Restriction Map of RAD51/YER095W



Send questions or suggestions to SGD

BLAST search | Genome Restriction Map | Design Primers for this sequence


The currently selected gene/sequence is :

RAD51/YER095W on chromosome V from coordinates 349980 to 351182.

seqfile=/share/crumb/www-data/html/tmp/gcgseq.tmp.21874

AluI Eco57I PleI Eco57MI CviJI | Hpy188I |MlyI SmlI | |HinfI ||SetI | BsmAI | ||MaeIII ||| Csp6I | | Hpy178III* | ||Tsp45I ||| |RsaI Tsp4CI* \ \ \ \ \\\ \\\ \\ \ ATGTCTCAAGTTCAAGAACAACATATATCAGAGTCACAGCTTCAGTACGGGAACGGTTCG 10 20 30 40 50 60 ----:----|----:----|----:----|----:----|----:----|----:----| TACAGAGTTCAAGTTCTTGTTGTATATAGTCTCAGTGTCGAAGTCATGCCCTTGCCAAGC / / / / / / / // // / | | | | | | | |PleI |Csp6I Tsp4CI* | | | | | | | |MlyI RsaI | | | | | | | CviJI | | | | | | | AluI | | | | | | Tsp45I | | | | | | MaeIII | | | | | | SetI | | | | | HinfI | | | | Hpy188I | | | Eco57MI | | | Eco57I | | Hpy178III* | BsmAI SmlI M S Q V Q E Q H I S E S Q L Q Y G N G S C L K F K N N I Y Q S H S F S T G T V R V S S S R T T Y I R V T A S V R E R F V ----:----|----:----|----:----|----:----|----:----|----:----| X D * T * S C C I D S D C S * Y P F P E X T E L E L V V Y I L T V A E T R S R N H R L N L F L M Y * L * L K L V P V T R Hpy166II | Tsp4CI* | |Csp6I | ||RsaI Tsp4CI* Tsp4CI* | |||TspRI SetI | BccI EcoP15I |MwoI \ \\\\ \ \ \ \ \\ TTGATGTCCACTGTACCAGCAGACCTTTCACAGTCAGTCGTTGATGGAAACGGCAACGGT 70 80 90 100 110 120 ----:----|----:----|----:----|----:----|----:----|----:----| AACTACAGGTGACATGGTCGTCTGGAAAGTGTCAGTCAGCAACTACCTTTGCCGTTGCCA / / / // / / / / // | | | |Csp6I SetI | BccI | |Tsp4CI* | | | RsaI Tsp4CI* | MwoI | | Tsp4CI* EcoP15I | Hpy166II TspRI L M S T V P A D L S Q S V V D G N G N G * C P L Y Q Q T F H S Q S L M E T A T V D V H C T S R P F T V S R * W K R Q R * ----:----|----:----|----:----|----:----|----:----|----:----| N I D V T G A S R E C D T T S P F P L P T S T W Q V L L G K V T L R Q H F R C R Q H G S Y W C V K * L * D N I S V A V T TseI |BisI CviJI ||BlsI CviJI |NlaIV MwoI ||| BceAI MboII ||BccI |BceAI BtgZI EciI ||| | MnlI BbvI HaeIII |||HpaII || AciI |CviRI* Cac8I \\\ \ \ \ \ \\\\ \\ \ \\ \ AGCAGCGAAGATATTGAGGCCACCAACGGCTCCGGCGATGGTGGCGGATTGCAGGAGCAA 130 140 150 160 170 180 ----:----|----:----|----:----|----:----|----:----|----:----| TCGTCGCTTCTATAACTCCGGTGGTTGCCGAGGCCGCTACCACCGCCTAACGTCCTCGTT /// / // // / / / / / / / / / ||| BceAI |HaeIII || | | MwoI | AciI | | | Cac8I ||| MnlI |CviJI || | HpaII BceAI | | EciI ||TseI MboII || BccI | BtgZI |BisI BbvI |NlaIV CviRI* BlsI CviJI S S E D I E A T N G S G D G G G L Q E Q A A K I L R P P T A P A M V A D C R S K Q R R Y * G H Q R L R R W W R I A G A S ----:----|----:----|----:----|----:----|----:----|----:----| L L S S I S A V L P E P S P P P N C S C Y C R L Y Q P W W R S R R H H R I A P A A A F I N L G G V A G A I T A S Q L L L FokI | TspDTI | | TseI | | AluI | | CviJI | | |BisI | | ||BlsI | | ||SetI | | ||| DdeI Hin6I | | ||| SauI* |GlaI MnlI BcgI BbvI | | ||| | TspDTI AciI ||HhaI SetI HphI BseGI | | ||| | |SetI BcgI \ \\\ \ \ \ \ \ \\\ \ \\ \ GCGGAAGCGCAAGGTGAAATGGAGGATGAAGCATACGATGAAGCTGCCTTAGGTTCGTTT 190 200 210 220 230 240 ----:----|----:----|----:----|----:----|----:----|----:----| CGCCTTCGCGTTCCACTTTACCTCCTACTTCGTATGCTACTTCGACGGAATCCAAGCAAA / /// / / // / / / / //// // / | ||| | MnlI || BseGI BbvI | | |||| || BcgI | ||| SetI |HphI | | |||| |TspDTI | ||Hin6I BcgI | | |||| |SauI* | |GlaI | | |||| |DdeI | HhaI | | |||| SetI AciI | | |||TseI | | ||BisI | | |BlsI | | CviJI | | AluI | FokI | SetI TspDTI A E A Q G E M E D E A Y D E A A L G S F R K R K V K W R M K H T M K L P * V R L G S A R * N G G * S I R * S C L R F V C ----:----|----:----|----:----|----:----|----:----|----:----| A S A C P S I S S S A Y S S A A K P E N L P L A L H F P P H L M R H L Q R L N T R F R L T F H L I F C V I F S G * T R K BseGI |EcoP15I || DdeI CviRI* || FokI | Hpy166II AciI || EciI \ \ \ \\ \ GTGCCAATAGAAAAACTGCAAGTGAACGGGATTACTATGGCGGATGTGAAAAAACTAAGG 250 260 270 280 290 300 ----:----|----:----|----:----|----:----|----:----|----:----| CACGGTTATCTTTTTGACGTTCACTTGCCCTAATGATACCGCCTACACTTTTTTGATTCC / / / / / / // | Hpy166II | | | EciI |FokI CviRI* | | | DdeI | | EcoP15I | BseGI AciI V P I E K L Q V N G I T M A D V K K L R C Q * K N C K * T G L L W R M * K N * G A N R K T A S E R D Y Y G G C E K T K G ----:----|----:----|----:----|----:----|----:----|----:----| T G I S F S C T F P I V I A S T F F S L Q A L L F V A L S R S * * P P H S F V L H W Y F F Q L H V P N S H R I H F F * P CviJI TspRI Eco57I | BtsI | AciI NdeI Eco57MI \ \ \ \ \ \ GAGAGTGGGCTTCACACTGCTGAAGCGGTAGCATATGCTCCCAGAAAGGATTTATTGGAA 310 320 330 340 350 360 ----:----|----:----|----:----|----:----|----:----|----:----| CTCTCACCCGAAGTGTGACGACTTCGCCATCGTATACGAGGGTCTTTCCTAAATAACCTT / / / / / | TspRI AciI | Eco57MI | BtsI | Eco57I CviJI NdeI E S G L H T A E A V A Y A P R K D L L E R V G F T L L K R * H M L P E R I Y W K E W A S H C * S G S I C S Q K G F I G N ----:----|----:----|----:----|----:----|----:----|----:----| S L P S * V A S A T A Y A G L F S K N S P S H A E C Q Q L P L M H E W F P N I P L T P K V S S F R Y C I S G S L I * Q F AciI Hpy188I |BisI | AluI ||BlsI | CviJI |||TauI | |DdeI |||| EcoP15I | |Bpu10I |||| | CviJI SetI | ||SetI |||| | |MaeI \ \ \\\ \\\\ \ \\ ATCAAAGGTATATCGGAAGCTAAGGCAGATAAGTTGCTAAACGAAGCGGCAAGGCTAGTG 370 380 390 400 410 420 ----:----|----:----|----:----|----:----|----:----|----:----| TAGTTTCCATATAGCCTTCGATTCCGTCTATTCAACGATTTGCTTCGCCGTTCCGATCAC / / / / / /// / / SetI | | | Bpu10I ||BisI | MaeI | | | DdeI ||AciI EcoP15I | | CviJI |BlsI CviJI | | AluI TauI | SetI Hpy188I I K G I S E A K A D K L L N E A A R L V S K V Y R K L R Q I S C * T K R Q G * C Q R Y I G S * G R * V A K R S G K A S A ----:----|----:----|----:----|----:----|----:----|----:----| I L P I D S A L A S L N S F S A A L S T F * L Y I P L * P L Y T A L R L P L A L D F T Y R F S L C I L Q * V F R C P * H MboI | DpnI | |BstKTI TseI | || Hpy188I CviJI | || | AluI TspDTI | || | CviJI MaeIII |BisI NdeI | || | | SetI BbvI Tsp45I ||BlsI BceAI | || | | MboII \ \ \\\ \ \ \\ \ \ \ CCTATGGGATTTGTCACGGCTGCTGATTTTCATATGAGAAGATCGGAGCTGATTTGTTTG 430 440 450 460 470 480 ----:----|----:----|----:----|----:----|----:----|----:----| GGATACCCTAAACAGTGCCGACGACTAAAAGTATACTCTTCTAGCCTCGACTAAACAAAC / / //// / // / / // BbvI | |||TseI BceAI || | | |MboII | ||BisI NdeI || | | CviJI | |BlsI || | | AluI | CviJI || | SetI Tsp45I || Hpy188I MaeIII || MboI TspDTI |DpnI BstKTI P M G F V T A A D F H M R R S E L I C L L W D L S R L L I F I * E D R S * F V * Y G I C H G C * F S Y E K I G A D L F D ----:----|----:----|----:----|----:----|----:----|----:----| G I P N T V A A S K * I L L D S S I Q K A * P I Q * P Q Q N E Y S F I P A S K N R H S K D R S S I K M H S S R L Q N T Q DdeI BseMII | ApoI |BsrI | TspEI TaqII |BspCNI \ \ \ \\ ACAACGGGTTCTAAGAATTTGGACACTCTTTTGGGTGGTGGTGTGGAAACTGGTTCTATT 490 500 510 520 530 540 ----:----|----:----|----:----|----:----|----:----|----:----| TGTTGCCCAAGATTCTTAAACCTGTGAGAAAACCCACCACCACACCTTTGACCAAGATAA / // // DdeI |TaqII |BspCNI TspEI |BsrI ApoI BseMII T T G S K N L D T L L G G G V E T G S I Q R V L R I W T L F W V V V W K L V L L N G F * E F G H S F G W W C G N W F Y Y ----:----|----:----|----:----|----:----|----:----|----:----| V V P E L F K S V R K P P P T S V P E I S L P N * S N P C E K P H H H P F Q N * C R T R L I Q V S K Q T T T H F S T R N BseYI ApoI | AluI TspEI | GsaI EcoRI | CviJI CfrI DdeI | BslFI | |BceAI | CviJI | AluI | | Hpy178III* | ||SetI | HaeIII | CviJI | | | SetI | ||| MaeIII | | MaeIII | | SetI | | | HphI DrdI | ||| Tsp45I | | Tsp45I \ \ \ \ \ \ \ \ \ \\\ \ \ \ \ ACTGAGCTTTTCGGTGAATTCAGGACAGGTAAGTCCCAGCTATGTCACACTTTGGCCGTG 550 560 570 580 590 600 ----:----|----:----|----:----|----:----|----:----|----:----| TGACTCGAAAAGCCACTTAAGTCCTGTCCATTCAGGGTCGATACAGTGTGAAACCGGCAC /// / /// / / / / / / / / / ||CviJI | ||| | DrdI | | | BceAI Tsp45I | CfrI ||AluI | ||| SetI | | BseYI MaeIII HaeIII |DdeI | ||HphI | | CviJI CviJI SetI | |Hpy178III* | | AluI | BslFI | SetI EcoRI GsaI TspEI ApoI T E L F G E F R T G K S Q L C H T L A V L S F S V N S G Q V S P S Y V T L W P * * A F R * I Q D R * V P A M S H F G R D ----:----|----:----|----:----|----:----|----:----|----:----| V S S K P S N L V P L D W S H * V K A T * Q A K R H I * S L Y T G A I D C K P R S L K E T F E P C T L G L * T V S Q G H FatI |CviAII || NspI || NlaIII TaqI || | ApoI Hin4II* SetI ClaI || | TspEI |AciI | HphI | Hin4II* \\ \ \ \\ \ \ \ \ ACATGCCAAATTCCATTGGATATTGGTGGCGGTGAAGGTAAGTGTTTGTATATCGATACC 610 620 630 640 650 660 ----:----|----:----|----:----|----:----|----:----|----:----| TGTACGGTTTAAGGTAACCTATAACCACCGCCACTTCCATTCACAAACATATAGCTATGG // // / / / / / // || |FatI TspEI | | SetI HphI |ClaI || CviAII ApoI | AciI |TaqI |Tsp45I Hin4II* Hin4II* |MaeIII NlaIII NspI T C Q I P L D I G G G E G K C L Y I D T H A K F H W I L V A V K V S V C I S I P M P N S I G Y W W R * R * V F V Y R Y R ----:----|----:----|----:----|----:----|----:----|----:----| V H W I G N S I P P P S P L H K Y I S V S M G F E M P Y Q H R H L Y T N T Y R Y C A L N W Q I N T A T F T L T Q I D I G AluI CviJI |DdeI |EspI* ||SetI ||BciVI ||| AciI ||| NspBII* ||| | Hpy188I ||| | | BspCNI ||| | | |BseMII ||| | | || SfaNI CviJI ||| | | || | BssKI Csp6I Cfr10I ||| | | || | | HpaII |RsaI HaeIII ||| | | || | | ScrFI |SetI |HpaII BsaBI ||| | | || | | CauII* \\ \\ \ \\\ \ \ \\ \ \ \ GAAGGTACTTTCAGGCCGGTAAGATTGGTATCCATAGCTCAGCGGTTCGGATTAGACCCG 670 680 690 700 710 720 ----:----|----:----|----:----|----:----|----:----|----:----| CTTCCATGAAAGTCCGGCCATTCTAACCATAGGTATCGAGTCGCCAAGCCTAATCTGGGC / // / // / / // // / /// /// | |Csp6I | |Cfr10I BsaBI | || || | ||BseMII ||HpaII | RsaI | HpaII | || || | |BspCNI |CauII* SetI HaeIII | || || | Hpy188I |ScrFI CviJI | || || AciI SfaNI | || |NspBII* | || EspI* | || DdeI | |BciVI | CviJI | AluI SetI E G T F R P V R L V S I A Q R F G L D P K V L S G R * D W Y P * L S G S D * T R R Y F Q A G K I G I H S S A V R I R P G ----:----|----:----|----:----|----:----|----:----|----:----| S P V K L G T L N T D M A * R N P N S G R L Y K * A P L I P I W L E A T R I L G F T S E P R Y S Q Y G Y S L P E S * V R FokI MwoI | AclI | EcoP15I MseI | MaeII | | MboI | BbvI | | SetI CviRI* | | | DpnI | SfaNI BseGI | | TaiI | CviJI | | | |BstKTI | | BbvI \ \ \ \ \ \ \ \ \ \\ \ \ \ GATGATGCTTTGAACAACGTTGCGTATGCAAGAGCCTATAACGCCGATCATCAGTTAAGA 730 740 750 760 770 780 ----:----|----:----|----:----|----:----|----:----|----:----| CTACTACGAAACTTGTTGCAACGCATACGTTCTCGGATATTGCGGCTAGTAGTCAATTCT / / // / / / / /// / / | BseGI || MaeII | | MwoI ||| MboI MseI BssKI || AclI | CviJI ||DpnI |FokI CviRI* |BstKTI TaiI EcoP15I SetI D D A L N N V A Y A R A Y N A D H Q L R M M L * T T L R M Q E P I T P I I S * D * C F E Q R C V C K S L * R R S S V K T ----:----|----:----|----:----|----:----|----:----|----:----| S S A K F L T A Y A L A * L A S * * N L P H H K S C R Q T H L L R Y R R D D T L I I S Q V V N R I C S G I V G I M L * S Hpy178III* | TseI | |BisI | ||BlsI | ||BseGI | |||TseI | ||||BisI | |||||BlsI | |||||| BplI BsmAI TaqI | |||||| BplI |PleI BplI | TfiI | |||||| |FokI HinfI ||MlyI BplI | HinfI \ \\\\\\ \\ \ \\\ \ \ \ CTTCTGGATGCTGCTGCCCAAATGATGAGCGAGTCTCGGTTTTCCTTGATTGTGGTCGAT 790 800 810 820 830 840 ----:----|----:----|----:----|----:----|----:----|----:----| GAAGACCTACGACGACGGGTTTACTACTCGCTCAGAGCCAAAAGGAACTAACACCAGCTA / / / /////// / / / / / / | | | ||||||TseI FokI HinfI | | BplI TaqI | | | |||||BisI | | BplI | | | ||||BlsI | BsmAI | | | |||TseI PleI | | | |||BplI MlyI | | | |||BplI | | | ||BisI | | | |BlsI | | | BseGI | | Hpy178III* | BbvI SfaNI BbvI L L D A A A Q M M S E S R F S L I V V D F W M L L P K * * A S L G F P * L W S I S G C C C P N D E R V S V F L D C G R F ----:----|----:----|----:----|----:----|----:----|----:----| S R S A A A W I I L S D R N E K I T T S V E P H Q Q G F S S R T E T K R S Q P R K Q I S S G L H H A L R P K G Q N H D I TspGWI | Hpy166II | | DdeI SplI* | | | Hin6I Tsp4CI* | | | |GlaI |Csp6I | | | ||HhaI CviJI ||RsaI | | | ||HphI \ \\\ \ \ \ \\\ TCTGTTATGGCTCTATACCGTACGGATTTTTCTGGTCGTGGTGAACTAAGCGCAAGGCAA 850 860 870 880 890 900 ----:----|----:----|----:----|----:----|----:----|----:----| AGACAATACCGAGATATGGCATGCCTAAAAAGACCAGCACCACTTGATTCGCGTTCCGTT / / / /// / / //// HinfI CviJI | ||SplI* TspGWI | |||Hin6I TfiI | |Csp6I | ||HphI | RsaI | ||GlaI Tsp4CI* | |HhaI | DdeI Hpy166II S V M A L Y R T D F S G R G E L S A R Q L L W L Y T V R I F L V V V N * A Q G K C Y G S I P Y G F F W S W * T K R K A N ----:----|----:----|----:----|----:----|----:----|----:----| E T I A R Y R V S K E P R P S S L A L C N Q * P E I G Y P N K Q D H H V L R L A R N H S * V T R I K R T T T F * A C P L Cac8I |TsoI || MwoI || | CviRI* || | | CviJI CviRI* || | | | CfrI | EcoT22I || | | | Cac8I | | CviJI || | | | | CviJI | | | ApoI || | | | | HaeIII | | | TspEI || | | | | | TspEI CviRI* \ \ \ \ \\ \ \ \ \ \ \ \ ATGCATTTAGCCAAATTTATGCGTGCTTTGCAAAGGCTGGCCGACCAATTTGGTGTTGCA 910 920 930 940 950 960 ----:----|----:----|----:----|----:----|----:----|----:----| TACGTAAATCGGTTTAAATACGCACGAAACGTTTCCGACCGGCTGGTTAAACCACAACGT / / / / /// / / / / / / / | CviRI* CviJI | ||MwoI | | | | CfrI TspEI CviRI* EcoT22I | |Cac8I | | | HaeIII | TsoI | | | CviJI TspEI | | Cac8I ApoI | CviJI CviRI* M H L A K F M R A L Q R L A D Q F G V A C I * P N L C V L C K G W P T N L V L Q A F S Q I Y A C F A K A G R P I W C C S ----:----|----:----|----:----|----:----|----:----|----:----| I C K A L N I R A K C L S A S W N P T A F A N L W I * A H K A F A P R G I Q H Q H M * G F K H T S Q L P Q G V L K T N C CviJI | MseI | | BinI* | | | Hpy178III* | | | | MboI | | | | XhoII MaeIII BccI XcmI | | | | | DpnI |Hpy99I TsoI BstXI | | | | | |BstKTI \\ \ \ \ \ \ \ \ \\ GTCGTCGTTACTAACCAAGTGGTCGCCCAAGTTGATGGTGGTATGGCTTTTAATCCAGAT 970 980 990 1000 1010 1020 ----:----|----:----|----:----|----:----|----:----|----:----| CAGCAGCAATGATTGGTTCACCAGCGGGTTCAACTACCACCATACCGAAAATTAGGTCTA / / / // / / // /// Hpy99I MaeIII | || XcmI CviJI || ||DpnI | |BstXI || |BstKTI | BccI || Hpy178III* TsoI |BinI* MseI V V V T N Q V V A Q V D G G M A F N P D S S L L T K W S P K L M V V W L L I Q I R R Y * P S G R P S * W W Y G F * S R S ----:----|----:----|----:----|----:----|----:----|----:----| T T T V L W T T A W T S P P I A K L G S L R R * * G L P R G L Q H H Y P K * D L D D N S V L H D G L N I T T H S K I W I CviJI BsiYI* SspI MboII FnuDII* SetI \ \ \ \ \ \ CCAAAGAAGCCTATCGGTGGTAATATTATGGCACATTCTTCCACCACGCGATTAGGTTTC 1030 1040 1050 1060 1070 1080 ----:----|----:----|----:----|----:----|----:----|----:----| GGTTTCTTCGGATAGCCACCATTATAATACCGTGTAAGAAGGTGGTGCGCTAATCCAAAG / / / / / / / XhoII | BsiYI* | MboII | SetI MboI CviJI SspI FnuDII* P K K P I G G N I M A H S S T T R L G F Q R S L S V V I L W H I L P P R D * V S K E A Y R W * Y Y G T F F H H A I R F Q ----:----|----:----|----:----|----:----|----:----|----:----| G F F G I P P L I I A C E E V V R N P K D L S A * R H Y Y * P V N K W W A I L N W L L R D T T I N H C M R G G R S * T E FokI | CviRI* | | MlyI | | PleI | | |HphI | | || HindII | | || Hpy166II SetI BseGI | | || |HinfI | MnlI \ \ \ \\ \\ \ \ AAAAAGGGTAAGGGATGTCAAAGATTATGCAAAGTTGTTGACTCACCTTGCTTACCAGAG 1090 1100 1110 1120 1130 1140 ----:----|----:----|----:----|----:----|----:----|----:----| TTTTTCCCATTCCCTACAGTTTCTAATACGTTTCAACAACTGAGTGGAACGAATGGTCTC / // // / // / / BseGI || || | |SetI MnlI AlwNI || || | HinfI || || Hpy166II || || HindII || |PleI || MlyI || HphI |FokI CviRI* K K G K G C Q R L C K V V D S P C L P E K R V R D V K D Y A K L L T H L A Y Q R K G * G M S K I M Q S C * L T L L T R G ----:----|----:----|----:----|----:----|----:----|----:----| L F P L P H * L N H L T T S E G Q K G S * F P Y P I D F I I C L Q Q S V K S V L F L T L S T L S * A F N N V * R A * W L Hpy178III* |NruI |FnuDII* ||AjuI MboII ||MboI MaeIII ||| DpnI Tsp45I CviJI ||| |BstKTI BstEII HphI AlwNI ||| || BccI |TspDTI AjuI \ \\\ \\ \ \\ \ GCTGAATGTGTGTTCGCGATCTATGAAGATGGTGTTGGTGACCCCAGAGAAGAAGACGAG 1150 1160 1170 1180 1190 1200 ----:----|----:----|----:----|----:----|----:----|----:----| CGACTTACACACAAGCGCTAGATACTTCTACCACAACCACTGGGGTCTCTTCTTCTGCTC / / //// / / / / / / / CviJI | |||| | BccI | | | HphI MboII | |||| MboI | | AjuI | |||DpnI | BstEII | ||BstKTI | Tsp45I | |Hpy178III* | MaeIII | FnuDII* TspDTI | NruI MboII AjuI A E C V F A I Y E D G V G D P R E E D E L N V C S R S M K M V L V T P E K K T S * M C V R D L * R W C W * P Q R R R R V ----:----|----:----|----:----|----:----|----:----|----:----| A S H T N A I * S S P T P S G L S S S S P Q I H T R S R H L H H Q H G W L L L R S F T H E R D I F I T N T V G S F F V L MboII \ TAG --- ATC * X X --- Y T L # Enzymes that cut Frequency Isoschizomers AciI 7 BspACI,SsiI AclI 1 Psp1406I AjuI 1 AluI 7 AluBI AlwNI 1 CaiI ApoI 4 AcsI,XapI BbvI 5 BseXI,BstV1I,Lsp1109I BccI 4 BceAI 4 BcgI 1 BciVI 1 BfuI BinI* 1 AlwI,BspPI,AclWI BisI 6 Fnu4HI,Fsp4HI,GluI,ItaI,SatI BlsI 6 BplI 2 Bpu10I 1 BsaBI 1 Bse8I,BseJI BseGI 5 BstF5I,BtsCI BseMII 2 BseYI 1 BsiYI* 1 Bsc4I,BseLI,BslI,AfiI BslFI 1 BsmFI,FaqI BsmAI 2 Alw26I,BstMAI BspCNI 2 BsrI 1 BseNI,Bse1I,BsrSI BssKI 1 BstSCI,StyD4I BstEII 1 BstPI,Eco91I,EcoO65I,PspEI BstKTI 4 BstXI 1 BtgZI 1 BtsI 1 Cac8I 3 BstC8I CauII* 1 BcnI,BpuMI,NciI,AsuC2I Cfr10I 1 BsrFI,BssAI,Bse118I CfrI 2 AcoI,EaeI ClaI 1 Bsa29I,BseCI,BshVI,BspDI,BspXI,Bsu15I,BsuTUI,BanIII Csp6I 4 CviQI,RsaNI CviAII 1 CviJI 22 CviKI-1 CviRI* 7 HpyCH4V DdeI 7 BstDEI,HpyF3I DpnI 4 MalI DrdI 1 AasI,DseDI EciI 2 Eco57I 2 AcuI Eco57MI 2 EcoP15I 4 EcoRI 1 EcoT22I 1 Mph1103I,NsiI,Zsp2I EspI* 1 Bpu1102I,Bsp1720I,CelII,BlpI FatI 1 FnuDII* 2 Bsh1236I,BspFNI,BstFNI,BstUI,MvnI,AccII FokI 5 GlaI 2 GsaI 1 HaeIII 4 BsnI,BsuRI,BshFI,PhoI HhaI 2 BstHHI,CfoI,AspLEI Hin4II* 2 HpyAV Hin6I 2 HinP1I,HspAI HindII 1 HincII HinfI 4 HpaII 3 HapII,BsiSI,MspI HphI 6 AsuHPI Hpy166II 4 Hpy8I Hpy178III* 5 Hpy188III Hpy188I 4 Hpy99I 1 MaeI 1 FspBI,BfaI,XspI MaeII 1 HpyCH4IV MaeIII 6 MboI 4 Bsp143I,BssMI,BstMBI,DpnII,Kzo9I,BfuCI,NdeII,Sau3AI MboII 5 MlyI 3 SchI MnlI 3 MseI 2 Tru1I,Tru9I MwoI 4 HpyF10VI,BstMWI NdeI 2 FauNDI NlaIII 1 Hin1II,Hsp92II,FaeI NlaIV 1 BspLI,BmiI,PspN4I NruI 1 BtuMI,Bsp68I NspBII* 1 MspA1I NspI 1 BstNSI,XceI PleI 3 PpsI RsaI 4 AfaI SauI* 1 Bse21I,Bsu36I,Eco81I,AxyI ScrFI 1 BmrFI,MspR9I,Bme1390I SetI 17 SfaNI 2 LweI SmlI 1 SmoI SplI* 1 Pfl23II,PspLI,BsiWI SspI 1 TaiI 1 TaqI 2 TaqII 1 TauI 1 TfiI 1 PfeI TseI 5 ApeKI TsoI 2 Tsp45I 5 NmuCI Tsp4CI* 5 HpyCH4III,TaaI,Bst4CI TspDTI 4 TspEI 5 TasI,Tsp509I,Sse9I TspGWI 1 TspRI 2 TscAI XcmI 1 XhoII 1 BstYI,MflI,PsuI,BstX2I # Enzymes which cut less frequently than the MINCUTS criterion # Enzymes < MINCUTS Frequency Isoschizomers # Enzymes which cut more frequently than the MAXCUTS criterion # Enzymes > MAXCUTS Frequency Isoschizomers # Enzymes that do not cut AarI AatII AbsI Acc65I AccI AcyI AflII AflIII AgeI AhaIII* AlfI AloI ApaI ApaLI AscI Asp718I AsuI* AsuII AvaI AvaII AvrII BaeI BalI BamHI BarI BbvCI BbvII* Bce83I* BclI BdaI BetI* BfiI BglI BglII BmeT110I BmgT120I BmtI BsaAI BsaXI BseBI BsePI BseRI BseSI BsgI BsiI* BsmI Bsp120I Bsp1407I BspHI BspLU11I* BspMI BspMII* BspOI BsrBI BsrDI BssNAI Bst1107I Bst2UI BstAPI BstNI BstOI BstZ17I BtrI Cfr9I CspCI DinI DraII DraIII DsaI* Eam1105I Ecl136II Eco31I Eco47III EcoICRI EcoNI EcoRII EcoRV EgeI EheI Esp3I FalI FauI FseI FspAI GsuI HaeII HgaI HgiAI* HgiCI* HgiJII* Hin4I HindIII HpaI KasI KpnI Ksp632I* MauBI McrI* MfeI MluI MmeI MroNI MslI MstI* MvaI NaeI NarI NcoI NgoMIV NheI NmeAIII NotI OliI PacI PasI PflMI PfoI PmaCI PmeI PpiI PpuMI PshAI PsiI PspOMI PspXI PsrI PstI PvuI PvuII RsrII SacI SacII SalI SanDI SapI ScaI SduI SecI* SexAI SfeI* SfiI SfoI SgfI SgrAI SgrDI SmaI SnaBI SpeI SphI SrfI Sse232I* Sse8387I StuI StyI SwaI TatI TspMI TstI Tth111I VspI XbaI XhoI XmaCI XmaI XmaIII* XmnI ZraI # No. of cutting enzymes which do not match the # SITELEN, BLUNT, STICKY, COMMERCIAL, AMBIGUOUS criteria 769