y P K N R V C C * I H R L Q N T K Y C ----:----|----:----|----:----|----:----|----:----|----:----| L I I W F I P N A A L N V S K L I C F I L F * G F F R T Q Q * I * L S * F V F Y S N D L F D P K S S F E C V E F Y L I N MaeIII Tsp45I MaeII | MaeII |Hin4II* FatI | | MseI || XbaI |CviAII | | SetI || SetI || BseRI | | TaiI || TaiI || |NlaIII | | | ApoI || |MaeI || ||Csp6I | | | TspEI || |Hpy178III* BsmI || |||RsaI \ \ \ \ \\ \\ \ \\ \\\\ GTCGGTTCGTGTGACGTTAAATTCCCTATACGTCTAGAAGGGTTAGCATTCAGTCATGGT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCCAAGCACACTGCAATTTAAGGGATATGCAGATCTTCCCAATCGTAAGTCAGTACCA / // / / // / // / // // / | || | TspEI || | |XbaI BsmI || || RsaI | || | ApoI || | Hpy178III* || |FatI | || MseI || | MaeI || CviAII | |MaeII || MaeII |BseRI | Tsp45I |Hin4II* NlaIII | MaeIII TaiI TaiI SetI SetI V G S C D V K F P I R L E G L A F S H G S V R V T L N S L Y V * K G * H S V M V R F V * R * I P Y T S R R V S I Q S W Y ----:----|----:----|----:----|----:----|----:----|----:----| T P E H S T L N G I R R S P N A N L * P Q R N T H R * I G * V D L L T L M * D H D T R T V N F E R Y T * F P * C E T M T MnlI CviJI | TspEI | | XmnI | | | BssKI MboI | | | EcoRII | DpnI | | | | ScrFI | |BstKTI | | | | BseBI | ||SfeI* CviJI \ \ \ \ \ \ \\\ \ ACTTTCTCCTCCTATGAGCCAGAATTGTTTCCTGGTTTGATCTATAGAATGGTGAAGCCG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGAAAGAGGAGGATACTCGGTCTTAACAAAGGACCAAACTAGATATCTTACCACTTCGGC / // / / / // / / / Csp6I |CviJI TspEI | | || | SfeI* CviJI MnlI XmnI | | || MboI | | |DpnI | | BstKTI | EcoRII | BssKI BseBI ScrFI T F S S Y E P E L F P G L I Y R M V K P L S P P M S Q N C F L V * S I E W * S R F L L L * A R I V S W F D L * N G E A E ----:----|----:----|----:----|----:----|----:----|----:----| V K E E * S G S N N G P K I * L I T F G Y K R R R H A L I T E Q N S R Y F P S A S E G G I L W F Q K R T Q D I S H H L R BsrI TspEI MseI |CviRI* |HphI |TspEI AloI Hpy178III* || AloI \\ \\ \ \ \\ \ AAAATTGTGTTGTTAATTTTTGTTTCAGGAAAGATTGTTCTTACTGGTGCAAAGCAAAGG 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTAACACAACAATTAAAAACAAAGTCCTTTCTAACAAGAATGACCACGTTTCGTTTCC / / / / / // / | TspEI | TspEI Hpy178III* || CviRI* HphI MseI |AloI AloI BsrI K I V L L I F V S G K I V L T G A K Q R K L C C * F L F Q E R L F L L V Q S K G N C V V N F C F R K D C S Y W C K A K G ----:----|----:----|----:----|----:----|----:----|----:----| F I T N N I K T E P F I T R V P A F C L S F Q T T L K Q K L F S Q E * Q H L A F F N H Q * N K N * S L N N K S T C L L P MboII |HindIII || AluI || CviJI || | SetI || | | MwoI || | | | AluI ApoI || | | | CviJI ApoI TspEI || | | | | SetI DdeI TspEI \ \\ \ \ \ \ \ \ \ GAAGAAATTTACCAAGCTTTTGAAGCTATATACCCTGTGCTAAGTGAATTTAGAAAAATG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCTTTAAATGGTTCGAAAACTTCGATATATGGGACACGATTCACTTAAATCTTTTTAC / / / / // / / / / | | | | || | CviJI DdeI TspEI | | | | || | AluI ApoI | | | | || SetI | | | | |MwoI | | | | HindIII | | | CviJI | | | AluI | | SetI | MboII TspEI ApoI E E I Y Q A F E A I Y P V L S E F R K M K K F T K L L K L Y T L C * V N L E K C R N L P S F * S Y I P C A K * I * K N V ----:----|----:----|----:----|----:----|----:----|----:----| S S I * W A K S A I Y G T S L S N L F I P L F K G L K Q L * I G Q A L H I * F F F F N V L S K F S Y V R H * T F K S F H TGA --- ACT * X X --- H T S # Enzymes that cut Frequency Isoschizomers AciI 1 BspACI,SsiI AclI 1 Psp1406I AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 2 DraI AloI 1 AluI 5 AluBI AlwNI 1 CaiI ApoI 4 AcsI,XapI BalI 1 MlsI,MluNI,MscI,Msp20I BbvI 3 BseXI,BstV1I,Lsp1109I BccI 1 BetI* 1 BsaWI BglII 1 BinI* 1 AlwI,BspPI,AclWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BplI 2 BseBI 1 Bst2UI,BstNI,BstOI,MvaI BseGI 1 BstF5I,BtsCI BseMII 1 BseRI 1 BsgI 1 BsmI 1 BsaMI,Mva1269I,PctI BspCNI 1 BspMI 1 BfuAI,Acc36I,BveI BsrI 2 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstKTI 3 Cac8I 1 BstC8I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI Csp6I 2 CviQI,RsaNI CviAII 3 CviJI 10 CviKI-1 CviRI* 5 HpyCH4V DdeI 2 BstDEI,HpyF3I DpnI 3 MalI EciI 1 EcoP15I 1 EcoRII 1 AjnI,Psp6I,PspGI FatI 3 FokI 1 GlaI 1 HaeIII 2 BsnI,BsuRI,BshFI,PhoI HhaI 1 BstHHI,CfoI,AspLEI Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HindIII 1 HinfI 3 HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy178III* 4 Hpy188III Hpy188I 2 Ksp632I* 1 Eam1104I,EarI,Bst6I MaeI 1 FspBI,BfaI,XspI MaeII 3 HpyCH4IV MaeIII 3 MboI 3 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 2 MlyI 1 SchI MmeI 1 MnlI 7 MseI 5 Tru1I,Tru9I MwoI 3 HpyF10VI,BstMWI NlaIII 3 Hin1II,Hsp92II,FaeI NspI 1 BstNSI,XceI PleI 1 PpsI RsaI 2 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 1 BmrFI,MspR9I,Bme1390I SetI 11 SfeI* 2 BstSFI,SfcI,BfmI SspI 1 TaiI 3 TaqI 1 TfiI 2 PfeI TseI 3 ApeKI Tsp45I 2 NmuCI Tsp4CI* 2 HpyCH4III,TaaI,Bst4CI TspEI 9 TasI,Tsp509I,Sse9I XbaI 1 XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AflIII AjuI AlfI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BamHI BarI BbvCI BbvII* Bce83I* BceAI BcgI BciVI BclI BdaI BfiI BglI BmeT110I BmgT120I BmtI Bpu10I BsaAI BsaBI BsaXI BsePI BseSI BseYI BsiI* BsiYI* BslFI BsmAI BsmFI Bsp120I Bsp1407I BspHI BspLU11I* BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I BstAPI BstEII BstXI BstZ17I BtgZI BtrI BtsI CauII* Cfr9I ClaI CspCI DinI DraII DraIII DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoRI EcoRV EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FauI FnuDII* FseI FspAI GsaI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* Hin4I HindII HpaI Hpy166II Hpy8I Hpy99I KasI KpnI MauBI McrI* MfeI MluI Mph1103I MroNI MslI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NlaIV NmeAIII NotI NruI NsiI NspBII* OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI ScaI SduI SecI* SexAI SfaNI SfiI SfoI SgfI SgrAI SgrDI SmaI SmlI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyI SwaI TaqII TatI TauI TsoI TspDTI TspGWI TspMI TspRI TstI Tth111I VspI XhoI XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769