Restriction Map of MAM1/YER106W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

MAM1/YER106W on chromosome V from coordinates 372326 to 373234.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.4224

TspEI ApoI |XmnI TspEI \\ \ ATGAGGGAAAAAAGAACAATTTCAAATAAAGACACAAACTATCTCAAATTCCCAAATAAA 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACTCCCTTTTTTCTTGTTAAAGTTTATTTCTGTGTTTGATAGAGTTTAAGGGTTTATTT / / / | TspEI TspEI XmnI ApoI M R E K R T I S N K D T N Y L K F P N K * G K K E Q F Q I K T Q T I S N S Q I N E G K K N N F K * R H K L S Q I P K * T ----:----|----:----|----:----|----:----|----:----|----:----| X L S F L V I E F L S V F * R L N G F L X S P F F F L K L Y L C L S D * I G L Y H P F F S C N * I F V C V I E F E W I F Hpy178III* | TfiI | HinfI MboII | | SmlI Bce83I* | | Hpy178III* EcoRV | CviJI \ \ \ \ \ \ CTCCAAAGATATTCCCGATTCTTGAGCAGGAAGATATCCAATACCAGCCCAGAAAAGCAA 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| GAGGTTTCTATAAGGGCTAAGAACTCGTCCTTCTATAGGTTATGGTCGGGTCTTTTCGTT / / / / / // / | | | SmlI | |MboII CviJI | | Hpy178III* | Bce83I* | HinfI EcoRV | TfiI Hpy178III* L Q R Y S R F L S R K I S N T S P E K Q S K D I P D S * A G R Y P I P A Q K S N P K I F P I L E Q E D I Q Y Q P R K A T ----:----|----:----|----:----|----:----|----:----|----:----| S W L Y E R N K L L F I D L V L G S F C V G F I N G I R S C S S I W Y W G L F A E L S I G S E Q A P L Y G I G A W F L L Tsp4CI* MboII | TspRI | MboII | | TaqI \ \ \ \ \ CCGAAGAAGAACATAAAAGAACACTGTTTATCGAGTTATCATAAAGAACACTCGGTAAAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| GGCTTCTTCTTGTATTTTCTTGTGACAAATAGCTCAATAGTATTTCTTGTGAGCCATTTT / / / / / | | | Tsp4CI* TaqI | | TspRI | MboII MboII P K K N I K E H C L S S Y H K E H S V K R R R T * K N T V Y R V I I K N T R * N E E E H K R T L F I E L S * R T L G K T ----:----|----:----|----:----|----:----|----:----|----:----| G F F F M F S C Q K D L * * L S C E T F V S S S C L L V S N I S N D Y L V S P L R L L V Y F F V T * R T I M F F V R Y F BbvI | BbvII* TseI | | MboII CviRI* | | | TseI BetI* |BisI | | | |BisI |HpaII ||BlsI | | | ||BlsI BbvI \\ \\\ \ \ \ \\\ \ CCAAAGCAAAACTCCGGTAATGTTGCAGCAAAAGAAGACAAAGATACGCAGCATTTACAA 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTCGTTTTGAGGCCATTACAACGTCGTTTTCTTCTGTTTCTATGCGTCGTAAATGTT // //// / / /// |BetI* |||TseI | | ||TseI HpaII ||BisI | | |BisI |BlsI | | BlsI CviRI* | BbvII* | MboII BbvI P K Q N S G N V A A K E D K D T Q H L Q Q S K T P V M L Q Q K K T K I R S I Y K K A K L R * C C S K R R Q R Y A A F T K ----:----|----:----|----:----|----:----|----:----|----:----| G F C F E P L T A A F S S L S V C C K C V L A F S R Y H Q L L L L C L Y A A N V W L L V G T I N C C F F V F I R L M * L MboII TspGWI |TspDTI | TspEI MaeIII \\ \ \ \ AATAATGTCGCTAATGAAGAAGCAACGGAATGTCTAACAAGAAGTAATTTGAAAAAGTTA 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| TTATTACAGCGATTACTTCTTCGTTGCCTTACAGATTGTTCTTCATTAAACTTTTTCAAT / / / / BbvI TspDTI TspGWI TspEI MboII N N V A N E E A T E C L T R S N L K K L I M S L M K K Q R N V * Q E V I * K S Y * C R * * R S N G M S N K K * F E K V T ----:----|----:----|----:----|----:----|----:----|----:----| F L T A L S S A V S H R V L L L K F F N F Y H R * H L L L P I D L L F Y N S F T I I D S I F F C R F T * C S T I Q F L * ApoI MboI TspEI BclI | XmnI | DpnI | | TaqI MseI | |BstKTI \ \ \ \ \ \\ CAAGAGAAAATTTTCGATAGAGAACTTAATGATATTGCCTGTGATCATTGTCTTTGTAGC 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| GTTCTCTTTTAAAAGCTATCTCTTGAATTACTATAACGGACACTAGTAACAGAAACATCG / / / / / // / MaeIII | | TaqI MseI || BclI | TspEI || MboI | ApoI |DpnI XmnI BstKTI Q E K I F D R E L N D I A C D H C L C S K R K F S I E N L M I L P V I I V F V A R E N F R * R T * * Y C L * S L S L * H ----:----|----:----|----:----|----:----|----:----|----:----| C S F I K S L S S L S I A Q S * Q R Q L V L S F K R Y L V * H Y Q R H D N D K Y L L F N E I S F K I I N G T I M T K T A EcoRV Hpy178III* Ksp632I* | MboII | MmeI NlaIV \ \ \ \ \ \ ACAGAAAATAGAAGAGATATCAAGTATTCACGACTTTGGTTCCTTTTTGAGTTGGAAATG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TGTCTTTTATCTTCTCTATAGTTCATAAGTGCTGAAACCAAGGAAAAACTCAACCTTTAC / / / // / Ksp632I* | MboII || NlaIV EcoRV |Hpy178III* MmeI T E N R R D I K Y S R L W F L F E L E M Q K I E E I S S I H D F G S F L S W K * R K * K R Y Q V F T T L V P F * V G N E ----:----|----:----|----:----|----:----|----:----|----:----| V S F L L S I L Y E R S Q N R K S N S I C L F Y F L Y * T N V V K T G K Q T P F C F I S S I D L I * S K P E K K L Q F H AciI | DdeI AciI EciI | |TspDTI | MfeI BsrI | || MwoI | TspEI \ \ \\ \ \ \ AGTGAAAACTGGAATGAAAATCTCCGCCTTAGTTGCTATAATAAATATGTGTATTCCGCA 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| TCACTTTTGACCTTACTTTTAGAGGCGGAATCAACGATATTATTTATACACATAAGGCGT / // / / / BsrI || | DdeI AciI EciI || MwoI |TspDTI AciI S E N W N E N L R L S C Y N K Y V Y S A V K T G M K I S A L V A I I N M C I P Q * K L E * K S P P * L L * * I C V F R N ----:----|----:----|----:----|----:----|----:----|----:----| L S F Q F S F R R R L Q * L L Y T Y E A S H F S S H F D G G * N S Y Y I H T N R T F V P I F I E A K T A I I F I H I G C PleI HinfI |MlyI SspI MseI \ \\ \ \ ATTGATGAGTCGTGGAAAATGGAGAATATTCTACTTAAAGAACAAGAGAAGCATTATGAA 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TAACTACTCAGCACCTTTTACCTCTTATAAGATGAATTTCTTGTTCTCTTCGTAATACTT / / / / / TspEI HinfI PleI SspI MseI MfeI MlyI I D E S W K M E N I L L K E Q E K H Y E L M S R G K W R I F Y L K N K R S I M N * * V V E N G E Y S T * R T R E A L * I ----:----|----:----|----:----|----:----|----:----|----:----| I S S D H F I S F I R S L S C S F C * S L Q H T T S F P S Y E V * L V L S A N H N I L R P F H L I N * K F F L L L M I F SspI TspDTI |XmnI | TspEI SspI Hin4II* \\ \ \ \ \ TATTTTCCAATAGGACAATTACTGATACCCAATAATATTGACTACACTAATAAACAGAAA 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| ATAAAAGGTTATCCTGTTAATGACTATGGGTTATTATAACTGATGTGATTATTTGTCTTT // / / / / |XmnI TspDTI TspEI SspI Hin4II* SspI Y F P I G Q L L I P N N I D Y T N K Q K I F Q * D N Y * Y P I I L T T L I N R K F S N R T I T D T Q * Y * L H * * T E K ----:----|----:----|----:----|----:----|----:----|----:----| Y K G I P C N S I G L L I S * V L L C F I N E L L V I V S V W Y Y Q S C * Y V S I K W Y S L * Q Y G I I N V V S I F L F MseI |BbvII* || MfeI || TspEI Hin4I || | MboII Hin4I || | | TspEI |BsmAI \\ \ \ \ \\ AGGAAGGAAAACATTGAAGACTTAACAATTGAAATTGATAGTATTATAGAGACAAACCAT 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TCCTTCCTTTTGTAACTTCTGAATTGTTAACTTTAACTATCATAATATCTCTGTTTGGTA / / / // / | | TspEI |Hin4I BsmAI | | MfeI |Hin4I | BbvII* TspEI | MboII MseI R K E N I E D L T I E I D S I I E T N H G R K T L K T * Q L K L I V L * R Q T I E G K H * R L N N * N * * Y Y R D K P S ----:----|----:----|----:----|----:----|----:----|----:----| L F S F M S S K V I S I S L I I S V F W F S P F C Q L S L L Q F Q Y Y * L S L G P L F V N F V * C N F N I T N Y L C V M BdaI Hin4I BdaI Hin4I |TspEI | AciI ||BseGI | BisI ||| CviRI* | |BlsI Hpy178III* ||| | FokI BccI | ||TauI | MnlI ||| | TspDTI \ \ \\\ \ \ \\\ \ \ CAAAAGAAAAGATTTTTGCCGCAAAGTGTCCTGATAAAAAGGGAGGATGAAATTGCATTT 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| GTTTTCTTTTCTAAAAACGGCGTTTCACAGGACTATTTTTCCCTCCTACTTTAACGTAAA / / //// / / / / /// / | Hin4I |||AciI | MnlI | | ||| TspDTI | Hin4I ||BisI Hpy178III* | | ||TspDTI BccI |BlsI | | |CviRI* TauI | | TspEI | BseGI BdaI BdaI Q K K R F L P Q S V L I K R E D E I A F K R K D F C R K V S * * K G R M K L H L K E K I F A A K C P D K K G G * N C I * ----:----|----:----|----:----|----:----|----:----|----:----| * F F L N K G C L T R I F L S S S I A N D F S F I K A A F H G S L F P P H F Q M L L F S K Q R L T D Q Y F P L I F N C K CviRI* Hin6I | BseGI |GlaI TspDTI | | BdaI FokI ||HhaI | SfaNI MslI | | BdaI |SetI |||HaeII Hpy188I \ \ \ \ \ \ \\ \\\\ \ GACGACTTTCATTTGGATGCACGAAAGGTTCTAAACGATTTGAGCGCCACTTCTGAAAAT 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTGCTGAAAGTAAACCTACGTGCTTTCCAAGATTTGCTAAACTCGCGGTGAAGACTTTTA / / / / / / / //// / FokI | MslI | | SetI FokI |||Hin6I Hpy188I SfaNI | BdaI ||GlaI | BdaI |HhaI CviRI* HaeII BseGI D D F H L D A R K V L N D L S A T S E N T T F I W M H E R F * T I * A P L L K I R L S F G C T K G S K R F E R H F * K S ----:----|----:----|----:----|----:----|----:----|----:----| S S K * K S A R F T R F S K L A V E S F Q R S E N P H V F P E L R N S R W K Q F V V K M Q I C S L N * V I Q A G S R F I MboII | HphI | | AluI StyI | | CviJI SapI TspEI SecI* | | | SetI Ksp632I* | MseI | SetI XmnI \ \ \ \ \ \ \ \ \ \ CCATTCAGCTCTTCACCAAATACAAAAAAAATTAAATCAAAGGGAAAAACCTTGGAAGTG 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GGTAAGTCGAGAAGTGGTTTATGTTTTTTTTAATTTAGTTTCCCTTTTTGGAACCTTCAC / / / / / // / / / | | | CviJI Ksp632I* |MseI SetI | XmnI | | | AluI SapI TspEI SecI* | | SetI StyI | HphI MboII P F S S S P N T K K I K S K G K T L E V H S A L H Q I Q K K L N Q R E K P W K W I Q L F T K Y K K N * I K G K N L G S G ----:----|----:----|----:----|----:----|----:----|----:----| G N L E E G F V F F I L D F P F V K S T D M * S K V L Y L F F * I L P F F R P L W E A R * W I C F F N F * L S F G Q F H MboI AluI | DpnI CviJI NlaIV | |BstKTI SetI | SetI MslI \ \ \\ \ \ \ \ GTTCCCAAAAAGAAAAACAAAAAGATCATAGGTGCTTTGGAAAGAAAGCTACATATAGAT 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| CAAGGGTTTTTCTTTTTGTTTTTCTAGTATCCACGAAACCTTTCTTTCGATGTATATCTA / // / / / / / NlaIV || | SetI | CviJI MslI || MboI | AluI |DpnI SetI BstKTI V P K K K N K K I I G A L E R K L H I D F P K R K T K R S * V L W K E S Y I * M S Q K E K Q K D H R C F G K K A T Y R * ----:----|----:----|----:----|----:----|----:----|----:----| T G L F F F L F I M P A K S L F S C I S P E W F S F C F S * L H K P F F A V Y L N G F L F V F L D Y T S Q F S L * M Y I TspEI | MseI \ \ GAAAATTAA ----:---- CTTTTAATT // |MseI TspEI E N * K I X K L X ----:---- S F * H F N F I L # Enzymes that cut Frequency Isoschizomers AciI 3 BspACI,SsiI AluI 2 AluBI ApoI 2 AcsI,XapI BbvI 2 BseXI,BstV1I,Lsp1109I BbvII* 2 BpiI,BpuAI,BstV2I,BbsI BccI 1 Bce83I* 1 BpuEI BclI 1 FbaI,Ksp22I BdaI 2 BetI* 1 BsaWI BisI 3 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 3 BseGI 2 BstF5I,BtsCI BsmAI 1 Alw26I,BstMAI BsrI 1 BseNI,Bse1I,BsrSI BstKTI 2 CviJI 3 CviKI-1 CviRI* 3 HpyCH4V DdeI 1 BstDEI,HpyF3I DpnI 2 MalI EciI 1 EcoRV 2 Eco32I FokI 2 GlaI 1 HaeII 1 BstH2I HhaI 1 BstHHI,CfoI,AspLEI Hin4I 2 Hin4II* 1 HpyAV Hin6I 1 HinP1I,HspAI HinfI 2 HpaII 1 HapII,BsiSI,MspI HphI 1 AsuHPI Hpy178III* 4 Hpy188III Hpy188I 1 Ksp632I* 2 Eam1104I,EarI,Bst6I MaeIII 1 MboI 2 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 8 MfeI 2 MunI MlyI 1 SchI MmeI 1 MnlI 1 MseI 5 Tru1I,Tru9I MslI 2 RseI,SmiMI MwoI 1 HpyF10VI,BstMWI NlaIV 2 BspLI,BmiI,PspN4I PleI 1 PpsI SapI 1 LguI,PciSI,BspQI SecI* 1 BseDI,BssECI,BsaJI SetI 5 SfaNI 1 LweI SmlI 1 SmoI SspI 3 StyI 1 Eco130I,EcoT14I,ErhI,BssT1I TaqI 2 TauI 1 TfiI 1 PfeI TseI 2 ApeKI Tsp4CI* 1 HpyCH4III,TaaI,Bst4CI TspDTI 5 TspEI 11 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 1 TscAI XmnI 4 MroXI,PdmI,Asp700I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AclI AcyI AflII AflIII AgeI AhaIII* AjuI AlfI AloI AlwNI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BceAI BcgI BciVI BfiI BglI BglII BinI* BmeT110I BmgT120I BmtI BplI Bpu10I BsaAI BsaBI BsaXI BseBI BseMII BsePI BseRI BseSI BseYI BsgI BsiI* BsiYI* BslFI BsmFI BsmI Bsp120I Bsp1407I BspCNI BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssKI BssNAI Bst1107I Bst2UI BstAPI BstEII BstNI BstOI BstSCI BstXI BstZ17I BtgZI BtrI BtsI Cac8I CauII* Cfr10I Cfr9I CfrI ClaI Csp6I CspCI CviAII CviQI DinI DraII DraIII DrdI DsaI* Eam1105I Ecl136II Eco31I Eco47III Eco57I Eco57MI EcoICRI EcoNI EcoP15I EcoRI EcoRII EcoT22I EgeI EheI Esp3I EspI* FalI FaqI FatI FauI FnuDII* FseI FspAI GsaI GsuI HaeIII HgaI HgiAI* HgiCI* HgiJII* HindII HindIII HpaI Hpy166II Hpy8I Hpy99I KasI KpnI MaeI MaeII MauBI McrI* MluI Mph1103I MroNI MstI* MvaI NaeI NarI NcoI NdeI NgoMIV NheI NlaIII NmeAIII NotI NruI NsiI NspBII* NspI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsaI RsaNI RsrII SacI SacII SalI SanDI SauI* ScaI ScrFI SduI SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SplI* SrfI Sse232I* Sse8387I StuI StyD4I SwaI TaiI TaqII TatI TsoI Tsp45I TspMI TstI Tth111I VspI XbaI XcmI XhoI XhoII XmaCI XmaI XmaIII* ZraI Zsp2I # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769