Restriction Map of RSP5/YER125W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RSP5/YER125W on chromosome V from coordinates 410189 to 412618.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.10981

TseI CviJI |BisI |SfeI* ||BlsI TspGWI |||CviRI* MnlI | MaeII TspGWI Hin4II* |||| PstI |PleI | | SetI |BseGI | BbvI |||| |HinfI ||MlyI | | TaiI \\ \ \ \\\\ \\ \\\ \ \ \ ATGCCTTCATCCATATCCGTCAAGTTAGTGGCTGCAGAGTCATTATATAAGAGGGACGTA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACGGAAGTAGGTATAGGCAGTTCAATCACCGACGTCTCAGTAATATATTCTCCCTGCAT // / / //// / / / / / / / |BseGI Hin4II* BbvI |||| | | | | | | MaeII TspGWI |||| | | | | | TaiI |||| | | | | | SetI |||| | | | | TspGWI |||| | | | PleI |||| | | | MlyI |||| | | MnlI |||| | HinfI |||| SfeI* |||CviRI* |||TseI ||BisI |BlsI |PstI CviJI M P S S I S V K L V A A E S L Y K R D V C L H P Y P S S * W L Q S H Y I R G T Y A F I H I R Q V S G C R V I I * E G R I ----:----|----:----|----:----|----:----|----:----|----:----| X G E D M D T L N T A A S D N Y L L S T X A K M W I R * T L P Q L T M I Y S P R H R * G Y G D L * H S C L * * I L P V Y TspGWI | BinI* | BslFI | |BssKI | |SecI* | ||BsiYI* | |||HpaII | |||ScrFI | |||CauII* | |||| MboI | |||| BamHI | |||| XhoII | |||| | DpnI | |||| | NlaIV TsoI MaeIII | |||| | |BstKTI Hpy188I BstEII | |||| | || BinI* | BccI | FokI BseGI \ \\\\ \ \\ \ \ \ \ \ \ TTCCGTTCCCCGGATCCGTTTGCTGTTCTGACTATTGATGGTTACCAAACCAAATCTACA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AAGGCAAGGGGCCTAGGCAAACGACAAGACTGATAACTACCAATGGTTTGGTTTAGATGT / / / //// / / // / / / / | | | |||| | BinI* || BccI | FokI BseGI | | | |||| XhoII |Hpy188I BstEII | | | |||| BamHI TsoI MaeIII | | | |||| MboI | | | |||NlaIV | | | |||DpnI | | | ||BstKTI | | | ||BssKI | | | |SecI* | | | |HpaII | | | CauII* | | | BslFI | | | ScrFI | | BinI* | BsiYI* TspGWI F R S P D P F A V L T I D G Y Q T K S T S V P R I R L L F * L L M V T K P N L H P F P G S V C C S D Y * W L P N Q I Y I ----:----|----:----|----:----|----:----|----:----|----:----| N R E G S G N A T R V I S P * W V L D V I G N G P D T Q Q E S * Q H N G F W I * E T G R I R K S N Q S N I T V L G F R C AclI BbvI MaeII AciI | MseI | TseI | SetI ApoI | |BisI | TaiI BsmAI TspEI Hpy99I | ||BlsI | | MboII | BsrI | TaqI | EcoRV \ \\\ \ \ \ \ \ \ \ \ \ TCCGCAGCGAAGAAAACGTTAAATCCCTACTGGAATGAGACTTTCAAATTCGACGATATC 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| AGGCGTCGCTTCTTTTGCAATTTAGGGATGACCTTACTCTGAAAGTTTAAGCTGCTATAG //// / / // / / / / / |||TseI | | |MseI | BsmAI | TaqI EcoRV ||BisI | | MboII BsrI Hpy99I |BlsI | | BbvI TspEI AciI | MaeII ApoI | AclI TaiI SetI S A A K K T L N P Y W N E T F K F D D I P Q R R K R * I P T G M R L S N S T I S R S E E N V K S L L E * D F Q I R R Y Q ----:----|----:----|----:----|----:----|----:----|----:----| D A A F F V N F G * Q F S V K L N S S I M R L S S F T L D R S S H S K * I R R Y G C R L F R * I G V P I L S E F E V I D ApoI TspEI | MseI | |Hin4II* | |AhaIII* MboI | || FalI BclI | || FalI ApoI MseI TsoI | || | MboI TspEI |TspDTI | DpnI | || | | DpnI |FokI || BseGI BccI | |BstKTI | || | | |BstKTI \\ \\ \ \ \ \\ \ \\ \ \ \\ AATGAAAATTCTATTTTAACCATCCAAGTCTTTGATCAAAAGAAATTTAAAAAGAAGGAT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| TTACTTTTAAGATAAAATTGGTAGGTTCAGAAACTAGTTTTCTTTAAATTTTTCTTCCTA // / / / / // / /// // || | BseGI | | || BclI ||MseI |DpnI || | MseI | | || MboI |AhaIII* BstKTI || TspDTI | | |DpnI |FalI |FokI | | BstKTI |FalI TspEI | TsoI Hin4II* ApoI BccI TspEI ApoI N E N S I L T I Q V F D Q K K F K K K D M K I L F * P S K S L I K R N L K R R I * K F Y F N H P S L * S K E I * K E G S ----:----|----:----|----:----|----:----|----:----|----:----| L S F E I K V M W T K S * F F N L F F S * H F N * K L W G L R Q D F S I * F S P I F I R N * G D L D K I L L F K F L L I MseI |HpaI |HindII |Hpy166II ||TaqII |||MaeII |||| FalI AsuI* |||| FalI |HphI |||| |SetI |BmgT120I |||| |TaiI ||CviJI BinI* |||| ||AciI ||HaeIII | TsoI |||| ||| FnuDII* ||| MslI BseGI \ \ \\\\ \\\ \ \\\ \ \ CAAGGGTTTCTTGGCGTGGTTAACGTCCGCGTGGGTGATGTTTTGGGCCATTTGGATGAA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCCCAAAGAACCGCACCAATTGCAGGCGCACCCACTACAAAACCCGGTAAACCTACTT / // /// / / / // / / | |BinI* ||| | FnuDII* | || MslI BseGI | TsoI ||| | AciI | |AsuI* MboI ||| MaeII | BmgT120I ||MseI | HaeIII ||TaiI | CviJI ||SetI HphI |Hpy166II |HindII |HpaI TaqII FalI FalI Q G F L G V V N V R V G D V L G H L D E K G F L A W L T S A W V M F W A I W M K R V S W R G * R P R G * C F G P F G * R ----:----|----:----|----:----|----:----|----:----|----:----| * P N R P T T L T R T P S T K P W K S S D L T E Q R P * R G R P H H K P G N P H L P K K A H N V D A H T I N Q A M Q I F AccI |Hpy166II || SetI MboII FokI || |Hpy178III* |BsiI* | MboII || ||NruI || Hpy178III* | |TspDTI || ||FnuDII* || | MseI | || TaqI || ||| MnlI || | |AhaIII* \ \\ \ \\ \\\ \ \\ \ \\ GATACTGCTACATCGAGTGGTAGACCTCGCGAAGAAACTATTACTCGTGATTTAAAAAAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTATGACGATGTAGCTCACCATCTGGAGCGCTTCTTTGATAATGAGCACTAAATTTTTTT / / / // // / / / // | | TaqI |AccI || MnlI MboII | |MseI | FokI |SetI |Hpy178III* | AhaIII* TspDTI | FnuDII* Hpy178III* MboII | NruI BsiI* Hpy166II D T A T S S G R P R E E T I T R D L K K I L L H R V V D L A K K L L L V I * K N Y C Y I E W * T S R R N Y Y S * F K K I ----:----|----:----|----:----|----:----|----:----|----:----| S V A V D L P L G R S S V I V R S K F F L Y Q * M S H Y V E R L F * * E H N L F I S S C R T T S R A F F S N S T I * F F CfrI AciI | CviJI TspGWI BceAI | HaeIII NspBII* SetI SetI \ \ \ \ \ \ TCTAATGACGGAATGGCCGTCAGCGGTAGGTTGATTGTTGTTTTATCAAAACTACCTTCG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| AGATTACTGCCTTACCGGCAGTCGCCATCCAACTAACAACAAAATAGTTTTGATGGAAGC / / / / / / / / BceAI | | | | | SetI SetI | | | | AciI | | | NspBII* | | TspGWI | CfrI HaeIII CviJI S N D G M A V S G R L I V V L S K L P S L M T E W P S A V G * L L F Y Q N Y L R * * R N G R Q R * V D C C F I K T T F V ----:----|----:----|----:----|----:----|----:----|----:----| D L S P I A T L P L N I T T K D F S G E I * H R F P R * R Y T S Q Q K I L V V K R I V S H G D A T P Q N N N * * F * R R CfrI | BalI | CviJI | HaeIII MaeI Hin4II* AluI | | MboII | SfaNI | AciI CviJI | | Hin4II* | |Csp6I | | BsmI | SetI | | | CviRI* | ||RsaI \ \ \ \ \ \ \ \ \ \ \\\ TCAAGTCCGCATTCACAAGCTCCTTCTGGCCATACTGCATCTTCTAGTACGAATACAAGT 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTCAGGCGTAAGTGTTCGAGGAAGACCGGTATGACGTAGAAGATCATGCTTATGTTCA / / / / / / / / / /// | | AciI | CviJI | | CviRI* | ||SfaNI | BsmI | AluI | Hin4II* | |Csp6I Hin4II* SetI | MboII | RsaI | CfrI MaeI HaeIII CviJI BalI S S P H S Q A P S G H T A S S S T N T S Q V R I H K L L L A I L H L L V R I Q V K S A F T S S F W P Y C I F * Y E Y K F ----:----|----:----|----:----|----:----|----:----|----:----| D L G C E C A G E P W V A D E L V F V L T L D A N V L E K Q G Y Q M K * Y S Y L * T R M * L S R R A M S C R R T R I C T MaeII | SetI | TaiI | | BseGI MnlI | | | BsmAI TaqI | FokI | | | Esp3I \ \ \ \ \ \ \ TCAACTACTCGAACAAATGGTCATTCTACTTCCTCCACCCGTAATCATTCAACGTCTCAT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| AGTTGATGAGCTTGTTTACCAGTAAGATGAAGGAGGTGGGCATTAGTAAGTTGCAGAGTA / / / / // / TaqI MnlI | | || MnlI | | |BseGI | | MaeII | TaiI | SetI FokI S T T R T N G H S T S S T R N H S T S H Q L L E Q M V I L L P P P V I I Q R L I N Y S N K W S F Y F L H P * S F N V S S ----:----|----:----|----:----|----:----|----:----|----:----| E V V R V F P * E V E E V R L * E V D * N L * E F L H D N * K R W G Y D N L T E * S S S C I T M R S G G G T I M * R R M MnlI | EcoNI | Hpy178III* | | BsiYI* | | | HgiCI* | | | |Hin4II* TseI | | | ||NlaIV AluI | | | ||| AciI CviJI | | | ||| | Hin6I Ksp632I* PvuII | | | ||| | FnuDII* |BbvI NspBII* | | | ||| | |GlaI TfiI || AciI |BisI | | | ||| | ||HhaI MboII || | Csp6I ||BlsI | | | ||| | ||| Cac8I HinfI || | |RsaI ||SetI \ \ \ \\\ \ \\\ \ \ \\ \ \\ \\\ CCTTCCAGAGGCACCGCGCAAGCAGTAGAATCAACTCTTCAAAGCGGTACAACAGCTGCT 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| GGAAGGTCTCCGTGGCGCGTTCGTCATCTTAGTTGAGAAGTTTCGCCATGTTGTCGACGA // // / / / /// / / / / / // / //// || || | | | ||| Cac8I | HinfI | | || | |||TseI || || | | | ||Hin6I | TfiI | | || | ||BisI || || | | | |GlaI MboII | | || | |BlsI || || | | | FnuDII* | | || | NspBII* || || | | | AciI | | || | PvuII || || | | | HhaI | | || | CviJI || || | | HgiCI* | | || | AluI || || | NlaIV | | || SetI || || Hin4II* | | |Csp6I || |Hpy178III* | | RsaI || EcoNI | AciI |BsiYI* | BbvI Esp3I Ksp632I* BsmAI P S R G T A Q A V E S T L Q S G T T A A L P E A P R K Q * N Q L F K A V Q Q L L F Q R H R A S S R I N S S K R Y N S C Y ----:----|----:----|----:----|----:----|----:----|----:----| G E L P V A C A T S D V R * L P V V A A D K W L C R A L L L I L E E F R Y L L Q R G S A G R L C Y F * S K L A T C C S S HphI | BsrI | | MaeIII | | Tsp45I | | | BceAI | | | | Tsp4CI* BseGI TspRI | | | | | FokI TspEI | BsrI | MboII \ \ \ \ \ \ \ \ \ \ \ ACTAATACGGCAACAACCAGTCACCGTTCCACCAATTCCACATCCAGTGCTACCAGACAA 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGATTATGCCGTTGTTGGTCAGTGGCAAGGTGGTTAAGGTGTAGGTCACGATGGTCTGTT / / // / // / / | BsrI |BceAI FokI || TspRI MboII HphI Tsp4CI* || BsrI Tsp45I |BseGI MaeIII TspEI T N T A T T S H R S T N S T S S A T R Q L I R Q Q P V T V P P I P H P V L P D N * Y G N N Q S P F H Q F H I Q C Y Q T I ----:----|----:----|----:----|----:----|----:----|----:----| V L V A V V L * R E V L E V D L A V L C * * Y P L L W D G N W W N W M W H * W V S I R C C G T V T G G I G C G T S G S L Hpy166II | BssKI | SecI* | EcoRII | | ScrFI | | BseBI BsrI | | | BsiYI* AsuI* | BbvII* | | | |BsiYI* AvaII Ksp632I* | | MboII | | | || Hin4II* |BmgT120I \ \ \ \ \ \ \ \\ \ \\ TACTCTTCGTTTGAAGACCAGTATGGTCGTTTACCCCCTGGTTGGGAGAGAAGGACCGAT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| ATGAGAAGCAAACTTCTGGTCATACCAGCAAATGGGGGACCAACCCTCTCTTCCTGGCTA / / / / //// / // | BsrI BbvII* | |||| Hin4II* |AvaII Ksp632I* MboII | |||EcoRII |AsuI* | |||BssKI BmgT120I | ||SecI* | |BsiYI* | |BseBI | |ScrFI | BsiYI* Hpy166II Y S S F E D Q Y G R L P P G W E R R T D T L R L K T S M V V Y P L V G R E G P I L F V * R P V W S F T P W L G E K D R * ----:----|----:----|----:----|----:----|----:----|----:----| Y E E N S S W Y P R K G G P Q S L L V S I S K T Q L G T H D N V G Q N P S F S R V R R K F V L I T T * G R T P L S P G I MaeII | TaqI | SetI | TaiI | |MboI TaqII | ||Hpy99I MaeII |Csp6I | |||DpnI | SetI ||RsaI | ||||BstKTI | TaiI \\\ \ \\\\\ \ \ AACTTTGGTCGTACATATTACGTCGATCATAACACAAGGACTACCACTTGGAAACGTCCA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| TTGAAACCAGCATGTATAATGCAGCTAGTATTGTGTTCCTGATGGTGAACCTTTGCAGGT / // // / // / / / | |Csp6I || | || MboI | MaeII | RsaI || | |DpnI TaiI TaqII || | BstKTI SetI || | TaqI || MaeII |Hpy99I TaiI SetI N F G R T Y Y V D H N T R T T T W K R P T L V V H I T S I I T Q G L P L G N V Q L W S Y I L R R S * H K D Y H L E T S N ----:----|----:----|----:----|----:----|----:----|----:----| L K P R V Y * T S * L V L V V V Q F R G Y S Q D Y M N R R D Y C L S * W K S V D V K T T C I V D I M V C P S G S P F T W CviJI TspEI TaqI | MmeI | MseI |MboI | | MaeII | | BseMII || DpnI | | | SetI | | |BspCNI || |BstKTI | | | TaiI | | ||CviRI* DdeI Hin4II* \\ \\ \ \ \ \ \ \ \\\ \ \ ACGCTCGATCAAACAGAAGCCGAACGTGGCAACCAATTAAATGCAAATACTGAGTTAGAG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| TGCGAGCTAGTTTGTCTTCGGCTTGCACCGTTGGTTAATTTACGTTTATGACTCAATCTC // / // / / /// / / / || MboI || | MaeII ||| CviRI* | Hin4II* |DpnI || TaiI ||BspCNI DdeI BstKTI || SetI |BseMII TaqI |MmeI |MseI CviJI TspEI T L D Q T E A E R G N Q L N A N T E L E R S I K Q K P N V A T N * M Q I L S * R A R S N R S R T W Q P I K C K Y * V R E ----:----|----:----|----:----|----:----|----:----|----:----| V S S * V S A S R P L W N F A F V S N S L A R D F L L R V H C G I L H L Y Q T L R E I L C F G F T A V L * I C I S L * L BssKI SexAI EcoRII | ScrFI | BseBI | MboII | |SetI | || MboI | || Hin4I | || | DpnI | || | |BstKTI TseI | || | || BinI* MaeIII |BisI | || | || Hpy188I | MnlI ||BlsI BbvI | || | || | TspEI | Tsp4CI* \\\ \ \ \\ \ \\ \ \ \ \ AGAAGGCAGCATAGGGGAAGAACTTTACCTGGTGGATCATCAGATAATTCCTCTGTAACA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTCCGTCGTATCCCCTTCTTGAAATGGACCACCTAGTAGTCTATTAAGGAGACATTGT /// / / /// / // / / / / / ||TseI | | ||| | || | | BinI* TspEI Tsp4CI* |BisI | | ||| | || | Hpy188I MaeIII BlsI | | ||| | || MboI MnlI | | ||| | |DpnI | | ||| | BstKTI | | ||| EcoRII | | ||| SexAI | | ||| BssKI | | ||BseBI | | ||ScrFI | | |Hin4I | | MboII | SetI BbvI R R Q H R G R T L P G G S S D N S S V T E G S I G E E L Y L V D H Q I I P L * Q K A A * G K N F T W W I I R * F L C N S ----:----|----:----|----:----|----:----|----:----|----:----| L L C C L P L V K G P P D D S L E E T V S F A A Y P F F K V Q H I M L Y N R Q L S P L M P S S S * R T S * * I I G R Y C MseI | BsiYI* | | TseI | | CviRI* | | |BisI | | ||BlsI | | |||TseI | | ||||BisI | | |||||BlsI | | ||||||TseI | | ||||||MwoI | | |||||||BisI | | ||||||||BlsI | | |||||||||TseI | | |||||||||MwoI | | ||||||||||BisI | | |||||||||||BlsI | | ||||||||||||BbvI | | ||||||||||||| MwoI MnlI SetI | | ||||||||||||| BbvI | Hin4I | NlaIV SetI | |MnlI ||||||||||||| BstAPI \ \ \ \ \ \ \\ \\\\\\\\\\\\\ \ GTTCAAGTGGGAGGTGGTTCCAATATACCTCCTGTTAATGGTGCAGCAGCAGCAGCGTTT 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGTTCACCCTCCACCAAGGTTATATGGAGGACAATTACCACGTCGTCGTCGTCGCAAA / / / / / / / ///////////// /// | MnlI SetI NlaIV SetI | MnlI ||||||||||||| ||BsgI Hin4I | MseI ||||||||||||| |BbvI BsiYI* ||||||||||||| MwoI ||||||||||||BstAPI ||||||||||||MwoI ||||||||||||TseI |||||||||||BisI ||||||||||BlsI |||||||||TseI ||||||||BisI |||||||BlsI ||||||MwoI ||||||TseI |||||BisI ||||BlsI |||MwoI |||TseI ||BisI |BlsI CviRI* V Q V G G G S N I P P V N G A A A A A F F K W E V V P I Y L L L M V Q Q Q Q R L S S G R W F Q Y T S C * W C S S S S V C ----:----|----:----|----:----|----:----|----:----|----:----| T * T P P P E L I G G T L P A A A A A N L E L P L H N W Y V E Q * H H L L L L T N L H S T T G I Y R R N I T C C C C R K SetI TseI |BbvI MwoI |Acc65I BbvI |HgiCI* CviRI* ||Csp6I BseYI |BisI ||EcoP15I CviJI |BsgI |||RsaI | GsuI ||BlsI |||NlaIV | Eco57MI |||AluI |||| KpnI | Hin4II* |||BbvI |||| EcoP15I | |GsaI |||CviJI |||| | EcoP15I | || TseI ||||SfeI* |||| | | Eco57I | || |BisI |||||SetI |||| | | Eco57MI TspEI SetI | || ||BlsI \\\\\\ \\\\ \ \ \ \ \ \ \\ \\\ GCAGCTACAGGTGGTACCACATCTGGTTTAGGCGAATTACCTTCAGGCTGGGAGCAGCGA 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CGTCGATGTCCACCATGGTGTAGACCAAATCCGCTTAATGGAAGTCCGACCCTCGTCGCT ///// // / /// / / / / /// / /// ||||| || | ||| | | Eco57MI TspEI ||| | ||TseI ||||| || | ||| | | Eco57I SetI ||| | |BisI ||||| || | ||| | EcoP15I ||| | BlsI ||||| || | ||| EcoP15I ||| BseYI ||||| || | ||HgiCI* ||Hin4II* ||||| || | ||Acc65I |Eco57MI ||||| || | ||BbvI |GsuI ||||| || | |EcoP15I CviJI ||||| || | |Csp6I GsaI ||||| || | NlaIV ||||| || | RsaI ||||| || KpnI ||||| |SfeI* ||||| BbvI ||||| SetI ||||BbvI |||CviJI |||TseI |||AluI ||BisI |BbvI |BlsI |SetI CviRI* A A T G G T T S G L G E L P S G W E Q R Q L Q V V P H L V * A N Y L Q A G S S D S Y R W Y H I W F R R I T F R L G A A I ----:----|----:----|----:----|----:----|----:----|----:----| A A V P P V V D P K P S N G E P Q S C R Q L * L H Y W M Q N L R I V K L S P A A C S C T T G C R T * A F * R * A P L L S OliI MslI Hin4II* BinI* | BbvI MboII | BstXI | |Hpy178III* AluI | HindII | | MboI | || SapI CviJI | Hpy166II MaeI | | BamHI | || Ksp632I* | SetI | | AjuI | TaqII | | XhoII \ \\ \ \ \ \ \ \ \ \ \ \ \ TTTACTCCAGAAGGAAGAGCTTATTTCGTTGACCATAATACTAGAACAACCACTTGGGTG 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| AAATGAGGTCTTCCTTCTCGAATAAAGCAACTGGTATTATGATCTTGTTGGTGAACCCAC / // / / / / // / / // | || | | CviJI | |AjuI TaqII | |BinI* | || | | AluI | Hpy166II MaeI | MslI | || | SetI | HindII | OliI | || Ksp632I* MboII BstXI | || SapI | |BbvI | Hpy178III* Hin4II* F T P E G R A Y F V D H N T R T T T W V L L Q K E E L I S L T I I L E Q P L G W Y S R R K S L F R * P * Y * N N H L G G ----:----|----:----|----:----|----:----|----:----|----:----| N V G S P L A * K T S W L V L V V V Q T I * E L L F L K N R Q G Y Y * F L W K P K S W F S S S I E N V M I S S C G S P H DpnI Tsp4CI* NlaIV | MaeII |BsmAI | |BsaAI |BstKTI | |SnaBI ||StyI | ||Csp6I AsuI* ||SecI* | |||RsaI |CviJI ||| AjuI | |||SetI |HaeIII ||| BinI* | |||TaiI |BmgT120I \\\ \ \ \\\\ \\ GATCCAAGGAGACAACAGTATATACGTACTTATGGCCCTACAAATACCACCATTCAGCAA 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| CTAGGTTCCTCTGTTGTCATATATGCATGAATACCGGGATGTTTATGGTGGTAAGTCGTT //// /// / / //// /// |||| ||BinI* | | |||Csp6I ||AsuI* |||| |SecI* | | ||RsaI |BmgT120I |||| |StyI | | |MaeII HaeIII |||| BsmAI | | SnaBI CviJI |||XhoII | | BsaAI |||BamHI | TaiI |||MboI | SetI ||AjuI Tsp4CI* |NlaIV |DpnI BstKTI D P R R Q Q Y I R T Y G P T N T T I Q Q I Q G D N S I Y V L M A L Q I P P F S N S K E T T V Y T Y L W P Y K Y H H S A T ----:----|----:----|----:----|----:----|----:----|----:----| S G L L C C Y I R V * P G V F V V M * C P D L S V V T Y V Y K H G * L Y W W E A I W P S L L I Y T S I A R C I G G N L L AsuI* AvaII AgeI DraII BccI BetI* BsmAI PpuMI | Hpy178III* Cfr10I Eco31I |BmgT120I | | Hin4II* |HpaII |TspEI ||SetI | | | BseGI FokI \\ \\ \\\ \ \ \ \ \ CAACCGGTCTCCCAATTAGGTCCTTTGCCTTCTGGATGGGAAATGAGATTGACCAATACG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| GTTGGCCAGAGGGTTAATCCAGGAAACGGAAGACCTACCCTTTACTCTAACTGGTTATGC // // // / / // / |Cfr10I || |PpuMI | | |BseGI FokI |BetI* || |DraII | | Hin4II* |AgeI || |AvaII | Hpy178III* HpaII || |AsuI* BccI || BmgT120I |TspEI |SetI Eco31I BsmAI Q P V S Q L G P L P S G W E M R L T N T N R S P N * V L C L L D G K * D * P I R T G L P I R S F A F W M G N E I D Q Y G ----:----|----:----|----:----|----:----|----:----|----:----| C G T E W N P G K G E P H S I L N V L V V V P R G I L D K A K Q I P F S I S W Y L R D G L * T R Q R R S P F H S Q G I R MaeII BssKI AflIII EcoRII |PmaCI |SecI* |BsaAI BceAI ||ScrFI || SetI | HindII ||BseBI BtgZI || TaiI | Hpy166II |||SetI |BseGI FokI \\ \ \ \ \\\\ \\ \ GCACGTGTATATTTCGTTGACCACAATACAAAAACAACGACCTGGGATGACCCAAGACTT 1210 1220 1230 1240 1250 1260 ----:----|----:----|----:----|----:----|----:----|----:----| CGTGCACATATAAAGCAACTGGTGTTATGTTTTTGTTGCTGGACCCTACTGGGTTCTGAA / // / / / / / / / / | || AflIII | Hpy166II | | | | BtgZI | |MaeII | HindII | | | BseGI | BsaAI BceAI | | EcoRII | PmaCI | | BssKI TaiI | | SecI* SetI | BseBI | ScrFI SetI A R V Y F V D H N T K T T T W D D P R L H V Y I S L T T I Q K Q R P G M T Q D F T C I F R * P Q Y K N N D L G * P K T S ----:----|----:----|----:----|----:----|----:----|----:----| A R T Y K T S W L V F V V V Q S S G L S P V H I N R Q G C Y L F L S R P H G L V C T Y I E N V V I C F C R G P I V W S K Hpy188I | MaeII | | SetI | | TaiI FalI | | | BslFI FalI | | | | SetI BccI | Eco57I MaeIII | | | | |FalI |MaeI | Eco57MI Tsp45I | | | | |FalI \\ \ \ \ \ \ \ \ \\ CCATCATCGCTAGACCAAAATGTTCCACAATACAAGCGTGACTTCAGACGTAAGGTTATT 1270 1280 1290 1300 1310 1320 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAGTAGCGATCTGGTTTTACAAGGTGTTATGTTCGCACTGAAGTCTGCATTCCAATAA / / / / / / / / / / / FokI | MaeI FalI Eco57MI | | | | FalI BslFI BccI FalI Eco57I | | | | FalI | | | | SetI | | | MaeII | | TaiI | | SetI | Hpy188I Tsp45I MaeIII P S S L D Q N V P Q Y K R D F R R K V I H H R * T K M F H N T S V T S D V R L F I I A R P K C S T I Q A * L Q T * G Y L ----:----|----:----|----:----|----:----|----:----|----:----| G D D S S W F T G C Y L R S K L R L T I E M M A L G F H E V I C A H S * V Y P * W * R * V L I N W L V L T V E S T L N N AsuI* AvaII DraII PpuMI |BmgT120I ||SetI ||NlaIV MseI |||BseYI BslFI |||| GsaI | Csp6I |||| CviJI SspI | |RsaI |||| | AciI | BssKI | ||MaeII |||| | Cac8I | |HpaII | |||BsaAI |||| | | BsrBI | ||ScrFI | |||SnaBI |||| | | | DdeI | ||CauII* | |||| SetI |||| | | | | FauI | ||| Tth111I | |||| TaiI \\\\ \ \ \ \ \ \ \\\ \ \ \\\\ \ TATTTCAGGTCCCAGCCCGCTCTTAGAATATTGCCGGGACAATGTCATATTAAAGTACGT 1330 1340 1350 1360 1370 1380 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAAGTCCAGGGTCGGGCGAGAATCTTATAACGGCCCTGTTACAGTATAATTTCATGCA / // / / / // / / / / / / //// | || | | BsrBI || SspI | | Tth111I | | |||MaeII | || | | AciI |FauI | BssKI | | ||SnaBI | || | Cac8I DdeI CauII* | | ||BsaAI | || BseYI HpaII | | |Csp6I | || CviJI ScrFI | | RsaI | |PpuMI | | TaiI | |DraII | | SetI | |AvaII | BslFI | |AsuI* MseI | |GsaI | BmgT120I | NlaIV SetI Y F R S Q P A L R I L P G Q C H I K V R I S G P S P L L E Y C R D N V I L K Y V F Q V P A R S * N I A G T M S Y * S T * ----:----|----:----|----:----|----:----|----:----|----:----| * K L D W G A R L I N G P C H * I L T R K N * T G A R E * F I A P V I D Y * L V I E P G L G S K S Y Q R S L T M N F Y T BsaBI |BseGI || Hpy178III* MseI || | FokI |Hin4I MnlI || | |TspEI |Hin4I SfaNI || | ||BsmAI |AhaIII* \ \\ \ \\\ \\ AGAAAGAACATTTTTGAGGATGCTTATCAAGAAATTATGAGACAAACCCCAGAAGATTTA 1390 1400 1410 1420 1430 1440 ----:----|----:----|----:----|----:----|----:----|----:----| TCTTTCTTGTAAAAACTCCTACGAATAGTTCTTTAATACTCTGTTTGGGGTCTTCTAAAT / / // / /// / // MnlI SfaNI |BsaBI | ||BsmAI | |MseI BseGI | |TspEI | AhaIII* | FokI Hin4I Hpy178III* Hin4I R K N I F E D A Y Q E I M R Q T P E D L E R T F L R M L I K K L * D K P Q K I * K E H F * G C L S R N Y E T N P R R F K ----:----|----:----|----:----|----:----|----:----|----:----| L F F M K S S A * * S I I L C V G S S K Y F S C K Q P H K D L F * S V F G L L N S L V N K L I S I L F N H S L G W F I * MseI VspI | MboI | BclI MnlI | | DpnI | Hin4II* | | |BstKTI | | Hin4I SetI MboII | | || BccI | | Hin4I |HphI Tsp4CI* Hpy178III* \ \ \ \\ \ \ \ \ \\ \ \ AAGAAAAGATTAATGATCAAGTTTGATGGTGAGGAAGGTTTAGATTACGGTGGTGTTTCC 1450 1460 1470 1480 1490 1500 ----:----|----:----|----:----|----:----|----:----|----:----| TTCTTTTCTAATTACTAGTTCAAACTACCACTCCTTCCAAATCTAATGCCACCACAAAGG / / // / / / // / / / MboII | || | | | |Hin4II* | HphI Tsp4CI* | || | | | Hin4I SetI | || | | | Hin4I | || | | MnlI | || | BccI | || BclI | || MboI | |DpnI | BstKTI VspI MseI K K R L M I K F D G E E G L D Y G G V S R K D * * S S L M V R K V * I T V V F P E K I N D Q V * W * G R F R L R W C F Q ----:----|----:----|----:----|----:----|----:----|----:----| F F L N I I L N S P S S P K S * P P T E L S F I L S * T Q H H P L N L N R H H K L F S * H D L K I T L F T * I V T T N G Hin4I Hin4I | FatI ApoI | |CviAII Hin4I TspEI | || NlaIII MseI Hin4I \ \ \\ \ \ \ AGAGAATTTTTCTTTTTATTATCACATGAGATGTTTAATCCATTTTATTGTTTGTTTGAA 1510 1520 1530 1540 1550 1560 ----:----|----:----|----:----|----:----|----:----|----:----| TCTCTTAAAAAGAAAAATAATAGTGTACTCTACAAATTAGGTAAAATAACAAACAAACTT / / / / // / / | TspEI Hin4I | |FatI MseI Hin4I | ApoI Hin4I | CviAII Hin4I Hpy178III* NlaIII R E F F F L L S H E M F N P F Y C L F E E N F S F Y Y H M R C L I H F I V C L N R I F L F I I T * D V * S I L L F V * I ----:----|----:----|----:----|----:----|----:----|----:----| L S N K K K N D C S I N L G N * Q K N S W L I K R K I I V H S T * D M K N N T Q S F K E K * * * M L H K I W K I T Q K F BsiYI* BdaI Tsp4CI* BdaI SspI | TspRI | SfaNI \ \ \ \ \ TATTCTGCGTATGACAACTATACCATTCAAATAAATCCTAACAGTGGCATCAACCCCGAA 1570 1580 1590 1600 1610 1620 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAGACGCATACTGTTGATATGGTAAGTTTATTTAGGATTGTCACCGTAGTTGGGGCTT / // / / / SspI || Tsp4CI* BdaI SfaNI |BsiYI* BdaI TspRI Y S A Y D N Y T I Q I N P N S G I N P E I L R M T T I P F K * I L T V A S T P N F C V * Q L Y H S N K S * Q W H Q P R T ----:----|----:----|----:----|----:----|----:----|----:----| Y E A Y S L * V M * I F G L L P M L G S I N Q T H C S Y W E F L D * C H C * G R I R R I V V I G N L Y I R V T A D V G F TspDTI ApoI BdaI |XmnI TspEI BdaI SfaNI \\ \ \ \ CATTTGAACTATTTCAAATTCATTGGTAGAGTTGTGGGTCTTGGTGTTTTCCATAGAAGA 1630 1640 1650 1660 1670 1680 ----:----|----:----|----:----|----:----|----:----|----:----| GTAAACTTGATAAAGTTTAAGTAACCATCTCAACACCCAGAACCACAAAAGGTATCTTCT / / / / | XmnI TspEI BdaI TspDTI ApoI BdaI H L N Y F K F I G R V V G L G V F H R R I * T I S N S L V E L W V L V F S I E D F E L F Q I H W * S C G S W C F P * K I ----:----|----:----|----:----|----:----|----:----|----:----| C K F * K L N M P L T T P R P T K W L L V N S S N * I * Q Y L Q P D Q H K G Y F M Q V I E F E N T S N H T K T N E M S S MboII | BsmI | CviRI* | | BseGI | | EcoT22I | | | FokI | | | | ApaLI | | | | |SetI | | | | ||CviRI* | | | | ||Hpy166II MaeII | | | | ||| SduI |BsaAI | | | | ||| BseSI |SnaBI | | | | ||| HgiAI* || SetI | | | | ||| | SfaNI || TaiI \ \ \ \ \\\ \ \ \\ \ TTTTTGGATGCATTCTTTGTAGGTGCACTTTACAAAATGATGCTACGTAAAAAAGTCGTA 1690 1700 1710 1720 1730 1740 ----:----|----:----|----:----|----:----|----:----|----:----| AAAAACCTACGTAAGAAACATCCACGTGAAATGTTTTACTACGATGCATTTTTTCAGCAT / // / / / / / / / // SfaNI || CviRI* | | | ApaLI SfaNI | |MaeII || BseGI | | Hpy166II | SnaBI |EcoT22I | | CviRI* | BsaAI |BsmI | HgiAI* TaiI MboII | BseSI SetI | FokI | SduI SetI F L D A F F V G A L Y K M M L R K K V V F W M H S L * V H F T K * C Y V K K S Y F G C I L C R C T L Q N D A T * K S R I ----:----|----:----|----:----|----:----|----:----|----:----| N K S A N K T P A S * L I I S R L F T T I K P H M R Q L H V K C F S A V Y F L R K Q I C E K Y T C K V F H H * T F F D Y SetI | MnlI BsrI CviRI* | HindII HgaI SfaNI | SmlI | Hin4II* | Hpy166II |SetI | MseI | |BseGI \ \ \ \ \\ \ \ \ \\ TTGCAAGATATGGAAGGTGTTGACGCAGAGGTGTATAACTCATTAAACTGGATGCTTGAG 1750 1760 1770 1780 1790 1800 ----:----|----:----|----:----|----:----|----:----|----:----| AACGTTCTATACCTTCCACAACTGCGTCTCCACATATTGAGTAATTTGACCTACGAACTC / / / // / / / / / / | Hin4II* SetI || SetI HgaI | | | SmlI CviRI* |Hpy166II | | BseGI |HindII | BsrI MnlI SfaNI MseI L Q D M E G V D A E V Y N S L N W M L E C K I W K V L T Q R C I T H * T G C L R A R Y G R C * R R G V * L I K L D A * E ----:----|----:----|----:----|----:----|----:----|----:----| N C S I S P T S A S T Y L E N F Q I S S I A L Y P L H Q R L P T Y S M L S S A Q Q L I H F T N V C L H I V * * V P H K L AloI | Bce83I* | | MboI | | XhoII | | | DpnI | | | |BstKTI | | | || Hpy188I | | | || | MaeII | | | || | |BinI* TspRI FokI | | | || | || SetI | Hpy99I TfiI |BccI | | | || | || TaiI | | AloI HinfI TspDTI \\ \ \ \ \\ \ \\ \ \ \ \ \ \ AATAGTATAGATGGTGTCTTGGATCTGACGTTCAGTGCCGACGATGAAAGATTCGGTGAA 1810 1820 1830 1840 1850 1860 ----:----|----:----|----:----|----:----|----:----|----:----| TTATCATATCTACCACAGAACCTAGACTGCAAGTCACGGCTGCTACTTTCTAAGCCACTT / // / // / / / / / / / | |AloI Bce83I* || | | BinI* | AloI | TspDTI | FokI || | | MaeII Hpy99I HinfI BccI || | | TspRI TfiI || | TaiI || | SetI || Hpy188I || XhoII || MboI |DpnI BstKTI N S I D G V L D L T F S A D D E R F G E I V * M V S W I * R S V P T M K D S V K * Y R W C L G S D V Q C R R * K I R * S ----:----|----:----|----:----|----:----|----:----|----:----| F L I S P T K S R V N L A S S S L N P S S Y Y L H H R P D S T * H R R H F I R H I T Y I T D Q I Q R E T G V I F S E T F MaeIII | HphI | | Tsp4CI* | | | TspRI | | | | BccI MaeIII | | | | | CviJI SspI |BccI \ \ \ \ \ \ \ \\ GTTGTAACAGTGGATTTGAAGCCAGATGGGAGAAATATTGAAGTTACTGATGGTAATAAG 1870 1880 1890 1900 1910 1920 ----:----|----:----|----:----|----:----|----:----|----:----| CAACATTGTCACCTAAACTTCGGTCTACCCTCTTTATAACTTCAATGACTACCATTATTC // / // / / / || Tsp4CI* |CviJI SspI | MaeIII || MaeIII BccI BccI |HphI TspRI V V T V D L K P D G R N I E V T D G N K L * Q W I * S Q M G E I L K L L M V I R C N S G F E A R W E K Y * S Y * W * * E ----:----|----:----|----:----|----:----|----:----|----:----| T T V T S K F G S P L F I S T V S P L L L Q L L P N S A L H S F Y Q L * Q H Y Y N Y C H I Q L W I P S I N F N S I T I L Hpy178III* BdaI | TspEI TaqI BdaI | | TspDTI | TspEI | TspEI | | | MseI \ \ \ \ \ \ \ \ AAAGAATATGTCGAATTATATACCCAATGGAGAATTGTTGATAGAGTTCAAGAACAATTT 1930 1940 1950 1960 1970 1980 ----:----|----:----|----:----|----:----|----:----|----:----| TTTCTTATACAGCTTAATATATGGGTTACCTCTTAACAACTATCTCAAGTTCTTGTTAAA / / / / / / // | TspEI BdaI TspEI | | |BdaI TaqI BdaI | | |BdaI | | TspEI | TspDTI Hpy178III* K E Y V E L Y T Q W R I V D R V Q E Q F K N M S N Y I P N G E L L I E F K N N L R I C R I I Y P M E N C * * S S R T I * ----:----|----:----|----:----|----:----|----:----|----:----| F S Y T S N Y V W H L I T S L T * S C N S L I H R I I Y G I S F Q Q Y L E L V I F F I D F * I G L P S N N I S N L F L K BdaI BdaI | BsmI | | BccI | | |FatI DdeI | | ||CviAII FokI | BbvII* | | ||| NlaIII TspEI | |MaeIII | | ||| | BseGI | MseI | || MboII | | ||| | | MseI | VspI | || | Tsp4CI* \ \ \\\ \ \ \ \ \ \ \\ \ \ AAGGCATTCATGGATGGTTTTAACGAATTAATCCCCGAAGACTTAGTAACTGTGTTTGAT 1990 2000 2010 2020 2030 2040 ----:----|----:----|----:----|----:----|----:----|----:----| TTCCGTAAGTACCTACCAAAATTGCTTAATTAGGGGCTTCTGAATCATTGACACAAACTA // / // / / // / / / |BsmI | || BseGI MseI |VspI | | Tsp4CI* MseI | |FatI |MseI | | MaeIII | CviAII TspEI | BbvII* NlaIII FokI | MboII BccI DdeI K A F M D G F N E L I P E D L V T V F D R H S W M V L T N * S P K T * * L C L M G I H G W F * R I N P R R L S N C V * * ----:----|----:----|----:----|----:----|----:----|----:----| L A N M S P K L S N I G S S K T V T N S * P M * P H N * R I L G R L S L L Q T Q L C E H I T K V F * D G F V * Y S H K I MboI Hpy166II | DpnI AciI | MaeI | |BstKTI | TspEI \ \ \ \\ \ \ GAGCGTGAACTAGAACTATTGATCGGTGGTATTGCGGAAATTGACATTGAAGATTGGAAG 2050 2060 2070 2080 2090 2100 ----:----|----:----|----:----|----:----|----:----|----:----| CTCGCACTTGATCTTGATAACTAGCCACCATAACGCCTTTAACTGTAACTTCTAACCTTC / / // / / / / | MaeI || MboI AciI TspEI MboII Hpy166II |DpnI BstKTI E R E L E L L I G G I A E I D I E D W K S V N * N Y * S V V L R K L T L K I G R A * T R T I D R W Y C G N * H * R L E E ----:----|----:----|----:----|----:----|----:----|----:----| S R S S S S N I P P I A S I S M S S Q F H A H V L V I S R H Y Q P F Q C Q L N S L T F * F * Q D T T N R F N V N F I P L HinfI | MnlI | | Hpy188I | | | PleI TsoI | | | |MlyI |MboII MaeIII | | | |Tth111I MboII || TspRI BstEII | | | || SetI \ \\ \ \ \ \ \ \\ \ AAACACACTGATTATCGTGGTTACCAAGAGTCAGACGAGGTCATTCAATGGTTTTGGAAG 2110 2120 2130 2140 2150 2160 ----:----|----:----|----:----|----:----|----:----|----:----| TTTGTGTGACTAATAGCACCAATGGTTCTCAGTCTGCTCCAGTAAGTTACCAAAACCTTC / / / / / // // | | MboII | | || |Tth111I | TsoI | | || PleI TspRI | | || MlyI | | || SetI | | |Hpy188I | | HinfI | MnlI BstEII MaeIII K H T D Y R G Y Q E S D E V I Q W F W K N T L I I V V T K S Q T R S F N G F G S T H * L S W L P R V R R G H S M V L E V ----:----|----:----|----:----|----:----|----:----|----:----| F C V S * R P * W S D S S T M * H N Q F S V C Q N D H N G L T L R P * E I T K S F V S I I T T V L L * V L D N L P K P L CviJI | SduI | HgiJII* | | TspDTI Csp6I | | | HphI |RsaI | | | | CviRI* |BsrI TspRI | | | | | Hpy166II |TspRI \ \ \ \ \ \ \ \\ TGTGTCAGTGAATGGGATAATGAACAAAGAGCCCGTTTATTGCAGTTCACCACTGGTACT 2170 2180 2190 2200 2210 2220 ----:----|----:----|----:----|----:----|----:----|----:----| ACACAGTCACTTACCCTATTACTTGTTTCTCGGGCAAATAACGTCAAGTGGTGACCATGA / / / / / / // / // TspRI | | | | | |TspRI | |Csp6I | | | | | | | RsaI | | | | | | BsrI | | | | | Hpy166II | | | | CviRI* | | | HphI | | TspDTI | CviJI HgiJII* SduI C V S E W D N E Q R A R L L Q F T T G T V S V N G I M N K E P V Y C S S P L V L C Q * M G * * T K S P F I A V H H W Y F ----:----|----:----|----:----|----:----|----:----|----:----| H T L S H S L S C L A R K N C N V V P V T H * H I P Y H V F L G N I A T * W Q Y T D T F P I I F L S G T * Q L E G S T S AccI |BssNAI CviRI* |Hpy166II | BccI || SetI | |CviJI || | HindII | || Hpy188I || | Hpy166II | || | AsuI* || | | MseI | || | AvaII TfiI || | |BsiYI* |AhaIII* | || | |BmgT120I HinfI \\ \ \\ \\ \ \\ \ \\ \ TCTCGTATACCTGTCAACGGGTTTAAAGATTTGCAAGGCTCTGATGGTCCAAGAAGATTC 2230 2240 2250 2260 2270 2280 ----:----|----:----|----:----|----:----|----:----|----:----| AGAGCATATGGACAGTTGCCCAAATTTCTAAACGTTCCGAGACTACCAGGTTCTTCTAAG // / / // / / / // / |AccI | Hpy166II |MseI | | | |AvaII HinfI |SetI | HindII AhaIII* | | | |AsuI* TfiI | BsiYI* | | | BmgT120I Hpy166II | | Hpy188I BssNAI | CviJI | BccI CviRI* S R I P V N G F K D L Q G S D G P R R F L V Y L S T G L K I C K A L M V Q E D S S Y T C Q R V * R F A R L * W S K K I H ----:----|----:----|----:----|----:----|----:----|----:----| E R I G T L P N L S K C P E S P G L L N K E Y V Q * R T * L N A L S Q H D L F I R T Y R D V P K F I Q L A R I T W S S E FatI AflIII BspLU11I* |CviAII AluI TatI MfeI || NspI CviJI |Csp6I HphI || NlaIII MboII | SetI ||RsaI TspEI || | MseI \ \ \ \\\ \ \\ \ \ ACTATTGAAAAAGCTGGTGAAGTACAACAATTGCCAAAATCTCACACATGTTTTAACAGA 2290 2300 2310 2320 2330 2340 ----:----|----:----|----:----|----:----|----:----|----:----| TGATAACTTTTTCGACCACTTCATGTTGTTAACGGTTTTAGAGTGTGTACAAAATTGTCT / / / /// / / / // / MboII | CviJI ||| HphI TspEI | || MseI | AluI ||TatI MfeI | |BspLU11I* SetI |Csp6I | |AflIII RsaI | |FatI | CviAII NlaIII NspI T I E K A G E V Q Q L P K S H T C F N R L L K K L V K Y N N C Q N L T H V L T E Y * K S W * S T T I A K I S H M F * Q S ----:----|----:----|----:----|----:----|----:----|----:----| V I S F A P S T C C N G F D * V H K L L * * Q F L Q H L V V I A L I E C M N * C S N F F S T F Y L L Q W F R V C T K V S FatI |CviAII ||AjuI ||| NlaIII ||| | BceAI ||| | | AluI ||| | | CviJI ||| | | | SetI ||| | | | | TspDTI ||| | | | | | CfrI ||| | | | | | | CviJI MaeII ||| | | | | | | HaeIII | SetI ||| | | | | | | |SecI* | TaiI ||| | | | | | | |DsaI* \ \ \\\ \ \ \ \ \ \ \\ GTTGATTTGCCACAATACGTTGATTATGACAGCATGAAACAGAAGCTAACATTGGCCGTG 2350 2360 2370 2380 2390 2400 ----:----|----:----|----:----|----:----|----:----|----:----| CAACTAAACGGTGTTATGCAACTAATACTGTCGTACTTTGTCTTCGATTGTAACCGGCAC / / / / // // / / / / / | MaeII | | |FatI || | TspDTI | | DsaI* TaiI | | CviAII || CviJI | | SecI* SetI | NlaIII || AluI | CfrI AjuI |SetI HaeIII BceAI CviJI V D L P Q Y V D Y D S M K Q K L T L A V L I C H N T L I M T A * N R S * H W P W * F A T I R * L * Q H E T E A N I G R G ----:----|----:----|----:----|----:----|----:----|----:----| T S K G C Y T S * S L M F C F S V N A T L Q N A V I R Q N H C C S V S A L M P R N I Q W L V N I I V A H F L L * C Q G H AjuI MboII Hpy178III* \ \ \ GAAGAAACCATAGGGTTTGGTCAAGAATGA 2410 2420 2430 ----:----|----:----|----:----| CTTCTTTGGTATCCCAAACCAGTTCTTACT / / / AjuI MboII Hpy178III* E E T I G F G Q E * K K P * G L V K N X R N H R V W S R M X ----:----|----:----|----:----| S S V M P N P * S H P L F W L T Q D L I F F G Y P K T L F S # Enzymes that cut Frequency Isoschizomers Acc65I 1 Asp718I AccI 2 FblI,XmiI AciI 8 BspACI,SsiI AclI 1 Psp1406I AflIII 2 AgeI 1 AsiGI,BshTI,CspAI,PinAI AhaIII* 4 DraI AjuI 2 AloI 1 AluI 6 AluBI ApaLI 1 Alw44I,VneI ApoI 5 AcsI,XapI AsuI* 6 Cfr13I,PspPI,Sau96I,AspS9I AvaII 4 Bme18I,Eco47I,SinI,VpaK11BI BalI 1 MlsI,MluNI,MscI,Msp20I BamHI 2 BbvI 10 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 10 Bce83I* 1 BpuEI BceAI 4 BclI 2 FbaI,Ksp22I BdaI 4 BetI* 1 BsaWI BinI* 7 AlwI,BspPI,AclWI BisI 10 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 10 BmgT120I 6 BsaAI 4 BstBAI,Ppu21I BsaBI 1 Bse8I,BseJI BseBI 3 Bst2UI,BstNI,BstOI,MvaI BseGI 12 BstF5I,BtsCI BseMII 1 BseSI 1 BaeGI,BstSLI BseYI 2 BsgI 1 BsiI* 1 BssSI,Bst2BI,BauI BsiYI* 7 Bsc4I,BseLI,BslI,AfiI BslFI 3 BsmFI,FaqI BsmAI 5 Alw26I,BstMAI BsmI 3 BsaMI,Mva1269I,PctI BspCNI 1 BspLU11I* 1 PscI,PciI BsrBI 1 AccBSI,MbiI BsrI 6 BseNI,Bse1I,BsrSI BssKI 5 BstSCI,StyD4I BssNAI 1 Bst1107I,BstZ17I BstAPI 1 BstEII 2 BstPI,Eco91I,EcoO65I,PspEI BstKTI 10 BstXI 1 BtgZI 1 Cac8I 2 BstC8I CauII* 2 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 3 AcoI,EaeI Csp6I 8 CviQI,RsaNI CviAII 4 CviJI 18 CviKI-1 CviRI* 10 HpyCH4V DdeI 3 BstDEI,HpyF3I DpnI 10 MalI DraII 2 EcoO109I DsaI* 1 BtgI,BstDSI Eco31I 1 Bso31I,BspTNI,BsaI Eco57I 2 AcuI Eco57MI 3 EcoNI 1 BstENI,XagI EcoP15I 3 EcoRII 3 AjnI,Psp6I,PspGI EcoRV 1 Eco32I EcoT22I 1 Mph1103I,NsiI,Zsp2I Esp3I 1 BsmBI FalI 4 FatI 4 FauI 1 SmuI FnuDII* 3 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 11 GlaI 1 GsaI 2 GsuI 1 BpmI HaeIII 5 BsnI,BsuRI,BshFI,PhoI HgaI 1 CseI HgiAI* 1 Bbv12I,BsiHKAI,Alw21I HgiCI* 2 BanI,BshNI,BspT107I,AccB1I HgiJII* 1 Eco24I,EcoT38I,FriOI,BanII HhaI 1 BstHHI,CfoI,AspLEI Hin4I 5 Hin4II* 12 HpyAV Hin6I 1 HinP1I,HspAI HindII 5 HincII HinfI 5 HpaI 1 KspAI HpaII 3 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 11 Hpy8I Hpy178III* 9 Hpy188III Hpy188I 6 Hpy99I 3 KpnI 1 Ksp632I* 3 Eam1104I,EarI,Bst6I MaeI 4 FspBI,BfaI,XspI MaeII 14 HpyCH4IV MaeIII 8 MboI 10 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 16 MfeI 1 MunI MlyI 2 SchI MmeI 1 MnlI 11 MseI 17 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 4 HpyF10VI,BstMWI NlaIII 4 Hin1II,Hsp92II,FaeI NlaIV 6 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 2 MspA1I NspI 1 BstNSI,XceI OliI 1 AleI PleI 2 PpsI PmaCI 1 BbrPI,Eco72I,AcvI,PmlI,PspCI PpuMI 2 Psp5II,PspPPI PstI 1 PvuII 1 RsaI 8 AfaI SapI 1 LguI,PciSI,BspQI ScrFI 5 BmrFI,MspR9I,Bme1390I SduI 2 MhlI,Bsp1286I SecI* 5 BseDI,BssECI,BsaJI SetI 38 SexAI 1 MabI SfaNI 6 LweI SfeI* 2 BstSFI,SfcI,BfmI SmlI 1 SmoI SnaBI 3 Eco105I,BstSNI SspI 3 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaiI 14 TaqI 6 TaqII 3 TatI 1 TfiI 3 PfeI TseI 10 ApeKI TsoI 4 Tsp45I 2 NmuCI Tsp4CI* 7 HpyCH4III,TaaI,Bst4CI TspDTI 7 TspEI 17 TasI,Tsp509I,Sse9I TspGWI 4 TspRI 7 TscAI Tth111I 2 PflFI,PsyI,AspI VspI 2 PshBI,AseI XhoII 3 BstYI,MflI,PsuI,BstX2I XmnI 1 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI AcyI AflII AlfI AlwNI ApaI AscI AsuII AvaI AvrII BaeI BarI BbvCI BcgI BciVI BfiI BglI BglII BmeT110I BmtI BplI Bpu10I BsaXI BsePI BseRI Bsp120I Bsp1407I BspHI BspMI BspMII* BspOI BsrDI BtrI BtsI Cfr9I ClaI CspCI DinI DraIII DrdI Eam1105I EciI Ecl136II Eco47III EcoICRI EcoRI EgeI EheI EspI* FseI FspAI HaeII HindIII KasI MauBI McrI* MluI MroNI MstI* NaeI NarI NcoI NdeI NgoMIV NheI NmeAIII NotI PacI PasI PflMI PfoI PmeI PpiI PshAI PsiI PspOMI PspXI PsrI PvuI RsrII SacI SacII SalI SanDI SauI* ScaI SfiI SfoI SgfI SgrAI SgrDI SmaI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI SwaI TauI TspMI TstI XbaI XcmI XhoI XmaCI XmaI XmaIII* ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769